ID: 1145949166

View in Genome Browser
Species Human (GRCh38)
Location 17:28802490-28802512
Sequence TTGGGTTACCACCTGGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145949166_1145949170 12 Left 1145949166 17:28802490-28802512 CCATCAACCAGGTGGTAACCCAA 0: 1
1: 0
2: 2
3: 16
4: 133
Right 1145949170 17:28802525-28802547 GAGATTCACAAGTGCATTCATGG 0: 1
1: 0
2: 2
3: 27
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145949166 Original CRISPR TTGGGTTACCACCTGGTTGA TGG (reversed) Intronic
903916342 1:26767252-26767274 AAGGTTTCCCACCTGGTTGAAGG - Intronic
907927662 1:58969562-58969584 TAGGGTTAACACCTAGGTGAAGG + Intergenic
908292813 1:62685777-62685799 TTGGGCAACCACGTGGATGATGG - Intronic
909171482 1:72301520-72301542 TCAGGTCACCACCTCGTTGATGG - Intergenic
911524349 1:98965780-98965802 TTGAGTTACCACCAGTTAGAGGG - Intronic
912600076 1:110921913-110921935 TGGGCTTAACACCTGGGTGATGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
916139726 1:161685142-161685164 TCGGGTCACCACCTCGTTGATGG + Intergenic
922451905 1:225744284-225744306 TGGGCTTAACACCTGGGTGATGG + Intergenic
922797813 1:228349847-228349869 TTGGGTCCCCACCTGGGTGACGG + Intronic
923824988 1:237490230-237490252 TTTGCTCACTACCTGGTTGATGG + Intronic
1063661237 10:8036196-8036218 TTGTGTTACAACCTGGGGGAGGG - Intergenic
1065094468 10:22267034-22267056 TTGGGCCACCACCTTGCTGATGG - Intergenic
1067751760 10:48976390-48976412 TTTGGATGCCACCTGGTGGATGG - Intronic
1068668707 10:59702967-59702989 TTTGGTTTCCACTTGGATGAGGG - Intronic
1069070543 10:63987039-63987061 TTGAGTTATCACCTTTTTGAAGG + Intergenic
1071045433 10:81369353-81369375 TGGGCTTAACACCTGGGTGATGG - Intergenic
1071696965 10:87886816-87886838 TTGAGTTACCACATGGCAGAAGG - Intronic
1072578251 10:96719697-96719719 TTGGGTTGCCTTCTGGTTCATGG - Intronic
1072858239 10:98973235-98973257 TTGTGTTACTACTTTGTTGATGG - Intronic
1075822746 10:125328743-125328765 TTGGGTTAGAATCTGGTGGAGGG + Intergenic
1076050962 10:127332789-127332811 GTGAGTCACCACCTGGATGAAGG + Intronic
1078733656 11:13999949-13999971 TTTAGTAACCACCTGGTAGAAGG - Intronic
1081402173 11:42656048-42656070 TTGGCTTAATACCTGGGTGATGG + Intergenic
1083702080 11:64486174-64486196 TTGGGGTTCCCCCTGGTTGGTGG + Intergenic
1085225773 11:74919633-74919655 TCGGGTCACCACCTCATTGATGG - Intronic
1086647331 11:89240138-89240160 TGGGCTTAATACCTGGTTGATGG + Intronic
1090239467 11:125171938-125171960 TGTGGTTAACACCTGGTTGGTGG - Intronic
1090994534 11:131853333-131853355 TTGGGTTAATACCTGGGTGATGG - Intronic
1092176271 12:6409945-6409967 TCGGGTCACCACTTCGTTGATGG + Intergenic
1092793313 12:12087911-12087933 TTGAGTTACCACCAGCCTGATGG - Intronic
1096051127 12:48609046-48609068 TGGGCTTAAGACCTGGTTGATGG - Intergenic
1097846938 12:64376543-64376565 TGGGCTTAACACCTGGGTGATGG - Intronic
1098234603 12:68406461-68406483 ATGGGTTCCCACCTAGTGGAGGG - Intergenic
1102123408 12:110461034-110461056 TCGGGTTACCACTTCGTTGATGG - Intronic
1102269360 12:111519125-111519147 TTTGGTAACCACCTAGTTAAGGG - Intronic
1103375259 12:120450741-120450763 TTGGGTCACCACCTAGTTGATGG + Intronic
1107247752 13:38318064-38318086 TGGGGTTAATACCTGTTTGATGG - Intergenic
1110714899 13:78690466-78690488 TTGGCTCAGCACCTGGGTGATGG + Intergenic
1110945212 13:81405668-81405690 TTGGGTTAACTCTTGATTGATGG - Intergenic
1111531051 13:89538421-89538443 TAGGCTTACTACCTGGGTGATGG - Intergenic
1112324211 13:98432666-98432688 TTGGCTTAAAACCTGGGTGACGG + Intronic
1115172994 14:30529564-30529586 TTTGCTTGCCACCTGGTTAAGGG + Intergenic
1117738865 14:58794698-58794720 TCGGGTTACCACTTCGTTGATGG - Intergenic
1123453935 15:20399502-20399524 TGGGCTTAATACCTGGTTGATGG - Intergenic
1125981355 15:44004633-44004655 TTGGGGGAACAGCTGGTTGATGG - Intronic
1126125549 15:45292344-45292366 TTTAGTTACCTCCTGGTTGTTGG + Intergenic
1129413929 15:75364362-75364384 GAGGGTTTCCACCTGCTTGAGGG - Intronic
1130995397 15:88900629-88900651 TTGGGTTTACACCTGGATGTTGG - Intronic
1131842086 15:96448200-96448222 TCGGGTCACCACCTCATTGATGG - Intergenic
1133572452 16:7054681-7054703 TTTAGTTACCACATCGTTGAAGG + Intronic
1134516416 16:14890888-14890910 TTCAGTTAGCCCCTGGTTGAGGG + Intronic
1134704089 16:16289540-16289562 TTCAGTTAGCCCCTGGTTGAGGG + Intronic
1134963454 16:18422574-18422596 TTCAGTTAGCCCCTGGTTGAGGG - Intronic
1134967749 16:18505173-18505195 TTCAGTTAGCCCCTGGTTGAGGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141027151 16:80559415-80559437 ATGGGATGCCACCTGGTTAATGG - Intergenic
1145949166 17:28802490-28802512 TTGGGTTACCACCTGGTTGATGG - Intronic
1150332886 17:64308622-64308644 TCGGGTCACCATCTCGTTGATGG + Intergenic
1155281111 18:24240867-24240889 TTGGGATACCACCTGGGTTTGGG - Intronic
1156458029 18:37305656-37305678 TGGGGTTACCAGCTGGTGGGTGG - Intronic
1159327885 18:66947724-66947746 TGGGCTTAACACCTGGGTGATGG + Intergenic
1159966430 18:74599655-74599677 GTGGGTATTCACCTGGTTGAAGG + Intronic
926170405 2:10549612-10549634 TTGGGGTACCAGCTGGAAGAAGG + Intergenic
926481346 2:13399728-13399750 TGGGCTTAATACCTGGTTGATGG + Intergenic
926536832 2:14123397-14123419 TTGTGATACCAGCTGCTTGAGGG - Intergenic
928987343 2:37194669-37194691 TTGGGTCATCACCTCGTTGATGG + Intronic
930463367 2:51712416-51712438 TTGGCTTAACACCTAGGTGATGG - Intergenic
931392570 2:61856738-61856760 TTGGGTCACTACCTTGTTGATGG - Intergenic
935219848 2:101002748-101002770 TCGGGTTACCACTTCGTTGATGG - Exonic
936146272 2:109982278-109982300 TTGGCTTACTTCCTGGTTGCAGG - Intergenic
936198419 2:110389201-110389223 TTGGCTTACTTCCTGGTTGCAGG + Intergenic
943039590 2:182788138-182788160 TCGGGTCACCACCTCATTGATGG - Exonic
945384163 2:209177299-209177321 TATAGTTACCACCTGGGTGATGG - Intergenic
946732946 2:222726503-222726525 TTGGGTCACCACCTCGTTGATGG - Intergenic
946862222 2:224011211-224011233 TTGGGTCACCTCTTGGTTGCTGG - Intronic
947048423 2:226015149-226015171 TTGGTTTACCTCTTGGTTCATGG - Intergenic
947556045 2:231094117-231094139 TAGGGTTAACACCTGTTGGAGGG + Intronic
947688309 2:232110751-232110773 TGGGCTTAACACCTGGGTGATGG + Intronic
948323587 2:237092661-237092683 TTAGGTTACAGGCTGGTTGAAGG + Intronic
1171244213 20:23597016-23597038 TTGTATTACCACATGGCTGAAGG + Intergenic
1173368244 20:42408902-42408924 TTGGGTAATCACATGGGTGAAGG + Intronic
1176359993 21:5987278-5987300 TCAGGTCACCACCTTGTTGATGG + Intergenic
1177022481 21:15880471-15880493 TGGGGTTAATACCTGGGTGATGG - Intergenic
1179615540 21:42580875-42580897 TTGGTTTCCAACCTGGTTGTCGG - Exonic
1179763525 21:43551272-43551294 TCAGGTCACCACCTTGTTGATGG - Intronic
1180068100 21:45422749-45422771 TTGGGAGACCACCTGGTGGGTGG + Intronic
1182956523 22:34431836-34431858 TTGGGATGCCACCTGATTTATGG + Intergenic
1185095167 22:48802488-48802510 TTGGTTTACTCTCTGGTTGAAGG + Intronic
949156590 3:834246-834268 TGGGCTTAACACCTGGATGATGG + Intergenic
951322031 3:21256649-21256671 TTGGCTTAGTAGCTGGTTGATGG + Intergenic
951605575 3:24430791-24430813 TTGGGTCACCACCTTGTTAAAGG - Intronic
952985489 3:38777132-38777154 TTGAATTACCATCTTGTTGAAGG + Intronic
956831220 3:73050501-73050523 TTGGTTTTCCACCAGTTTGAGGG + Intronic
958643374 3:96837970-96837992 TGGGCTTAACACCTGGGTGATGG - Intronic
960574916 3:119220009-119220031 TTGGGATGCCACTTGTTTGATGG - Intronic
967902724 3:194473040-194473062 TCTGCTTACTACCTGGTTGATGG + Intronic
969860180 4:10029380-10029402 TTGGCTTGCCACCTTGATGATGG + Intronic
970212898 4:13729708-13729730 TATGCTTACCACCTGGGTGACGG + Intergenic
970712651 4:18881533-18881555 TTGAGTGAGCACATGGTTGATGG - Intergenic
971996217 4:33968220-33968242 TCGGGTCACCACTTCGTTGATGG - Intergenic
976720378 4:88163625-88163647 TTGGGTCACTACCTCGTTTATGG - Intronic
985682653 5:1264631-1264653 TCAGGTTACCTCCTGGGTGACGG - Intronic
986448234 5:7841879-7841901 TGGGCTTACTACCTGGGTGATGG + Intronic
986460292 5:7963224-7963246 TTGGGTTACGTCCAGGTTCATGG + Intergenic
988311565 5:29565606-29565628 TTGGGTTACAACATGGGAGATGG - Intergenic
990870818 5:60430209-60430231 TCGGGTCACCATCTCGTTGATGG + Intronic
991077864 5:62562153-62562175 TCAGGTCACCACCTTGTTGATGG + Intronic
992043961 5:72866148-72866170 TATGGTTACCACCTAGGTGATGG - Intronic
994692408 5:103034799-103034821 TTGGGTGAACAGCAGGTTGATGG - Intergenic
997119173 5:131156634-131156656 TTGGGTTCCCACATGGTGAAAGG + Intergenic
999514570 5:152288038-152288060 TTGGGTATCCACCTTGTTTAAGG - Intergenic
999589947 5:153133935-153133957 TTGGGTTTCCACATGATGGAAGG - Intergenic
1001543053 5:172552547-172552569 TGGTGTTAGCTCCTGGTTGATGG + Intergenic
1004222808 6:13760896-13760918 TTGTGCTACCTCTTGGTTGAGGG - Intergenic
1006211458 6:32399023-32399045 TGGGCTTAACACCTGGGTGATGG - Intronic
1007172026 6:39870724-39870746 TTGGTTTTCAAACTGGTTGATGG + Intronic
1007831012 6:44638325-44638347 TATGCTTACCACCTGGGTGACGG + Intergenic
1008629988 6:53354734-53354756 TTGGATCACCACCTCATTGATGG - Intergenic
1008631757 6:53368698-53368720 TCGGGTCACCACCTCATTGATGG - Intergenic
1013624064 6:111919836-111919858 TTGTGTTACCAGCTGGTTTGGGG - Intergenic
1013726807 6:113108057-113108079 TGGGCTTAACACCTGGGTGATGG - Intergenic
1017296523 6:152802199-152802221 TACGCTTACCACCTGGTTGATGG - Intergenic
1024794971 7:53009089-53009111 TTGGCTTAATACCTGGGTGATGG - Intergenic
1024929609 7:54656403-54656425 TCGGGTCACCACCTCGTTGATGG - Intergenic
1026047202 7:66914627-66914649 TCGGGTCACCACCTCGTTGATGG - Intergenic
1031476916 7:122234577-122234599 TCGGGTCACCACCTCGTTGATGG - Intergenic
1031731047 7:125300810-125300832 TCGGGTCACCACCTCGTTGATGG + Intergenic
1032385503 7:131520180-131520202 TCGGGTCACCACCTCGTTGATGG - Intronic
1040095677 8:43440204-43440226 TTGGGTTACCTTCTGGCTCAGGG - Intergenic
1040739783 8:50559062-50559084 TTTGCTCACCACCTGGTTGATGG - Intronic
1042090649 8:65155447-65155469 TTGGATCACCACCTCTTTGATGG - Intergenic
1042498347 8:69481552-69481574 TTGGCTTAATACCTGGGTGATGG - Intronic
1043207736 8:77468342-77468364 TTGGGTTACCTGCTGCATGAAGG + Intergenic
1044657642 8:94565082-94565104 TCGGGTCACCACCTCATTGATGG - Intergenic
1049204538 8:141357627-141357649 ATCGGTCACCACCAGGTTGATGG + Exonic
1050990698 9:12148409-12148431 TTGGGTTAGCATCTGACTGATGG + Intergenic
1051221240 9:14850615-14850637 TGGGCTTACTACCTGGGTGATGG + Intronic
1051456296 9:17262629-17262651 CGGGGTTAACACCTAGTTGATGG + Intronic
1052364321 9:27595241-27595263 TATGTTTACCACCTGGGTGATGG + Intergenic
1053803099 9:41776337-41776359 TTGGTTTACAACCTGATGGAGGG - Intergenic
1054142167 9:61538785-61538807 TTGGTTTACAACCTGATGGAGGG + Intergenic
1054191389 9:61987647-61987669 TTGGTTTACAACCTGATGGAGGG - Intergenic
1054461920 9:65469970-65469992 TTGGTTTACAACCTGATGGAGGG + Intergenic
1054646980 9:67600070-67600092 TTGGTTTACAACCTGATGGAGGG + Intergenic
1062510422 9:136902313-136902335 TTGGGGTACCAGCTGGCTGCAGG + Intronic
1186453706 X:9693996-9694018 TTGGGTTCCCACCCCATTGATGG - Intronic
1186593766 X:10958972-10958994 CTGGCTTAACACCTGGGTGATGG + Intergenic
1187057184 X:15752094-15752116 TTGGGTTACAGCATGGTTTAGGG + Intronic
1187396283 X:18922316-18922338 TTCAGTTACCACCTGGTGCATGG - Intronic
1192135909 X:68600145-68600167 TCGGGTCACCATCTTGTTGATGG - Intergenic
1193294042 X:79813085-79813107 TGGGTTTAATACCTGGTTGATGG - Intergenic