ID: 1145950390

View in Genome Browser
Species Human (GRCh38)
Location 17:28812505-28812527
Sequence ATTGGCTGTGCAGACAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145950390_1145950400 25 Left 1145950390 17:28812505-28812527 CCTCTCCTGTCTGCACAGCCAAT 0: 1
1: 0
2: 2
3: 26
4: 247
Right 1145950400 17:28812553-28812575 ACTCGCCAAACAGCCAACTGGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1145950390_1145950399 24 Left 1145950390 17:28812505-28812527 CCTCTCCTGTCTGCACAGCCAAT 0: 1
1: 0
2: 2
3: 26
4: 247
Right 1145950399 17:28812552-28812574 GACTCGCCAAACAGCCAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 34
1145950390_1145950401 28 Left 1145950390 17:28812505-28812527 CCTCTCCTGTCTGCACAGCCAAT 0: 1
1: 0
2: 2
3: 26
4: 247
Right 1145950401 17:28812556-28812578 CGCCAAACAGCCAACTGGGGAGG 0: 1
1: 0
2: 1
3: 4
4: 62
1145950390_1145950398 23 Left 1145950390 17:28812505-28812527 CCTCTCCTGTCTGCACAGCCAAT 0: 1
1: 0
2: 2
3: 26
4: 247
Right 1145950398 17:28812551-28812573 CGACTCGCCAAACAGCCAACTGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145950390 Original CRISPR ATTGGCTGTGCAGACAGGAG AGG (reversed) Intronic
900416690 1:2538520-2538542 AGGGGCTCTGCACACAGGAGGGG - Intergenic
900416701 1:2538572-2538594 AGCGGCTCTGCACACAGGAGGGG - Intergenic
900416705 1:2538590-2538612 AGGGGCTCTGCACACAGGAGCGG - Intergenic
901896784 1:12320288-12320310 ATGGGGTGTGGAGACAGAAGGGG + Intronic
904345057 1:29862438-29862460 ACTGGCTTTGCATAGAGGAGTGG - Intergenic
905621907 1:39455616-39455638 ATAGAGTGTGCATACAGGAGTGG + Intronic
908028688 1:59976922-59976944 ATTGGCAGAGCAGAAAGGACGGG + Intergenic
908319721 1:62967568-62967590 AGAGGATGTGCAGAAAGGAGGGG + Intergenic
911098105 1:94072225-94072247 ATTGACTGTGTTGACAGCAGAGG + Intronic
911303496 1:96205046-96205068 ATTGGCAGTACAGATAGGAAAGG - Intergenic
911439428 1:97907095-97907117 ATGGGCTGGGCAGGAAGGAGCGG + Intronic
912143308 1:106758541-106758563 ATTGGCTGGGCAGGAAGGGGTGG - Intergenic
912297569 1:108485145-108485167 ATTGACTGTGCAACCAGGATAGG - Intergenic
913429563 1:118776113-118776135 AATGGGTGTGTATACAGGAGAGG - Intergenic
916688084 1:167165980-167166002 AATGGTTGAGCAGACAGTAGTGG + Intergenic
917674244 1:177304273-177304295 ATTAGCTGTGCAGCCAGTTGAGG + Intergenic
919843820 1:201628589-201628611 GAGGGCTGTGCAGGCAGGAGGGG - Intronic
920527100 1:206675217-206675239 ATTGGCTCTGCAGACACAAGTGG + Intronic
921325386 1:213982984-213983006 CTTGGCCGCGCAGGCAGGAGGGG + Intergenic
921578526 1:216867318-216867340 TTTGGCTGTGTAAAAAGGAGAGG - Intronic
923059003 1:230453102-230453124 GTTGGTTTTTCAGACAGGAGAGG + Intergenic
923618491 1:235557533-235557555 ATTGTATGTGTAGACAGAAGGGG - Intronic
924167172 1:241296106-241296128 ATTATCTGTATAGACAGGAGAGG + Intronic
1063532950 10:6853359-6853381 ACTGGCTCTGCAGAGAAGAGAGG + Intergenic
1064088921 10:12366853-12366875 ATTGGCTGTGGATATAGGGGCGG + Intronic
1065841029 10:29701185-29701207 TTTGGCTGTGGACAGAGGAGTGG - Intronic
1065864387 10:29901162-29901184 ATTGGCTGTTGAGATGGGAGAGG + Intergenic
1069264239 10:66438238-66438260 ACTGGCTCTGAAGACAGCAGTGG - Intronic
1069808204 10:71139091-71139113 ACTGGCTTTGAAGACAGGAGGGG + Intergenic
1069940223 10:71950276-71950298 CTTGGCTGGGCAGACAGAACTGG + Intergenic
1070332327 10:75427097-75427119 GTTGGCTGTGGAGAATGGAGTGG - Intergenic
1070938334 10:80319957-80319979 AGTGGTTGTGCAGGCAGGACAGG + Intergenic
1072737774 10:97890604-97890626 ATTGGGAGTGCAGAGAGGAAGGG - Intronic
1073866066 10:107805312-107805334 ATTGGCTGAGTGGAAAGGAGAGG + Intergenic
1074681840 10:115914773-115914795 ATGGGCTTTGCAGTCAGAAGAGG + Intronic
1076163121 10:128261479-128261501 CTTGCCTGTGCAGGAAGGAGAGG - Intergenic
1076562789 10:131377862-131377884 ACTGGCTGCACAGACAGGAACGG + Intergenic
1077089510 11:772081-772103 CTTGCGTGTGCAGTCAGGAGGGG - Intronic
1077138029 11:1011290-1011312 CTTGGATGTGCAGCCAGGGGAGG + Exonic
1077139244 11:1016426-1016448 ATTAGTTGTGGAAACAGGAGTGG + Exonic
1077154719 11:1086156-1086178 ATTGGATGTGCAACCAGGAAAGG - Intergenic
1078907297 11:15699532-15699554 ATTGGCTGTGAGAAAAGGAGAGG - Intergenic
1080033548 11:27687948-27687970 GTTGGCTGTGAAGAGAGCAGTGG - Intronic
1081741067 11:45441003-45441025 ATAGGCTGTGCCCACAGGGGTGG - Intergenic
1085445751 11:76599540-76599562 AGTTGAGGTGCAGACAGGAGGGG - Intergenic
1088493091 11:110405588-110405610 ATTGGCTGGGTAGACAGAACTGG - Intergenic
1089681322 11:120120511-120120533 TGGGGCTGTGCAGGCAGGAGGGG - Intronic
1090069075 11:123527764-123527786 GTTGGGTGTGCTGACAGCAGGGG - Intronic
1091672370 12:2461591-2461613 ATTATCTATTCAGACAGGAGAGG - Intronic
1092214844 12:6673884-6673906 ATTATCTATGGAGACAGGAGAGG - Intronic
1094012540 12:25824509-25824531 ATTGGCTGTGAATGAAGGAGAGG - Intergenic
1094217379 12:27957828-27957850 ATTTGAAGTTCAGACAGGAGTGG - Intergenic
1095742464 12:45622040-45622062 ATTGGGTATGTAGCCAGGAGTGG - Intergenic
1096810805 12:54168653-54168675 ATTAGGTGTGCAGACTGCAGAGG + Intronic
1097298123 12:57989245-57989267 AATGACTGTGCAGGCAAGAGTGG + Intergenic
1097740526 12:63236631-63236653 ATTGGCTGTGGAGGTATGAGAGG - Intergenic
1097866044 12:64559942-64559964 ATTGGCTTGGGAGACAGTAGAGG + Intergenic
1099377040 12:81904381-81904403 CTTGGCTGTGTAGACAGAACTGG - Intergenic
1100581076 12:95941239-95941261 ATGGTCTGTGAAGTCAGGAGAGG + Intronic
1100913877 12:99395474-99395496 ATTGGATGTGCAAAGATGAGGGG - Intronic
1101277925 12:103222574-103222596 ATGGCGTGTGCAGATAGGAGTGG + Intergenic
1101278806 12:103228562-103228584 ATGGCATGTGCAGATAGGAGTGG + Intergenic
1102300579 12:111767984-111768006 AAAGGCTGTGCAGACAGGACAGG - Intronic
1102962536 12:117101947-117101969 TTTGGCTGTGGACCCAGGAGAGG - Intergenic
1104736408 12:131138298-131138320 ATGGGGTGTGCAGGCAGCAGAGG + Intronic
1104867954 12:131971483-131971505 TTTGGCTGTGCACCCAGAAGTGG + Intronic
1104883585 12:132089744-132089766 TTTGGCTGTGCACCCAGAAGTGG + Intronic
1105845112 13:24287076-24287098 CTTAGCAGTGCAGACAGCAGAGG - Intronic
1106518568 13:30476466-30476488 AGTGGCTGTGCTGCCAAGAGAGG + Intronic
1107108747 13:36673952-36673974 ATTGGTTGTGCGGCCAGGAGGGG + Exonic
1108040820 13:46338131-46338153 ATGGGCTCTGCAGATGGGAGTGG - Intergenic
1108228885 13:48317847-48317869 AGTTGCTGTGCAGGAAGGAGCGG - Intronic
1109496006 13:63172851-63172873 ATTAGCTGTGGAGACAGAAGAGG + Intergenic
1110013367 13:70367145-70367167 CTTGGCAGTGCAGACATGATAGG - Intergenic
1110668514 13:78147104-78147126 ATTGTCTGTGCAGCCAGTAAAGG - Intergenic
1110689684 13:78417739-78417761 TTTAGCTGTGCAAACAGGAAAGG + Intergenic
1112828057 13:103414734-103414756 ATTGGGAGTACAGACAAGAGAGG - Intergenic
1113056299 13:106271817-106271839 ATTGTCTGTGGGGTCAGGAGGGG - Intergenic
1113117045 13:106885177-106885199 AGTTGCTGTCCAGGCAGGAGTGG + Intergenic
1113736275 13:112680756-112680778 ATCAGCTGTGCAGTCAGGGGAGG - Intronic
1115476257 14:33816028-33816050 ATTGTCTGTGCAGCCAGAATTGG - Intergenic
1115653340 14:35419690-35419712 TGTGGCTGTGCAGGAAGGAGGGG + Intergenic
1115660303 14:35487791-35487813 ATTGGCTATGTAGCTAGGAGTGG + Intergenic
1117953462 14:61104811-61104833 AAAGGCTGTGGAGACAGAAGTGG - Intergenic
1120979815 14:90279828-90279850 GGTAGCTGTGCAGCCAGGAGTGG + Intronic
1121243898 14:92449218-92449240 TAAGGCTGAGCAGACAGGAGTGG + Intronic
1121456893 14:94044083-94044105 ACTGGCAGAGCAGACAGGAGTGG + Intronic
1121501541 14:94442189-94442211 ATGGGCTGTACAGACAAGAGAGG - Intergenic
1122182717 14:99967626-99967648 ACTGGCTTTGAAGGCAGGAGGGG - Intergenic
1122458322 14:101874156-101874178 AATGGCTGTGCATACATGACTGG + Intronic
1125475981 15:40048334-40048356 CTTGACTCTGCAGACAGGATGGG + Intergenic
1126430069 15:48573840-48573862 GTAGGCTGTGCAGACAGGCCAGG + Intronic
1127079143 15:55358564-55358586 ATTTGCTATGCAGACAGGGAAGG - Intronic
1127545378 15:59989470-59989492 ATAGGCGGTGGAGACAGGATGGG - Intergenic
1135691428 16:24540279-24540301 ATTGGCGGTGCAGTCAGTAGCGG - Exonic
1135829582 16:25761499-25761521 ATTGGCAGGTCAGCCAGGAGAGG + Intronic
1137018266 16:35396965-35396987 ATAGTCCCTGCAGACAGGAGGGG + Intergenic
1138167431 16:54816254-54816276 AAAGTCTGTGCAGTCAGGAGAGG - Intergenic
1138354808 16:56368657-56368679 ATTGGCTTTGCACACTGGTGTGG - Intronic
1139487403 16:67265711-67265733 ACTGGCTTTGCAGCCAGGTGCGG - Intronic
1141210125 16:81971961-81971983 ATTGGGAGTGCTGAAAGGAGGGG - Intergenic
1141700638 16:85640501-85640523 ACTGGCTTTGCAGGCAAGAGGGG + Intronic
1143472371 17:7184006-7184028 ACTGAATGTGCAGTCAGGAGGGG + Intergenic
1145761614 17:27428949-27428971 ATGTGCTGTGCACGCAGGAGGGG + Intergenic
1145950390 17:28812505-28812527 ATTGGCTGTGCAGACAGGAGAGG - Intronic
1147648077 17:42045915-42045937 ATTGATTGGGCAGACAGGAATGG - Intronic
1152937981 17:83151851-83151873 GGTGGCTGTGCAGACAGCAGGGG - Intergenic
1155088602 18:22483432-22483454 GGTGGCTGTGCAGAGAAGAGAGG + Intergenic
1156358985 18:36367397-36367419 AGTGGCTGTGCTGATAGGAAAGG + Intronic
1156401801 18:36745954-36745976 AGTGGGTGTGCTGAAAGGAGGGG - Intronic
1157283031 18:46358596-46358618 GGTGGCTGTGGAGAAAGGAGGGG + Intronic
1158819479 18:61142606-61142628 ATGGGCTTTGCAAACAGAAGGGG + Intergenic
1160024553 18:75207532-75207554 ATTGGCTGTGGACACAGCAGAGG - Intronic
1160166634 18:76518719-76518741 AATCTCTGTGCACACAGGAGAGG + Intergenic
1160409388 18:78665091-78665113 ATTGACTCTGCAGAGCGGAGAGG + Intergenic
1161392303 19:4027961-4027983 AGTGGCTGTGAGGTCAGGAGAGG - Intronic
1161850217 19:6734151-6734173 GCTGGCTGTGCAGACGGGGGTGG - Intronic
1163250147 19:16121996-16122018 ATTGTCTCTGCAGCCAGAAGGGG - Intronic
1164051718 19:21589597-21589619 CTTGGCTGTGCACACAGGCAGGG + Intergenic
1168134169 19:54339113-54339135 CCTGGCTGTGCAGGCAGGTGTGG + Exonic
1168267881 19:55232119-55232141 ATTGGCTGTGCAGCCCGTGGAGG - Exonic
926249646 2:11147077-11147099 AGTGGCTGTGCTTCCAGGAGTGG - Intergenic
926275456 2:11400025-11400047 ATTGGCTTTGCAGCCAGGAAAGG + Intergenic
926921576 2:17945774-17945796 AGTGAATGTGCAGACAGGAAGGG - Intronic
927114760 2:19889093-19889115 GTTGGCTGAGCAGGCAGGATTGG - Intergenic
927287518 2:21371780-21371802 AGTGGATGTGCCGAGAGGAGTGG + Intergenic
927844537 2:26464691-26464713 AGAGGCTGGGCAGACAGGAACGG + Intronic
928064819 2:28152557-28152579 AGTGGCTGGGGAGACAGGAATGG + Intronic
928081280 2:28314824-28314846 ATTTGATGTGCAGAGAGGGGAGG + Intronic
929400632 2:41577334-41577356 ATTTGTTGTCCAGACAAGAGTGG - Intergenic
929522846 2:42670496-42670518 ATTGGCTTTATAGACAGGAAAGG + Intronic
929548632 2:42875015-42875037 CTGGGCAGAGCAGACAGGAGGGG + Intergenic
931261899 2:60627414-60627436 ATCTCCTGTGCAGAAAGGAGTGG + Intergenic
931443773 2:62309659-62309681 AGTTGCTGTGAGGACAGGAGAGG + Intergenic
931654875 2:64501879-64501901 GTTTGCTTTGCAGTCAGGAGTGG - Intergenic
931836562 2:66105114-66105136 ACTGCCTGTGAAGTCAGGAGGGG + Intergenic
932173524 2:69578663-69578685 ATGGGCTCTAGAGACAGGAGGGG - Intronic
932185699 2:69693631-69693653 AGTGTCTGTGGGGACAGGAGAGG + Intronic
932539294 2:72635379-72635401 ATGGGCTGTGCAGACATGAAAGG + Intronic
932657125 2:73619885-73619907 ACTGGCTGTACAGACAAGACAGG - Intergenic
935145312 2:100391363-100391385 ACTGGCTGTGCAGAAATGAACGG + Intergenic
935784124 2:106533568-106533590 TTTAGCTGTGCAGTAAGGAGGGG - Intergenic
937214324 2:120301641-120301663 TCTGGCTGTGGAGACAGCAGTGG + Intergenic
938165930 2:129026866-129026888 ATTGTCTGTGGAAACAGAAGAGG - Intergenic
940326772 2:152433838-152433860 AAAGGCTCTGCAGACAGCAGTGG + Intronic
944864516 2:203847495-203847517 ATTGGCTTGGCAGGCAAGAGAGG - Intergenic
944980014 2:205106644-205106666 AGTGGCTTTGTAGACAAGAGTGG - Intronic
945324197 2:208463801-208463823 AGTGGCTGTTCAGACCTGAGGGG + Intronic
947179768 2:227401627-227401649 GTGGGCTGTGAAGACAGAAGGGG + Intergenic
947524579 2:230870418-230870440 TTTGGCTCTGCAGGCTGGAGCGG + Intronic
947929105 2:233948666-233948688 ATTGGCTGAGCAGACGGCAGTGG - Intronic
1168979202 20:1990599-1990621 ATTTGCTGTGCAGAGACCAGAGG + Intronic
1172487678 20:35308425-35308447 ATGTGCTGTGCAGAAAGGAATGG + Intronic
1173664289 20:44753908-44753930 AAAGGCTGTGCAGACACCAGGGG + Intronic
1173808342 20:45940693-45940715 ATTGGCAGGCCAGCCAGGAGGGG + Intronic
1173888447 20:46482042-46482064 GTTGGCTTTGAAGACAGGATAGG + Intergenic
1174735077 20:52958382-52958404 ATTGGCTATGCAGTCACGAGGGG + Intergenic
1175456978 20:59123029-59123051 CTTGGCTGGGCAGGCAGGTGGGG + Intergenic
1176011737 20:62900498-62900520 ATGGGTTCTGCAGAGAGGAGCGG - Intronic
1176229184 20:64022953-64022975 ACTGGATGAGCAGACATGAGAGG - Intronic
1176266465 20:64212081-64212103 CTGGCCTGTGCAGCCAGGAGTGG - Exonic
1177792750 21:25737744-25737766 ATTGGTTGTGGAGATGGGAGTGG + Intronic
1177833496 21:26166481-26166503 ATTGGCTTTGTAGACAGAAAAGG - Intronic
1178360825 21:31947535-31947557 GCTGGCTGGGGAGACAGGAGAGG - Intronic
1179439135 21:41380874-41380896 ACAGGCTGTGCAGGCAGGATAGG - Intronic
1181163530 22:20971483-20971505 ATGGGCTGGGCAGCCAGGAGAGG + Intronic
1182151958 22:28034177-28034199 ATTGGCTTTGCAGACAAAACTGG + Intronic
1182253193 22:29018296-29018318 ATTGGATGTGGAGAGAGGAAGGG + Intronic
1182962862 22:34492488-34492510 ATTGGGTGTGAGGACAGGAGTGG + Intergenic
1184247480 22:43242942-43242964 ATTGCCTGTCCAGGCAGGAATGG + Intronic
1184534016 22:45074126-45074148 ACTGGCTTTGAAGACAGGAAGGG - Intergenic
1185322582 22:50208844-50208866 ATGGGGTTTGCGGACAGGAGCGG - Intronic
949415912 3:3814006-3814028 ACTAGATGTGCAGACAGGGGAGG - Intronic
953392399 3:42541067-42541089 ATCTGCTGTGCTGGCAGGAGTGG + Intergenic
957412099 3:79855816-79855838 TTTGGCTGGGCAGCCAGGGGAGG - Intergenic
957413913 3:79876266-79876288 ATAGGCTGAGCACAAAGGAGGGG + Intergenic
959562422 3:107797979-107798001 ATTGACTGTGCAGTAAGGACAGG - Intronic
960969050 3:123126219-123126241 ATGGGGTGTGCCGAGAGGAGAGG - Intronic
961591085 3:127982451-127982473 AGTGGGTGTGGGGACAGGAGTGG - Intronic
963312622 3:143725131-143725153 AAAGGCTTTGAAGACAGGAGAGG + Intronic
964447945 3:156780161-156780183 ATGGACTATGCAGAGAGGAGGGG - Intergenic
965725620 3:171712214-171712236 CTGGGCTGTGGAGACAGGGGAGG + Intronic
967832336 3:193930932-193930954 ATCAGCTGTGAAGACAGGACAGG - Intergenic
968095097 3:195923774-195923796 AATGACTTTGCAGACAGGCGCGG - Intergenic
968970432 4:3790921-3790943 CCTGCATGTGCAGACAGGAGAGG - Intergenic
969552352 4:7879175-7879197 TTGGGCTGTGCAGACGGGAGAGG - Intronic
972374989 4:38461517-38461539 ATTGGCAGAGCAGACATGATTGG + Intergenic
972776983 4:42250469-42250491 ATTTCCTGAGAAGACAGGAGGGG + Intergenic
973727651 4:53792060-53792082 ATTGGGTCTGCGGACAAGAGAGG - Intronic
973990970 4:56406762-56406784 ATTGGCTGGGCAGAGAAGAGAGG - Intronic
979612592 4:122704870-122704892 AATGGCTGTGGACACAGGAAGGG - Intergenic
979667285 4:123326292-123326314 ATAGGCTGTGCCAACAGGAGAGG + Intergenic
980729083 4:136804275-136804297 AATGCCTATGCAGAGAGGAGCGG + Intergenic
985875466 5:2591046-2591068 TGAGGCTCTGCAGACAGGAGGGG + Intergenic
987868827 5:23584396-23584418 ATGAGCTGTGCAGACAGCAATGG - Intergenic
988475479 5:31581190-31581212 ACTGGCTCTGAAGACAGTAGGGG + Intergenic
988872333 5:35404997-35405019 ATTGGCTGGGGATTCAGGAGTGG - Intergenic
989047447 5:37286596-37286618 ATTGGCTATGCAGACAGCAGTGG - Intergenic
991147025 5:63318970-63318992 ATTGGCTGGGGAGACAGGGAGGG + Intergenic
992362766 5:76058160-76058182 ATTGGCTATGGTGAGAGGAGGGG + Intergenic
993462764 5:88204640-88204662 AGTGTGTGTGCAGAGAGGAGGGG + Intronic
993691873 5:91011952-91011974 ATTGGCCGTGAAGAGAGGGGTGG - Intronic
994700848 5:103132900-103132922 TTTGACTATGAAGACAGGAGGGG + Intronic
995684695 5:114759425-114759447 CTTCGCAGTGCAGAAAGGAGAGG + Intergenic
996008244 5:118449723-118449745 ATTTGCTATGCAGAGGGGAGTGG - Intergenic
996425098 5:123305428-123305450 ATTGGATCCCCAGACAGGAGAGG + Intergenic
997558892 5:134826957-134826979 ACTGGCTGTGCAGAAAGCAAAGG + Exonic
998186010 5:139980670-139980692 ATTGTCTGTTCAGACAGAATGGG + Intronic
999151661 5:149430415-149430437 ATGAGCCGTGCAGACAGCAGAGG + Intergenic
1002334695 5:178469701-178469723 GATGGCTCTGCAGACAGGACGGG - Intronic
1003585839 6:7388555-7388577 ATTTGCTGTGTAGACAGCACTGG - Intronic
1004828677 6:19452635-19452657 AATGTCTGAGCAGACAAGAGAGG + Intergenic
1005060948 6:21776560-21776582 ATTAGCTGGGCAGCCAGGCGCGG - Intergenic
1005398861 6:25411207-25411229 ATTGGGTGAGCAGACAGCAGGGG - Intronic
1007567388 6:42862782-42862804 ATTGGCTGTGCAGGCCAAAGAGG - Intronic
1007943584 6:45804923-45804945 ATAGGCTGTGCACTCAGTAGAGG + Intergenic
1010666157 6:78632058-78632080 ATTGGATGTCCCCACAGGAGAGG + Intergenic
1011087628 6:83560147-83560169 ATGGGCTGTGCAAACATGACCGG + Exonic
1015960007 6:138638759-138638781 AGTGGCTGGGAAGACAGCAGAGG - Intronic
1017850114 6:158298059-158298081 AATGGATGTGCAAATAGGAGAGG - Intronic
1018153720 6:160965471-160965493 ACTGGCTGGGCAGACAGGTGTGG + Intergenic
1018172947 6:161155868-161155890 ATTGGTTCTGCAGCCAGGAAGGG + Intronic
1018939987 6:168302696-168302718 TTGGGCGGTGCAGACAGGAAGGG - Intronic
1018993368 6:168691864-168691886 AGGGGCTGTGCAGAAAGAAGGGG - Intergenic
1021234020 7:18120447-18120469 ATTGGCTTTACAGACTGGAATGG - Intronic
1024109978 7:46134777-46134799 AGTGCCTGTGCACACAGGAGAGG - Intergenic
1024318898 7:48045814-48045836 ATAGGCAGCGCACACAGGAGGGG - Intronic
1027270934 7:76518377-76518399 AGAGGCTGTGCAGAAGGGAGGGG - Intergenic
1027320695 7:77008208-77008230 AGAGGCTGTGCAGAAGGGAGGGG - Intergenic
1032384706 7:131513637-131513659 ACGGGCTCTGCAGGCAGGAGTGG + Intronic
1032465065 7:132139003-132139025 ATTGGCTGTCCACATGGGAGGGG + Intronic
1034925031 7:155114380-155114402 ATGCGCAGAGCAGACAGGAGTGG - Intergenic
1035044305 7:155953773-155953795 ATTGCCCCTGCAGACAGGACAGG - Intergenic
1035521244 8:276304-276326 ACTGACTGTGGAGAGAGGAGTGG + Intergenic
1036020353 8:4837964-4837986 ATTGCCTGTGAAGCCAGCAGGGG + Intronic
1037301909 8:17460868-17460890 ATTAGATGTGCAGACAGTGGAGG + Intergenic
1037608297 8:20455735-20455757 ATTGGCAATGCAGACAGCAGGGG + Intergenic
1038336611 8:26650721-26650743 ATCTGCTGTGCAGACAGGGGTGG + Intronic
1038432540 8:27511668-27511690 TCTGGCTGTGCTGGCAGGAGAGG + Intronic
1039371120 8:36984901-36984923 ATTGGCTCTGTAGACAGAACTGG + Intergenic
1040870268 8:52093509-52093531 ATTGGCAGTGGAGGCAGCAGGGG - Intergenic
1043383300 8:79725318-79725340 ATGGGCTGCTCAGACAGGAGAGG + Intergenic
1043768383 8:84165425-84165447 GTTGGCTGGGTAGACAGTAGTGG - Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1045488590 8:102654065-102654087 ATTGGCTGTGCGGCCCGGGGCGG + Intronic
1046967892 8:120187757-120187779 ATTAGCTGTGGACACAGCAGGGG + Intronic
1047207917 8:122818354-122818376 ATTCGCCTTGCAGACACGAGGGG - Intronic
1048482775 8:134815936-134815958 GTTGGCTGTTCTGACAGAAGAGG - Intergenic
1048938608 8:139377405-139377427 ATTGGCTGTGTGGAGAGTAGGGG - Intergenic
1049526743 8:143130707-143130729 ATCGGCTGAGGAGGCAGGAGGGG - Intergenic
1049790191 8:144468857-144468879 ATAGGCTGCCCAGAGAGGAGGGG - Intronic
1050174149 9:2852586-2852608 ATTGGCCTGGCAGTCAGGAGAGG + Intergenic
1050475369 9:6034989-6035011 AATGGCTGTGCAGTGGGGAGAGG - Intergenic
1053576239 9:39359019-39359041 ACTCGCTGTGCAGAGAGGGGAGG - Exonic
1053840756 9:42186956-42186978 ACTCGCTGTGCAGAGAGGGGAGG - Exonic
1054097809 9:60917710-60917732 ACTCGCTGTGCAGAGAGGGGAGG - Intergenic
1054119211 9:61193340-61193362 ACTCGCTGTGCAGAGAGGGGAGG - Exonic
1054588542 9:66989222-66989244 ACTCGCTGTGCAGAGAGGGGAGG + Intergenic
1057160599 9:92885813-92885835 ATTCACTGTGCAGAGAGGGGAGG - Intergenic
1059149577 9:111937413-111937435 ATGGGGTGTGCAGGCAGCAGAGG - Intergenic
1059562678 9:115350638-115350660 GTTTGCTGTGCAGAAAGAAGAGG + Intronic
1059590135 9:115650170-115650192 AATGGCCCTGCAAACAGGAGAGG + Intergenic
1059646135 9:116269900-116269922 CATAGGTGTGCAGACAGGAGAGG + Intronic
1186671351 X:11770422-11770444 ATTCGCACTGCAGACCGGAGTGG - Intronic
1186935861 X:14449719-14449741 ACTGGCTGTGCTGACAGGATGGG - Intergenic
1187348000 X:18484609-18484631 ATTGATTATGCAGCCAGGAGTGG - Intronic
1189740916 X:44116433-44116455 ATTGTGTGTGTTGACAGGAGAGG - Intergenic
1190556092 X:51637276-51637298 TCTGCCAGTGCAGACAGGAGTGG + Intergenic
1191111989 X:56811443-56811465 ATGCCCTGTGCAGAGAGGAGGGG + Intergenic
1192018509 X:67358337-67358359 ACTGGCTCTGCAGAGAGCAGCGG + Intergenic
1192212972 X:69139490-69139512 ATTGGCTGTGCAGGCAGAAGAGG - Intergenic
1194304815 X:92230894-92230916 AACGGCAGTGCAGACAGGACTGG + Intronic
1194708283 X:97201593-97201615 ATTAGGTGTGCAGACAAGATTGG + Intronic
1195420303 X:104667961-104667983 ATTGACTGTGAAGACTGGATTGG + Intronic
1198526623 X:137507988-137508010 ATTGGCTGTGCAGAAATGGATGG + Intergenic
1198769340 X:140112321-140112343 ACTGGCAGTGCAGAGAAGAGAGG + Intergenic