ID: 1145950390

View in Genome Browser
Species Human (GRCh38)
Location 17:28812505-28812527
Sequence ATTGGCTGTGCAGACAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145950390_1145950398 23 Left 1145950390 17:28812505-28812527 CCTCTCCTGTCTGCACAGCCAAT 0: 1
1: 0
2: 2
3: 26
4: 247
Right 1145950398 17:28812551-28812573 CGACTCGCCAAACAGCCAACTGG 0: 1
1: 0
2: 0
3: 1
4: 29
1145950390_1145950399 24 Left 1145950390 17:28812505-28812527 CCTCTCCTGTCTGCACAGCCAAT 0: 1
1: 0
2: 2
3: 26
4: 247
Right 1145950399 17:28812552-28812574 GACTCGCCAAACAGCCAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 34
1145950390_1145950400 25 Left 1145950390 17:28812505-28812527 CCTCTCCTGTCTGCACAGCCAAT 0: 1
1: 0
2: 2
3: 26
4: 247
Right 1145950400 17:28812553-28812575 ACTCGCCAAACAGCCAACTGGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1145950390_1145950401 28 Left 1145950390 17:28812505-28812527 CCTCTCCTGTCTGCACAGCCAAT 0: 1
1: 0
2: 2
3: 26
4: 247
Right 1145950401 17:28812556-28812578 CGCCAAACAGCCAACTGGGGAGG 0: 1
1: 0
2: 1
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145950390 Original CRISPR ATTGGCTGTGCAGACAGGAG AGG (reversed) Intronic