ID: 1145957046

View in Genome Browser
Species Human (GRCh38)
Location 17:28861774-28861796
Sequence GTGGGTTATGGGAAGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 565}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145957030_1145957046 25 Left 1145957030 17:28861726-28861748 CCCTCGCAGGCCAGCGTCTCCTT 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG 0: 1
1: 0
2: 5
3: 35
4: 565
1145957032_1145957046 15 Left 1145957032 17:28861736-28861758 CCAGCGTCTCCTTGATTCTGTGG 0: 1
1: 0
2: 2
3: 10
4: 125
Right 1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG 0: 1
1: 0
2: 5
3: 35
4: 565
1145957035_1145957046 6 Left 1145957035 17:28861745-28861767 CCTTGATTCTGTGGTCAGGCACA 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG 0: 1
1: 0
2: 5
3: 35
4: 565
1145957031_1145957046 24 Left 1145957031 17:28861727-28861749 CCTCGCAGGCCAGCGTCTCCTTG 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG 0: 1
1: 0
2: 5
3: 35
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145957046 Original CRISPR GTGGGTTATGGGAAGGGGAC TGG Intergenic
901813101 1:11778868-11778890 GGAGATTGTGGGAAGGGGACAGG + Intronic
902605836 1:17568922-17568944 TGGGGCTGTGGGAAGGGGACAGG - Intronic
902736869 1:18407111-18407133 GTGGGTTAGGGGCAGGGCTCAGG - Intergenic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903358400 1:22762154-22762176 GTGGCGTATGGGAAGGGGCCAGG + Intronic
903569442 1:24293691-24293713 GTGGGAGATGGGTGGGGGACAGG - Intergenic
904619814 1:31768467-31768489 GTGGGGTGGGGGTAGGGGACTGG - Intergenic
905005985 1:34710890-34710912 GTTGGTTAAGGGAAGGAGAGAGG - Intergenic
905012943 1:34759418-34759440 GGAGGCAATGGGAAGGGGACAGG + Intronic
905027257 1:34859432-34859454 GTGGGCTAGGGACAGGGGACCGG - Intronic
905256441 1:36688482-36688504 AAGGGGTATGGGAAGGGGAAAGG + Intergenic
905256531 1:36688716-36688738 AAGGGGTATGGGAAGGGGAAGGG + Intergenic
905256654 1:36689050-36689072 AAGGGGTATGGGAAGGGGAAGGG + Intergenic
905852004 1:41281566-41281588 GTGGGTGGTGGGAAGGGGACAGG + Intergenic
906019331 1:42613561-42613583 GTGCTTTCTGGGAAGGGGACAGG + Intronic
906201689 1:43964580-43964602 GTGGGGAATGGGAAAGGGAGGGG + Intronic
907875541 1:58483302-58483324 GTGGGGTATGGTAGGGGCACAGG + Intronic
908190331 1:61696754-61696776 GTGGGTTATGGGGCAGGGATAGG - Intronic
908768897 1:67578021-67578043 GTGGGTTTTGGGAAGAGGCGGGG - Intergenic
910315108 1:85873680-85873702 GTGGGGTAGGGGAGGGGGAAGGG + Intronic
910594725 1:88968120-88968142 GTGGGAAATGGGGAGGGGAATGG - Intronic
911884927 1:103286417-103286439 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
912141423 1:106733958-106733980 GTTGATTATAGGAATGGGACAGG + Intergenic
912515147 1:110212230-110212252 GTGGGTGGTGGGTAGGGGCCGGG + Intronic
912557572 1:110527264-110527286 GTGGGGTATGGGATGGGGAAGGG + Intergenic
912654854 1:111477114-111477136 GTGGGTTGAGGGAGGGGGAGAGG + Intronic
912906954 1:113717838-113717860 GTGGGTTGTGGGAGGGGCCCAGG - Intronic
913196267 1:116458787-116458809 GTGGGGTATGGGGAGGGGGGAGG - Intergenic
914411167 1:147429082-147429104 GTGGGGTGGGGGAAGGGGAGAGG + Intergenic
914640762 1:149605302-149605324 GTGGGTTGTGGGGAGGGGGGAGG - Intergenic
915153841 1:153858160-153858182 GTGAGTTATGGGAGAGTGACGGG + Intronic
915895582 1:159808805-159808827 GTGGGTGAGGGTAAGAGGACGGG + Intronic
916043538 1:160981601-160981623 GTGGGTTAGGGGAGCGGGATTGG - Intergenic
916097226 1:161362161-161362183 GTGGGTTTTGAGAAGGGTAAAGG + Intronic
916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG + Intergenic
916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG + Intronic
916206660 1:162321568-162321590 GTGGGGTAGGGGTAGGGGAGAGG + Intronic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
917161876 1:172066484-172066506 ATAGGTTATGGGAGTGGGACTGG - Intronic
917581954 1:176388021-176388043 GTGGGGTAGGGGAGGGGGAAGGG - Intergenic
918213210 1:182370143-182370165 TTGGGTGAGGGGCAGGGGACAGG + Intergenic
918339441 1:183555911-183555933 GTGGGTGAGGAGATGGGGACAGG - Exonic
918466618 1:184827362-184827384 GTGGGCTCTGGGGAGGTGACAGG - Intronic
920228532 1:204455324-204455346 GGGGGTTGGGGAAAGGGGACCGG + Intronic
921186270 1:212672035-212672057 GTGGGGCATGGGAAGGAAACTGG + Intergenic
921729970 1:218566789-218566811 GTTGATTCTGGGAATGGGACAGG + Intergenic
922070303 1:222185940-222185962 GTGGGGTATGGGGAGGGGGGAGG - Intergenic
922343445 1:224676326-224676348 GTGGTTGCTGGGCAGGGGACGGG + Intronic
923615142 1:235531058-235531080 ATGGGTTATGAGAGTGGGACTGG + Intergenic
924654098 1:245957362-245957384 GTAGGTGATGGGAAAGGGAAAGG - Intronic
1063938860 10:11107220-11107242 GCTGGTTTTGGGAAGGGGGCTGG + Intronic
1065416496 10:25493306-25493328 CTGGGTTATGCGAAAGGGAGAGG - Intronic
1065502621 10:26397159-26397181 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
1066279658 10:33903698-33903720 GTGGGATTTGGGGAGGGGAGAGG - Intergenic
1066952329 10:42133143-42133165 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
1067460478 10:46454580-46454602 GTGGGTGAGGGGAAGGGTAGTGG + Intergenic
1067626714 10:47930023-47930045 GTGGGTGAGGGGAAGGGTAGTGG - Intergenic
1067836264 10:49643712-49643734 CTGGCTAATGGGAAGGGGAAAGG - Intronic
1067910136 10:50338245-50338267 TTGGGTTATGGGTTGGGGTCAGG - Intronic
1069657708 10:70102331-70102353 GTGGGCTGTGCGAAGGGGTCTGG + Intronic
1069878508 10:71577661-71577683 AAGGGATATGGGAAGGGGAAAGG + Intronic
1070225364 10:74498668-74498690 GTGGGCTGGGGGAAGGGGAGAGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070456071 10:76618892-76618914 GTAGGTTAGGGGATGGGGAGAGG + Intergenic
1070711834 10:78688741-78688763 GTGGCTTATGGAAAAGGCACTGG + Intergenic
1070815452 10:79319903-79319925 GTGGGTGCTGGGAATGGGTCTGG + Intergenic
1070818829 10:79342947-79342969 TTGGCCTCTGGGAAGGGGACGGG - Intergenic
1073057019 10:100709591-100709613 GTGGGTTGGGGGAAGAGGTCAGG + Intergenic
1073480145 10:103781305-103781327 GTGGGTTATGCCAAAGGGAAGGG - Intronic
1074023755 10:109612566-109612588 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
1074640030 10:115369332-115369354 GGGGGTTCTGTGAAGGGGATAGG + Intronic
1074903469 10:117839634-117839656 GTGGGTTATGGTGAAGGAACAGG - Intergenic
1075954384 10:126509334-126509356 CTGGGTCATGGGAAGAGTACTGG - Intronic
1075992433 10:126849356-126849378 CTGGTTTCTGGGAAGAGGACAGG + Intergenic
1076364604 10:129914025-129914047 GTGGGTTTTGTGAATGGGATGGG - Intronic
1076628214 10:131834613-131834635 CTGGGTGATGGGGAGGGCACAGG + Intergenic
1077092363 11:785036-785058 CGGGGTTAAGGGGAGGGGACGGG + Intergenic
1077544209 11:3162041-3162063 GTGGGGTCTGGAAAGGGGTCAGG + Intronic
1078100537 11:8327936-8327958 GTGGGGAAAGGGAAGGGGAGTGG + Intergenic
1078509682 11:11976186-11976208 GTTGGTAATGGGAAGGGCACTGG - Intronic
1079242818 11:18732735-18732757 GAGAGTTGTGGGAAGGGAACAGG - Intronic
1079599895 11:22298368-22298390 GGGGCTTATGGGGAGGGGGCGGG + Intergenic
1079693038 11:23443656-23443678 GTGGCTTATGGGAACTGGAAAGG - Intergenic
1079770541 11:24453093-24453115 GTGGGGTGGGGGAAGGGGAGAGG + Intergenic
1081112740 11:39157009-39157031 GTGGGGTGGGGGAAGGGGAAGGG - Intergenic
1081204588 11:40260403-40260425 GTGGGTTAGGGGGAGGGGGGAGG + Intronic
1081511203 11:43775098-43775120 GAGGGTTATGTGACGGGGAATGG + Intronic
1082141227 11:48611901-48611923 GTGGGTTATGGGGTGGGGGGAGG - Intergenic
1082292250 11:50389865-50389887 GTGGGGTGTGGGAAGGGGGAGGG + Intergenic
1082774583 11:57235670-57235692 GTGGTTTAGGGGAAAGAGACTGG - Exonic
1083738010 11:64692741-64692763 GTGGAGGAGGGGAAGGGGACAGG + Intronic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084003737 11:66312753-66312775 GTAGGTTGTGGGCGGGGGACTGG + Intergenic
1084116537 11:67045888-67045910 CTGGGGGATGGGAAGGGGCCAGG + Intronic
1084518637 11:69649755-69649777 GTGGGTCATGGGCGAGGGACGGG + Intronic
1085638417 11:78175875-78175897 GTGGGGTAGGGGGAGGGGAGAGG - Intronic
1085751369 11:79164661-79164683 GTGTGTTATGGGAGGGACACAGG + Intronic
1086329537 11:85739872-85739894 GTGGCTTGTGGCAAGAGGACTGG + Intronic
1087334743 11:96829487-96829509 GAAGGTGATGGGAAAGGGACAGG + Intergenic
1088647679 11:111929715-111929737 GTAGGTTTTGGGGAGGGGTCTGG + Intronic
1088884276 11:113994763-113994785 GTGTGTGATGGGGTGGGGACTGG - Intergenic
1089147327 11:116338857-116338879 GTGGGTTGAGGGAAGGGGGAGGG + Intergenic
1089315573 11:117588810-117588832 GTGGCTTAGAGGAGGGGGACAGG - Intronic
1089677131 11:120097678-120097700 AGGGGTAATGGGAAGGGAACAGG - Intergenic
1089752705 11:120662661-120662683 GAGGCTTATGGGAAGGGAAGGGG + Intronic
1090603047 11:128392411-128392433 GTGGGTTGTGGATAGGGGCCTGG - Intergenic
1091143921 11:133260525-133260547 GTGGGGTATGGGAGTGGGAGTGG + Intronic
1091339483 11:134799303-134799325 GTGGGATATGAGCAGGGGGCTGG - Intergenic
1091726195 12:2848315-2848337 GAGGGTGATGGGAAGGTGGCTGG - Intronic
1091768928 12:3139053-3139075 GTGGGTTCTGGGGAGGGGCTGGG - Intronic
1091922839 12:4319803-4319825 GTAGGTAATGGGAAGGAGTCAGG + Intergenic
1091922846 12:4319831-4319853 GTAGGTAATGGGAAGGAGTCAGG + Intergenic
1092468785 12:8760086-8760108 GTGGGGTAGGGGAAGGGGGAGGG - Intronic
1092857192 12:12685222-12685244 ATGGGTGATGGGATGGGGACAGG - Intronic
1093300754 12:17451868-17451890 GTGAGTTCTGTGAAGGGGTCAGG - Intergenic
1093914589 12:24787506-24787528 ATGGGTCATGGTAAGGTGACAGG + Intergenic
1094353535 12:29553164-29553186 GTGGGTAATGGAAAGTGAACAGG + Intronic
1094359225 12:29612075-29612097 GTGGACTGTGGGAAGAGGACAGG - Intronic
1094382131 12:29854456-29854478 GTGGGGTAGGGGAAGGGGGGAGG + Intergenic
1095069488 12:37823515-37823537 GTGGGTTAGGGGGAGGGGGGAGG - Intergenic
1095591861 12:43912346-43912368 GTGGGGTGGGGGAAGGGGACAGG + Intronic
1096073718 12:48789370-48789392 CGGGGTGAAGGGAAGGGGACCGG - Intergenic
1096442185 12:51652677-51652699 GTGGGTTATGGGAAGAAAATGGG - Intronic
1096674432 12:53218924-53218946 GTGGGGTGTGGGGAGGGGCCAGG - Intronic
1096760488 12:53837682-53837704 GTTAGTTTTGGGAAGGGGAAAGG - Intergenic
1096876485 12:54633934-54633956 GTTGGTTGGGGGAAGGGGCCAGG + Intronic
1097176142 12:57144091-57144113 CAGGGAGATGGGAAGGGGACCGG - Intronic
1097456220 12:59801938-59801960 GTGGGTAGTGGGAAGGTGAGCGG + Intergenic
1099170630 12:79359675-79359697 GTGGGTGGAGGGAGGGGGACAGG - Intronic
1099295476 12:80823256-80823278 GTGGGTGATGAGAAGGAGAGAGG + Intronic
1100451623 12:94712285-94712307 ATTGTTTCTGGGAAGGGGACAGG + Intergenic
1101673626 12:106898491-106898513 GTGGGGTGGGGGAAGGGGAGTGG + Intergenic
1101846083 12:108364228-108364250 ATGGGCTATGGAAAGCGGACAGG + Intergenic
1101857941 12:108459577-108459599 CTGTTTTCTGGGAAGGGGACTGG - Intergenic
1102604591 12:114058711-114058733 GTGGGTTAAGGTCAGGGGATAGG - Intergenic
1104238381 12:126961621-126961643 TTTTGATATGGGAAGGGGACAGG - Intergenic
1104440814 12:128791921-128791943 GAGGTGTGTGGGAAGGGGACCGG + Intergenic
1106087043 13:26551991-26552013 TTGGGTTGTGGGAATGGGAAAGG + Intergenic
1106675700 13:31955874-31955896 GTGGGTACGTGGAAGGGGACTGG - Intergenic
1106878588 13:34104420-34104442 GGGGCTTATAGGAAGGAGACAGG - Intergenic
1107580374 13:41777338-41777360 AGGGTATATGGGAAGGGGACAGG + Intronic
1107982620 13:45748258-45748280 GTGAGGTGTGGGAACGGGACGGG - Intergenic
1107986544 13:45781367-45781389 TTAGGTTCTGGGAAGGGGATTGG + Exonic
1108631050 13:52282506-52282528 GTGGGGTAGGGGAAGGGGGGAGG + Intergenic
1108690613 13:52856156-52856178 GTGGGATATGGGATGTGGCCTGG + Intergenic
1110173197 13:72526709-72526731 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1110442290 13:75538885-75538907 GTGGGGTTTGGGTGGGGGACAGG + Intronic
1111214985 13:85129879-85129901 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1111359245 13:87153001-87153023 GTGGGGAATGGGAAGGGGGGAGG + Intergenic
1111765559 13:92522617-92522639 GTGGGGTGGGGGAAGGGGAGAGG + Intronic
1111873885 13:93868883-93868905 GTGGGTTGTGGAAAAGGGAAAGG - Intronic
1112393772 13:99009666-99009688 GTGGGTTTGGGGGTGGGGACAGG - Intronic
1115125839 14:29992711-29992733 GTAGGTTCTGGGAAGGGTAGTGG + Intronic
1115259871 14:31440854-31440876 GTGGGGTGTGGGGAGGGGAAGGG + Intronic
1115867724 14:37766943-37766965 GTGGGATGTGGGGAGGGGAGAGG - Intronic
1116242263 14:42359825-42359847 GTGGGGTAGGGGAAGGGGGGAGG + Intergenic
1116358341 14:43960079-43960101 GTGGGGTGTGGGGAGGGGGCAGG + Intergenic
1116908469 14:50431394-50431416 GTGGGGTGGGGGAAGGGGAGAGG - Intronic
1117227703 14:53680209-53680231 GTGGGGTAGGGGGAGGGGGCAGG - Intergenic
1117489742 14:56234600-56234622 GTGGGTTGTGGGGAGGGGTGAGG + Intronic
1117843737 14:59888866-59888888 GTGGGTTTTTGGAAAGGGAGAGG + Intergenic
1118244835 14:64099891-64099913 GTGGGTTAGGGGGAGGGGGAAGG - Intronic
1118465464 14:66026577-66026599 GTGGGTTGTGGGGAGGGGGGAGG - Intergenic
1118752586 14:68817550-68817572 GAGGGGAATGGGGAGGGGACTGG + Intergenic
1118954312 14:70465891-70465913 GGGGGTTGTGGGAAGGGTGCTGG - Intergenic
1118967445 14:70600877-70600899 GTGGGGTAGGGGAATGGGAGGGG + Intergenic
1118985707 14:70752879-70752901 GGGGGTTATGGGACTGGGACTGG + Intronic
1119198272 14:72733399-72733421 GTGGGTTTTGGGCAGGGGTGAGG + Intronic
1119603025 14:75990103-75990125 GTGAGTTAGGGCAGGGGGACTGG + Intronic
1120387554 14:83865130-83865152 GGGAGAGATGGGAAGGGGACGGG - Intergenic
1121113953 14:91330857-91330879 GTGGGCTAAGGGAAGGCGGCAGG + Intronic
1121518544 14:94570053-94570075 CAGGTTTATGGAAAGGGGACTGG + Intronic
1122580156 14:102766573-102766595 TTGGGGTAGGGGCAGGGGACAGG + Intergenic
1122781252 14:104144499-104144521 GTGGGCTAAGGGAATGGGACTGG + Intronic
1123174919 14:106407721-106407743 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1202891484 14_KI270722v1_random:163311-163333 GTGGGTCCTGGGGAGGTGACTGG + Intergenic
1202943764 14_KI270726v1_random:8058-8080 GTGGGCTGTGGGGAGGGGAGAGG - Intergenic
1124240690 15:28025458-28025480 ATGGGTAATGGTAAGGGGGCCGG - Intronic
1124883045 15:33659900-33659922 GGGGCTTATGGGAAGTGAACAGG - Intronic
1125677081 15:41507937-41507959 GTGGGTGCTGGGCAGGGGATTGG - Intronic
1125890755 15:43265237-43265259 GGGGGTGATGGGAAGAGCACTGG - Intronic
1127228884 15:56967122-56967144 GTGGGGGAGGGGAAGGGCACGGG - Intronic
1127342993 15:58066194-58066216 GTGGGTCCTGGGACGGGGATGGG - Exonic
1127748053 15:62001660-62001682 GTGGGTTGTGGGGAGGGGGAGGG - Intronic
1128537204 15:68500422-68500444 GTGGATTTAGGGCAGGGGACTGG - Intergenic
1128549668 15:68590178-68590200 GTGGGTGGAGGGAAGGGGAGAGG + Intronic
1129115760 15:73364573-73364595 GTGTGTTAAGGGAAGAGGCCAGG - Intronic
1129690750 15:77712058-77712080 GTGGGTGAGGGGAAGTGGCCAGG - Intronic
1131020127 15:89090473-89090495 GGGGGTGGGGGGAAGGGGACTGG - Intronic
1131202430 15:90410685-90410707 GTGGGGTAGGGGGAGGGGAGAGG + Intronic
1131873418 15:96782229-96782251 GTAGCCTAGGGGAAGGGGACAGG - Intergenic
1133216723 16:4297111-4297133 ATGTGTCATGGGAGGGGGACAGG + Intergenic
1134313553 16:13097776-13097798 CTGGGTGATGGGGAGTGGACAGG + Intronic
1134838908 16:17385235-17385257 GTGTGTTATGGGGATGGGGCAGG - Intronic
1135274908 16:21103745-21103767 GTTTCTTATGTGAAGGGGACAGG + Intronic
1135332781 16:21574610-21574632 GTGGGGTGGGGGAAGGGGCCAGG - Intergenic
1135983586 16:27167457-27167479 GTGGGATAAGGGAAGGGGAAAGG + Intergenic
1136032282 16:27512242-27512264 CTGGGTGCTGGGAAGGGAACAGG - Intronic
1136178436 16:28534450-28534472 GGGGCTTATGTGAAAGGGACAGG + Intronic
1136227552 16:28869222-28869244 GAGGGTCATGGGGCGGGGACTGG - Exonic
1137364283 16:47847290-47847312 GCAGGTTATGAGAAGGGGAGAGG - Intergenic
1137399463 16:48141513-48141535 GTGGGATTTGGGAAGGGCAGGGG + Intronic
1138323534 16:56140597-56140619 ATGGGTTATGGGTGGTGGACTGG - Intergenic
1138602803 16:58066815-58066837 GTCAGTGATGGGAAGGGGAGGGG - Intergenic
1139928250 16:70504203-70504225 GGGGGGTATGGGTAGGGGAATGG - Intronic
1140455368 16:75102278-75102300 GTGGGTTGTGGGGCTGGGACTGG - Intronic
1140672562 16:77293402-77293424 GTGGGTAATGGGAATGGGGGTGG - Intronic
1141206086 16:81934092-81934114 GTGGCTTTAGGGGAGGGGACAGG + Intronic
1141225411 16:82110437-82110459 GTGAGTTCTGGGAAGGGGGGTGG - Intergenic
1141815254 16:86405118-86405140 CTGGGTTTAGGGAAGTGGACAGG - Intergenic
1142202637 16:88768390-88768412 GTGGGGGGTGGGGAGGGGACTGG + Intronic
1142532827 17:594474-594496 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532844 17:594546-594568 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532860 17:594619-594641 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532875 17:594690-594712 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532892 17:594762-594784 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532907 17:594835-594857 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532922 17:594906-594928 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532939 17:594979-595001 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532955 17:595050-595072 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532970 17:595121-595143 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532986 17:595192-595214 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533001 17:595265-595287 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533016 17:595336-595358 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533033 17:595408-595430 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533048 17:595481-595503 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533065 17:595552-595574 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533082 17:595624-595646 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533100 17:595696-595718 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533116 17:595767-595789 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533131 17:595838-595860 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533146 17:595909-595931 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533161 17:595980-596002 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142643054 17:1295712-1295734 GTGGGTTGGGGGAAGGAGAAGGG + Intronic
1142892976 17:2957228-2957250 GTGCCTTGTGGGCAGGGGACCGG + Intronic
1143237170 17:5412809-5412831 GTGGGGTAGGGGAGTGGGACAGG - Intronic
1143462835 17:7114856-7114878 GTGGGGTGGGGGCAGGGGACGGG + Intronic
1143582316 17:7834452-7834474 TTGGGTCTTGGGAAGGGCACTGG + Intergenic
1143655005 17:8288902-8288924 GTGGGTTGTGGGAAGAGACCGGG + Exonic
1143699084 17:8644340-8644362 GTGGGTTATGTTCAGGGAACTGG - Intergenic
1144301597 17:13926561-13926583 GAGGGTTCTGGGGAGGGGAAAGG - Intergenic
1145039649 17:19567779-19567801 GAGGGTGATGAGAAGGGCACTGG - Intronic
1145394064 17:22479971-22479993 GTGGGGTGGGGGAAGGGGGCAGG + Intergenic
1145829115 17:27900808-27900830 GTGGGTTAGGGGGAGGGGGGAGG - Intergenic
1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG + Intergenic
1146093028 17:29901128-29901150 GTGGGTTGGGGGGAGGGGAGAGG + Intronic
1147134705 17:38428336-38428358 GTGGGTGGTGGGAAGGGGGAGGG + Intergenic
1147213578 17:38886307-38886329 GTGGGCTGTGGGGAGGGGACAGG + Intronic
1147602736 17:41756003-41756025 GTGGGGTCTGGGGAGGGGTCAGG - Intronic
1147772976 17:42880200-42880222 GTTGGTGATGGGGAGGGGACAGG + Intergenic
1148851262 17:50556566-50556588 TTGGGTTGAGGGATGGGGACTGG + Intergenic
1148855632 17:50577854-50577876 CTGGCTTCTGGGAAGGGGAAGGG + Intronic
1149556712 17:57578555-57578577 GGGGATGAGGGGAAGGGGACGGG + Intronic
1149695866 17:58615617-58615639 GTGGGGAATGGGTAGGGGAGGGG + Intronic
1149951834 17:60996529-60996551 GCAGGTTTTGGGATGGGGACAGG + Intronic
1150289132 17:63971665-63971687 GTGGGTGAGGGGAGGGGGCCAGG - Intronic
1150941714 17:69700186-69700208 GTGTGTTGTGGGAAGGGACCCGG + Intergenic
1151381602 17:73729654-73729676 ATGGGTGATAGGAAGGGGACGGG - Intergenic
1152765629 17:82136400-82136422 GTGGGTGCTGGGCGGGGGACAGG + Intronic
1153601101 18:6781967-6781989 ATGGGTTTAGGGATGGGGACAGG + Intronic
1153894507 18:9546128-9546150 GTGGGTAATGGGAGTGGGGCTGG - Intergenic
1153983079 18:10329188-10329210 GAGGCTTATGGGATGGGGTCGGG - Intergenic
1154091567 18:11368845-11368867 GCTGGTTATGGGGAGGTGACTGG - Intergenic
1155229312 18:23757459-23757481 GTGGGGGCTGGGGAGGGGACTGG - Intronic
1156122586 18:33863270-33863292 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
1156496012 18:37525427-37525449 CTGGGTTGTGGGGAGGGGAGTGG + Intronic
1157127521 18:44971017-44971039 GTGGGGTGGGGGAAGGGGAGAGG - Intronic
1157604832 18:48919533-48919555 TAGGGTAATGGGAAGGAGACAGG - Intergenic
1160923569 19:1532098-1532120 GTGGGTAGGGGGAAGGGGAAGGG + Intronic
1161451764 19:4350275-4350297 GGGGAGGATGGGAAGGGGACAGG + Intronic
1161624703 19:5319637-5319659 GTGAGTGATGGGGAGGGGAGAGG - Intronic
1162386243 19:10362055-10362077 GTGGGTGCAGGGAAGGGGCCCGG - Intronic
1162726082 19:12690312-12690334 GAGGGATATGGGATGTGGACGGG - Intronic
1162940483 19:14006154-14006176 GTCGATGTTGGGAAGGGGACGGG + Exonic
1162997368 19:14344734-14344756 GTTTGTGGTGGGAAGGGGACAGG - Intergenic
1163156476 19:15442578-15442600 CTGGGGAATGAGAAGGGGACAGG - Intronic
1163342963 19:16721618-16721640 GTGAGTTGTGGGAAGGTGGCTGG + Intronic
1163419667 19:17206911-17206933 GGGGGTTCTGGGAGGGGGCCAGG + Intronic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1164919271 19:32076774-32076796 GTGGGTGATGGGAAGGACAGAGG + Intergenic
1165012622 19:32859785-32859807 GTGGCTTGTGGGAAGGGGTAAGG - Intronic
1165164310 19:33840669-33840691 GAGGCTTAGGGGATGGGGACTGG - Intergenic
1165365057 19:35360130-35360152 TTGGGCTCTGGGAAGGGGTCAGG + Exonic
1165366876 19:35372599-35372621 TTGGGCTCTGGGAAGGGGTCAGG + Intronic
1165933462 19:39375166-39375188 GTGGGTTGTGGGAGAGGAACAGG + Intronic
1167252952 19:48410639-48410661 GTGGGTTATGAGCAGGAGACGGG + Intronic
1167493115 19:49803022-49803044 GTGGGGGAGGGGAACGGGACAGG + Intronic
1167569303 19:50276902-50276924 GTGGGTTGGGGCAGGGGGACAGG + Intronic
1167636056 19:50656386-50656408 TGGGGTGATGGGAAGGGCACAGG + Intronic
1167643602 19:50694785-50694807 GCGGGTTGGGGGAAGGGGAAAGG + Intronic
1167663446 19:50810160-50810182 GTGGGTTATGGTTAGGGGTAAGG + Intergenic
1167729678 19:51244631-51244653 GAGAGTAAGGGGAAGGGGACAGG - Intergenic
1168682326 19:58325079-58325101 GTGGATTAAGGGAAGGAGATGGG - Intergenic
925094103 2:1181066-1181088 GTGGGGTGGGGGAAGGGGAGAGG + Intronic
925231572 2:2237669-2237691 GTGGTTTATGTAAAGGGGCCTGG - Intronic
925622044 2:5803668-5803690 GTAGGATATGAGAAAGGGACTGG + Intergenic
925722523 2:6842812-6842834 GAGGGTTTTGGGAAGGGGGAAGG + Intronic
926370327 2:12172244-12172266 GTGGATGGTGGGAAGGAGACAGG - Intergenic
926666098 2:15524926-15524948 GTGGGTTGAGGGAAGGAAACAGG - Intronic
927142636 2:20140480-20140502 GTGGGATATGGGGAGGGGGCCGG - Intergenic
928023513 2:27721785-27721807 GTGGGCTGTGGGAAGGGGCTGGG + Intergenic
928097936 2:28416318-28416340 GAGGGTTATGGGAAAGGGAGGGG + Exonic
928278071 2:29920583-29920605 GTGGGCTCCGGGATGGGGACCGG - Exonic
929899551 2:45989005-45989027 GTGGGGGATGGGACGGGGGCAGG - Intronic
931232182 2:60384208-60384230 GTGTGTTTTGGGGGGGGGACAGG - Intergenic
932851858 2:75195338-75195360 GTGGGAGGTGGGAAGGGGATAGG - Intronic
935207116 2:100905768-100905790 GTGGGTTCTGTGAAGGGAAGTGG - Intronic
935927579 2:108087547-108087569 GTGGGGCATTGGAAGGGGATGGG - Intergenic
937127902 2:119485823-119485845 GTGGGTTCTGGGGAGGAGAAAGG - Intronic
937633443 2:124128910-124128932 ATGGGGTATGGGGAGGGGAGAGG + Intronic
937868210 2:126769613-126769635 GTGGGTTGTGGGGTGGAGACAGG - Intergenic
938404997 2:131027402-131027424 GAGGGAGATGGGAATGGGACTGG + Intronic
939403267 2:141722619-141722641 GTGGGCAATGGGAGAGGGACAGG - Intronic
940098928 2:150010915-150010937 GTGGGGTAGGGGAGGGGGAGGGG + Intergenic
940612138 2:156005984-156006006 GTGGGTGAAGGGAAGGAGAGAGG - Intergenic
942213312 2:173693237-173693259 GTGCTTTCTGGGAAGGGGACTGG - Intergenic
942241094 2:173964654-173964676 GTGGGGGAGGGGAAGGGGCCTGG - Intronic
944476665 2:200113430-200113452 GTGGGTCAGGGGATGGGGAAGGG - Intergenic
945714748 2:213344521-213344543 GTGGGGTGTGGGAAGTGGAGAGG - Intronic
946519715 2:220451549-220451571 GGGGTTTGTGGGAAAGGGACAGG - Intergenic
947547156 2:231018385-231018407 ATAGGTTATGGGAAGGAGAGGGG - Intronic
948421495 2:237863181-237863203 GTGGGAGCTGGGAAGGGGACAGG + Intronic
949064215 2:241980004-241980026 GTGGGGGATGGGGAGGGGATGGG - Intergenic
949064265 2:241980097-241980119 GTGGGGGATGGGGAGGGGATGGG - Intergenic
1168857922 20:1022194-1022216 CTAGGTGATAGGAAGGGGACAGG + Intergenic
1168910077 20:1440519-1440541 GAGGGTGGTGGGAAGGGGCCAGG + Intergenic
1168922671 20:1553345-1553367 GTTGGTAATGGGAAGGTGACTGG + Intronic
1168926946 20:1589328-1589350 ATGGGTTATGGAAAAGGGATAGG + Intronic
1168935130 20:1658404-1658426 GTGGGTTATGGAAAGGGGATAGG + Intergenic
1168938338 20:1687094-1687116 ATGGGTTATGGAGAGGGGATAGG + Intergenic
1169072145 20:2739192-2739214 CTGGGTGATGGGAAGGCTACAGG - Intronic
1169290371 20:4344485-4344507 CTGGGATTTGGGAAGGGGTCAGG + Intergenic
1170109641 20:12791020-12791042 ATGGGCTATGAGAATGGGACTGG - Intergenic
1171101054 20:22384361-22384383 TGGGGTTGTGGGAAGGGGGCAGG - Intergenic
1171127012 20:22611197-22611219 GAGGGTTATGGGAAGTGGCTTGG + Intergenic
1171250581 20:23643075-23643097 GGGGGTGATGGGAAAGGGATGGG + Intergenic
1171403580 20:24894528-24894550 TTGGGATGTGGGAAGAGGACAGG - Intergenic
1171835534 20:30140976-30140998 GTGGGTTGTGGGGAGGGGGGAGG - Intergenic
1172528696 20:35616481-35616503 GACGGTTATGGGAAGGGGCGGGG + Intronic
1173671216 20:44800261-44800283 GTGGCTTGTGGGAGTGGGACTGG + Intronic
1174538598 20:51271979-51272001 GTGGCTTCTGGGACAGGGACAGG + Intergenic
1175283468 20:57820893-57820915 AAGGGTGATGGGAAGGGGAAGGG + Intergenic
1175498149 20:59429380-59429402 GGGGGTTGTGGGCAGGAGACAGG - Intergenic
1175557961 20:59887143-59887165 GTGGGGTAGGGGAAGGGGGGAGG - Intronic
1175807954 20:61841197-61841219 TTGGGTTAGGAGAAGGGCACTGG - Intronic
1175936627 20:62517242-62517264 GTGGGTTTTGGGAAGTGGGGAGG + Intergenic
1176316376 21:5248475-5248497 GTGGGTTGGGGGAAGAGGGCTGG - Intergenic
1176930771 21:14807272-14807294 ATCGGTTATGGGAATGGAACTGG + Intergenic
1178590136 21:33902656-33902678 GGTGGTTCTGGGAAGGGAACTGG + Intronic
1178690612 21:34746698-34746720 GGGGGTGAGGGGACGGGGACTGG + Intergenic
1179481183 21:41679560-41679582 GTGGGGTCTGGGAAGGGGTTTGG + Intergenic
1179562223 21:42222907-42222929 GGGGGTGAAGGAAAGGGGACAGG - Intronic
1179707656 21:43191599-43191621 GTGTGATGTGTGAAGGGGACAGG + Intergenic
1180094499 21:45549730-45549752 GTGGGGGAGGGGCAGGGGACAGG + Intergenic
1180208076 21:46275143-46275165 GTGGAGTGTGGGCAGGGGACGGG - Intronic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1181956725 22:26592648-26592670 GTGGGCTGTGGGAAGGAGTCGGG + Intronic
1182007152 22:26970365-26970387 GTGGGTGATGGATAGGGGATAGG + Intergenic
1182368627 22:29795540-29795562 GGGGGTGATAGGAAGAGGACTGG - Intronic
1182409158 22:30167958-30167980 GTGTGTGATGGGAGGGGGAGTGG - Intronic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1183230587 22:36579603-36579625 GTGGGTTCTGAGCAGGGGACAGG - Intronic
1183341969 22:37286537-37286559 GTGGGGAATGGGAAGGGGTGGGG + Intronic
1183408613 22:37642316-37642338 GTGGCTTCTGGGAAGAGGAAAGG + Intronic
1183548662 22:38468718-38468740 GTGGGGTCTGGGAAGGGGCAGGG - Intronic
1183617576 22:38954777-38954799 GTGGGTCCAGGGGAGGGGACTGG + Intronic
1183721956 22:39567828-39567850 GTGGGTTTTAGGCAGGGGAGTGG - Intergenic
1184015747 22:41784555-41784577 GTGGGAGGTGGGAAGGAGACAGG + Intronic
1184489258 22:44799734-44799756 GTGGGTTCTGGGAAGCGGGGCGG + Intronic
1184703475 22:46193979-46194001 GTGGGTAATAGGAAGGGGTGGGG + Intronic
1185170242 22:49289288-49289310 GTGGGTTATCGGGAGGTGAAGGG - Intergenic
950523055 3:13507797-13507819 GTGGGTTCCGGGCAGGGGCCAGG - Intergenic
951257034 3:20462037-20462059 GAGGGGTATGGGAAGGTGAATGG - Intergenic
951570042 3:24052937-24052959 GTGGGGTAGGGGGAGGGGAGAGG - Intergenic
952749943 3:36816960-36816982 GTGGGAAAGGGGAAGGGGAAGGG - Intergenic
952769965 3:36990668-36990690 GTGGGTGATGGGGAGGGAAGAGG + Exonic
952920599 3:38281557-38281579 ATGAGTTATGAGAATGGGACTGG - Intergenic
953759740 3:45677141-45677163 GTGGGGTAGGGGAAGAGGAGGGG + Exonic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955600667 3:60641983-60642005 GTGGGTTAGGGGTAGGGGGTGGG + Intronic
956056158 3:65301050-65301072 GTGAGGTATGGGAAGGGGTATGG + Intergenic
956427937 3:69155803-69155825 GTGGGTGTGGGGAAGGGGTCAGG + Intergenic
956723616 3:72139079-72139101 GTGGGATATGCAAAGGGGAGAGG + Intergenic
957243812 3:77692901-77692923 GTGTGTGTTGGGAAGGGGAGTGG - Intergenic
957295816 3:78331186-78331208 GAAGGTTATGGGAAGGTGAGAGG + Intergenic
959160677 3:102720923-102720945 GTGGGGAATAGGAAGGAGACTGG - Intergenic
960743606 3:120861878-120861900 GTGGGTTAGGGGTAGGGGGAGGG - Intergenic
961069494 3:123908730-123908752 TTGGGATATGGGGAGGGGAGAGG + Intronic
961386738 3:126527085-126527107 GTGGAATAGGGGAAGGGGGCTGG - Intronic
961807634 3:129500768-129500790 GTGGGTTGGGGGAAGTGGGCTGG + Intronic
962268543 3:133961047-133961069 GTGCATGATGGGAAGGGGCCTGG + Intronic
963851644 3:150215963-150215985 GTGGGAGATGGGAGGGGGAAAGG + Intergenic
965008329 3:163054922-163054944 GAGGGTTTGGGGAAGGGGAAAGG + Intergenic
965112932 3:164450528-164450550 TTGGTTTATGTGAAGGAGACAGG - Intergenic
965520718 3:169666065-169666087 GTGGGTTCTGTGAGGGGAACTGG + Intergenic
965910821 3:173773106-173773128 GTGGGTTATGGCAGTGGGGCTGG - Intronic
967124441 3:186411618-186411640 GTGGGCTAGGGGAAGGGCTCTGG + Intergenic
967568338 3:190997953-190997975 GTGGGGTGGGGGGAGGGGACAGG - Intergenic
967790937 3:193548332-193548354 GGGTGTAATGGGAAGGGGAAGGG + Intronic
967807811 3:193730821-193730843 GTGGCTGATGGGAAGGACACGGG + Intergenic
968610150 4:1553371-1553393 GCGGGGTCTGGGAAGGGGCCCGG + Intergenic
968739494 4:2320126-2320148 GTGGGGGAGGGGAGGGGGACAGG - Intronic
968938194 4:3624492-3624514 GTGGGTTCTGGGAAGGACAGGGG + Intergenic
968938226 4:3624594-3624616 GTGGGGTCTGGGAAGGGCAGGGG + Intergenic
968938290 4:3624802-3624824 GTGGGTTCTGGGAAGGACAAGGG + Intergenic
969302351 4:6304545-6304567 GTGGCCCAGGGGAAGGGGACAGG - Intergenic
969680290 4:8639618-8639640 GTGGGTAAGGGGGAGGGGAGAGG + Intergenic
970644006 4:18098576-18098598 TTGGGCTGTGGGAAGGGGTCAGG + Intergenic
970749625 4:19342068-19342090 GGGGCTTATTGGAAGGTGACTGG + Intergenic
971164636 4:24170562-24170584 GTGGGTGATGGGAAGTGAGCAGG - Intergenic
972503552 4:39698752-39698774 GTGGGTTGGGGGAAGGGGAAAGG + Intronic
973586283 4:52395127-52395149 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
973640233 4:52895313-52895335 GTGGGGTAGGGGTAGGGGAGAGG - Intronic
974017320 4:56659384-56659406 GTGGGTCTTTGGAAGGGGATGGG + Intronic
974135432 4:57810939-57810961 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
974380720 4:61136334-61136356 GTGGGGTGGGGGAAGGGGGCAGG + Intergenic
974944421 4:68509947-68509969 GTGGGGTAGGGGCAGGGGGCAGG - Intergenic
975691041 4:76963945-76963967 GTGGGGTAGGGGGAGGGGAGAGG - Intronic
976264783 4:83180334-83180356 GTTGATTAGGGGAAGTGGACAGG - Intergenic
976753860 4:88477545-88477567 GTGGGGGAGGGGAAGGGGAAGGG + Intronic
976772949 4:88674135-88674157 CTGGGGTGTGGGAAGGGGTCAGG + Intronic
976811318 4:89104163-89104185 CTGGCATCTGGGAAGGGGACTGG + Intronic
976833943 4:89348652-89348674 GTGGGTTGTGGGGAGGGGGGAGG - Intergenic
978291783 4:107150540-107150562 GTGGGGGATGGGGAGGGGAGGGG + Intronic
978368583 4:108007831-108007853 GTGGGTCATGGGTTGGGCACTGG + Intronic
979423066 4:120530529-120530551 GTGGGGTGTGGGGAGGGGGCAGG - Intergenic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
980137513 4:128872943-128872965 GTGGGTTGTGGATATGGGACTGG + Exonic
980326241 4:131350787-131350809 GTGGGTTATAGGATGTGGTCGGG + Intergenic
980331057 4:131411833-131411855 GTGGGTTATAGGGTGGGGAGGGG - Intergenic
980563629 4:134508849-134508871 GTGGGTTAGGGGAAGTGGAATGG - Intergenic
981265805 4:142782124-142782146 GTGGGGTGTGGGAAGGGGGGAGG - Intronic
981550462 4:145937232-145937254 GTGGAGGAGGGGAAGGGGACCGG + Intronic
981968814 4:150639202-150639224 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
983252594 4:165361596-165361618 GTGGGATGTGGGAAAGGGAAAGG + Intronic
983315412 4:166126882-166126904 GTGGGGTATGGGGAGGGGGGAGG - Intergenic
983410991 4:167398100-167398122 GTGGGGTGGGGGAAGGGGAAGGG - Intergenic
984090207 4:175364217-175364239 GAAGGTTATGGGAGGGGTACAGG - Intergenic
984871199 4:184326782-184326804 GTAAGTTATGGGAAGGTGAAGGG - Intergenic
985134308 4:186769922-186769944 GTGGGGTGGGGGAAGGGGGCAGG + Intergenic
985271315 4:188197178-188197200 GTGGGGAGTGGGAAGGGGATGGG - Intergenic
985968002 5:3352262-3352284 GTGGGTTGAGGGAGGGGGGCAGG + Intergenic
986243032 5:5978687-5978709 GTGGGCTTTGGGATGGGGAAGGG - Intergenic
986831304 5:11581849-11581871 GTGGGGCATGGGAAGGGGAAGGG + Intronic
986872678 5:12068414-12068436 TTGGGTAAAGGGAAGGGGAAGGG + Intergenic
988287755 5:29242490-29242512 GTGGGGTAGGGGAAGCGGGCAGG - Intergenic
988321179 5:29698460-29698482 GGGGGTAATGGAAAGGGGAAGGG + Intergenic
988879703 5:35487889-35487911 GTGGGTTGTGGGAAGGGCAGGGG - Intergenic
989072750 5:37528478-37528500 GTGGGTTAGGGGGAGGGGTGAGG + Intronic
989243943 5:39232378-39232400 GTGGGTTATTGCAAGGAGAACGG - Intronic
989983260 5:50667357-50667379 GTGGGGGAGGGGAAGGGGAGAGG - Intronic
990449428 5:55920809-55920831 CTTAGCTATGGGAAGGGGACAGG - Intronic
990981723 5:61607505-61607527 GTGGGCGCAGGGAAGGGGACTGG + Intergenic
992054122 5:72970842-72970864 GTGGGTTGCGGGGAGGGGAGAGG - Intronic
992087890 5:73294473-73294495 TTGGGGGATGGGAAGGGGAAAGG + Intergenic
992198110 5:74359575-74359597 GAGGGTGAGGGGAAGGGGAGAGG + Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
992795631 5:80253122-80253144 GTGGGATGTGGGAATGAGACAGG - Intronic
993259878 5:85644346-85644368 GTGGGTTGGGGGGAGGGGGCAGG + Intergenic
994050354 5:95355780-95355802 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
994774841 5:104028129-104028151 GAGGGTTTTGGGAAGGGGAAAGG - Intergenic
995276016 5:110278807-110278829 GTGGGGTATGGGGAGGGGGGAGG - Intergenic
995855738 5:116590212-116590234 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
997081096 5:130739393-130739415 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
997863213 5:137438347-137438369 ATGGGATATGGGAAAGGGAGAGG + Intronic
998160591 5:139810792-139810814 GTGGGGAAGGGGCAGGGGACTGG + Intronic
998378943 5:141710297-141710319 GGAGGTTGTGGGAAGGGGTCAGG + Intergenic
999700806 5:154225982-154226004 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
999932021 5:156443836-156443858 GTGGGCTGTGGGCAAGGGACAGG + Intronic
999991911 5:157057815-157057837 ATGGGGTAGGGGAAGGGGAGGGG - Intronic
1000105687 5:158056829-158056851 GCCGGTTAAGGGAAGAGGACAGG + Intergenic
1000182889 5:158829578-158829600 GGGGGTTAGGGGATGGGGATGGG + Intronic
1000359333 5:160433004-160433026 GTTGGTTATGGGAAGTGTGCTGG + Intergenic
1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG + Intronic
1001714347 5:173802775-173802797 CTGAGATATGAGAAGGGGACAGG - Intergenic
1001792956 5:174476362-174476384 GTGGGGTAGGGGGAGGGGAGAGG - Intergenic
1002768712 6:268234-268256 GTGGGGTGGGGGAAGGGGAAAGG + Intergenic
1002999538 6:2318312-2318334 GTGAATTATGGGAAGGGGCATGG + Intergenic
1003126217 6:3357963-3357985 GTGGGTGAGGGGAAGGGAAGAGG + Intronic
1004320440 6:14627775-14627797 CTGGGGTCTGGGAAGGAGACAGG + Intergenic
1005480419 6:26250057-26250079 GAGGGTTAGGGGATGGGGGCAGG - Intergenic
1006328611 6:33373179-33373201 GGGGGTGATGGGGAGGGGAGAGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1009043829 6:58213806-58213828 GTGGGGTGGGGGAAGGGGAGAGG + Intergenic
1010022540 6:71177497-71177519 ATGGGTCATGGGATGGGGAAAGG - Intergenic
1010742577 6:79526198-79526220 GTGGCTATTGGGAAGGGGAAAGG - Intronic
1010780587 6:79942091-79942113 GTGGGTAAAGGCAAGGGGAATGG + Intronic
1011350495 6:86417878-86417900 GGGGGCTTTGGGAAGGGGGCAGG - Intergenic
1011698039 6:89930740-89930762 GTGTGATTCGGGAAGGGGACAGG + Exonic
1012533953 6:100272894-100272916 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
1013321858 6:109000124-109000146 GGGGTTTAGGGGAAGGGGAAAGG + Intronic
1014061962 6:117082029-117082051 ATGGGGTAGGGGAAGGGGAGAGG + Intergenic
1014198508 6:118584339-118584361 GAGGGTTTTGGGGAGGGGAAAGG - Intronic
1014249273 6:119099186-119099208 GTGAGGTATGGGAAGGGGTGTGG - Intronic
1014249361 6:119099787-119099809 GTGAGGTATGGGAAGGGGTGTGG - Intronic
1014276750 6:119397378-119397400 GAGGGTTTTGGGGAGGGGAAAGG + Intergenic
1015893801 6:137997099-137997121 GAGGGGTAGGGGAAGGGGAAGGG + Intergenic
1015931014 6:138359907-138359929 GTGGTGTTTGAGAAGGGGACAGG + Intergenic
1016827858 6:148404788-148404810 GTGGGGTGTTGGAGGGGGACTGG - Intronic
1017294120 6:152774553-152774575 GTGGGGTGAGGGAAGGAGACAGG + Intergenic
1017867453 6:158456149-158456171 GTAAGTTATGGGAAGGTGAGGGG + Intronic
1018832323 6:167452683-167452705 ATGGGGTATGTGAAAGGGACTGG + Intergenic
1019476054 7:1244910-1244932 GTGGGGGATGGGCAGGGGATGGG - Intergenic
1022113387 7:27244463-27244485 GAGGGTTATGGGAAGGAGGCTGG - Intronic
1023165287 7:37337375-37337397 GTGGGGTAAGGGAAGGGGGGAGG + Intronic
1024016554 7:45321264-45321286 GTGGGGTAGGGGGAGGGGAAGGG + Intergenic
1024033752 7:45488664-45488686 GTGGGGTGTGGGGAGGGGAAAGG + Intergenic
1024117608 7:46208691-46208713 GGGTCTTATGGGAAGGGGTCAGG - Intergenic
1025597457 7:62949256-62949278 GTGGGGTAGGGGAAGGGGGCAGG - Intergenic
1026132234 7:67630137-67630159 GTGGGTGAAGGGAAGGGAAAGGG + Intergenic
1026253502 7:68691056-68691078 GGGGGGAATGGGAAGGGGAAGGG + Intergenic
1026287360 7:68975103-68975125 TTTGGTGATGGGGAGGGGACAGG + Intergenic
1027241193 7:76330357-76330379 GTGGGCTGGGGGAAGGGGGCTGG + Intronic
1027276357 7:76561341-76561363 GTGGGGTAGGGGAAGGGGGGAGG - Intergenic
1027768753 7:82380022-82380044 GTGGGTTATGGGATGATGAAGGG - Intronic
1027935005 7:84590590-84590612 GTGGGGTAGGGGAAGGGGGAGGG - Intergenic
1028743113 7:94298696-94298718 ATGGGCTATGGGCAGGGGAAGGG - Intergenic
1029370875 7:100149580-100149602 GTGCGTTCTGGGAAAGGGAGGGG + Intronic
1029467378 7:100734715-100734737 GCGGGTTCTGGGAGCGGGACAGG + Intronic
1030178900 7:106684525-106684547 GTGGGTTGTGGGGAGGGGGAGGG - Intergenic
1030625367 7:111840246-111840268 GTGGGGTATGGAAATGGGCCTGG - Intronic
1031143311 7:117969549-117969571 GTGGGGTTGGGGAAGGGGGCAGG + Intergenic
1031462834 7:122072810-122072832 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
1031824440 7:126545191-126545213 GTGGTTTAAGGGAAGGGTGCAGG + Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032286204 7:130540032-130540054 GTGGGTTGGGTGAAGGGGATGGG + Intronic
1032968024 7:137124206-137124228 ATGGTTTATGGGAATGGAACTGG - Intergenic
1033051211 7:138006022-138006044 GAGGATTATGTGAAGGGGAGAGG + Intronic
1033108335 7:138551666-138551688 GGGGGTTAAGGGAATAGGACAGG - Intronic
1033431949 7:141297498-141297520 GTGGGGTGGGGGAAGGGGAGAGG - Intronic
1033633131 7:143181154-143181176 GTGGGGTGTGGGGAGGGGGCAGG + Intergenic
1034412091 7:150947117-150947139 GTGGGGAAGGGGAAGGGGAGGGG + Intronic
1034452222 7:151143135-151143157 GTGGGTAATGGAAAGGGGGGTGG - Intronic
1034455558 7:151168005-151168027 CTGGGTGGAGGGAAGGGGACCGG - Intronic
1034730622 7:153384515-153384537 GTGGGTGATGGGAGAGGCACTGG + Intergenic
1035099398 7:156384041-156384063 TGGGGTTGTGGGAAGGGGACAGG - Intergenic
1035495265 7:159319846-159319868 TTGGGATGTGGGAAGAGGACAGG + Intergenic
1035895377 8:3393838-3393860 GTGGGGTGTGGGGAGGGGGCAGG + Intronic
1035967233 8:4206336-4206358 GTGGGTTGGGGGGAGGGGAAAGG - Intronic
1036615935 8:10387597-10387619 GTGGATTGTGGGAAGGTGAGGGG + Intronic
1037401640 8:18500053-18500075 GGGTGGTATGGGATGGGGACAGG + Intergenic
1037675053 8:21044061-21044083 GTGGATGATGGGAAGGAGATGGG - Intergenic
1038466925 8:27772752-27772774 GTGGGTTAAGGGAAAGAGGCTGG + Intronic
1039555144 8:38469802-38469824 GTGGGTGATGGTAAGGGAACAGG - Intergenic
1040969397 8:53117260-53117282 GTGGGGTAGGGGGAGGGGAGAGG - Intergenic
1041485940 8:58376019-58376041 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
1041862361 8:62529140-62529162 TTGAATTATGGGAAGAGGACAGG - Intronic
1042056498 8:64769767-64769789 GTGGGTTAAGGCACGGAGACAGG - Intronic
1042817925 8:72898291-72898313 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
1043134573 8:76505369-76505391 CTGAGTTATGGGAATAGGACTGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044574064 8:93749632-93749654 GTAGGATAGGGAAAGGGGACAGG + Intergenic
1045845125 8:106625172-106625194 GTGGGGTATGGGGAGGGAAGGGG - Intronic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1050417181 9:5429954-5429976 GTGGGTTGTGGCAGGGGGAGAGG - Intronic
1051813227 9:21074549-21074571 GTGTGATATGGGAAGGGGGAAGG + Intergenic
1051864304 9:21662217-21662239 GTGGGGTAGGGGGAGGGGAGAGG - Intergenic
1053101835 9:35377730-35377752 CTGGGCTATGGGGAGGAGACTGG + Intronic
1053430969 9:38041497-38041519 ATGGGTGATGGGAAGGAGAAGGG + Intronic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1054452910 9:65412957-65412979 GTGGGTTCTGGGAAGGACAAGGG - Intergenic
1054452969 9:65413165-65413187 GTGGGGTCTGGGAAGGGCAGGGG - Intergenic
1056052357 9:82782581-82782603 GTAGGTTAAAGGAAGGGGAGAGG + Intergenic
1056451902 9:86724456-86724478 GTACGGTATGGAAAGGGGACGGG + Intergenic
1056614677 9:88153676-88153698 GTGGGTTGGGGGTAGGGGAGAGG + Intergenic
1057082774 9:92185199-92185221 GTGGGGGATGGGAAGGGTGCTGG + Intergenic
1057267472 9:93628818-93628840 GTGGATAATGGGCAGGGCACAGG - Intronic
1057844678 9:98514253-98514275 GTGGGGTAGGGGGAGGGGAGAGG + Intronic
1058409887 9:104719896-104719918 GTGGGGTGGGGGAAGGGGAAGGG + Intergenic
1058748200 9:108012722-108012744 GTGGGTTAAGTGAAGGAGGCAGG - Intergenic
1060030902 9:120214032-120214054 GTGGGTGATTGGTGGGGGACAGG - Intergenic
1060158638 9:121338935-121338957 GTGGGCCAGGGGAAGGGGACAGG - Intergenic
1061154194 9:128847182-128847204 CTGGGTTCTGGGATGGGCACAGG + Intronic
1061523555 9:131138241-131138263 CTAGGTTATGGGGAGGGGAGGGG - Intronic
1061625266 9:131837623-131837645 GTGGGGTCTGGGGAAGGGACGGG + Intergenic
1061725509 9:132580200-132580222 GTGGGTGATGGGGAGGGAAGTGG + Intergenic
1062250668 9:135592151-135592173 GGGGATGATGGGAGGGGGACGGG - Intergenic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1187141285 X:16596333-16596355 GTGGGTTAGGGGGAGGGGGGAGG - Intronic
1187435429 X:19264158-19264180 GTGGGTGAGGGGAATGGGAGTGG - Intergenic
1189564133 X:42222256-42222278 GTGAGTAGGGGGAAGGGGACAGG - Intergenic
1190063522 X:47225468-47225490 TTGGTTTCTGGGAAGGGGCCTGG - Intronic
1190401147 X:50036088-50036110 GTGTGTTATGGAAAGAGCACTGG + Intronic
1190446169 X:50526483-50526505 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
1190965578 X:55297796-55297818 GTGGGTTGAGGGAAGGGGAGAGG - Intergenic
1191002981 X:55681296-55681318 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
1191999716 X:67136456-67136478 GTGGGGTGTGGGAAGGGGGAGGG - Intergenic
1193326786 X:80187686-80187708 GTGGGGTAGGGGAAGGGGGGAGG - Intergenic
1193632587 X:83908565-83908587 GTGGGGTAGGGGGAGGGGGCAGG - Intergenic
1194682755 X:96873501-96873523 GAGGGTTGTGGGAAGGAGATGGG + Intronic
1195276760 X:103288486-103288508 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1195721717 X:107874788-107874810 GAGGGTTTTGGGGAGGGGAAAGG + Intronic
1196100612 X:111843645-111843667 GTGTGTTATGGTAAAGGGGCAGG + Intronic
1196338460 X:114567368-114567390 GTGGGATATGGGAAGTAGAGGGG + Intergenic
1196581151 X:117380386-117380408 GTGGGGTGGGGGAAGGGGGCAGG + Intergenic
1196809782 X:119619815-119619837 GGGGGTGCTGGGAGGGGGACTGG + Intronic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198313161 X:135439028-135439050 GTGGGAAAGAGGAAGGGGACGGG + Intergenic
1198405352 X:136306657-136306679 GTGGGTTGAGGAAAGGGGATGGG - Intronic
1198527970 X:137521342-137521364 GTGGGTCATTGGCAAGGGACAGG - Intergenic
1199469095 X:148173558-148173580 GTGGGGTATGGGGAGGGGGGAGG + Intergenic
1199997726 X:153036891-153036913 GTGAGCTAAGGGAAGGGCACTGG - Intergenic
1200298288 X:154945018-154945040 GTGGGGTGGGGGAAGGGGAGAGG + Intronic