ID: 1145959468

View in Genome Browser
Species Human (GRCh38)
Location 17:28879100-28879122
Sequence CATCACAGGCAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145959468_1145959476 -5 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959476 17:28879118-28879140 TGATGGAGCCAGGTGTTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 230
1145959468_1145959478 0 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959478 17:28879123-28879145 GAGCCAGGTGTTCCAGGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 345
1145959468_1145959481 6 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG 0: 1
1: 1
2: 3
3: 38
4: 437
1145959468_1145959477 -1 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959477 17:28879122-28879144 GGAGCCAGGTGTTCCAGGGCTGG 0: 1
1: 0
2: 5
3: 137
4: 1323
1145959468_1145959479 1 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959479 17:28879124-28879146 AGCCAGGTGTTCCAGGGCTGGGG 0: 1
1: 0
2: 1
3: 37
4: 359
1145959468_1145959475 -6 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959475 17:28879117-28879139 GTGATGGAGCCAGGTGTTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145959468 Original CRISPR CATCACAGGCAGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr