ID: 1145959475

View in Genome Browser
Species Human (GRCh38)
Location 17:28879117-28879139
Sequence GTGATGGAGCCAGGTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145959471_1145959475 -10 Left 1145959471 17:28879104-28879126 CCACCTTCTGCCTGTGATGGAGC No data
Right 1145959475 17:28879117-28879139 GTGATGGAGCCAGGTGTTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 214
1145959466_1145959475 4 Left 1145959466 17:28879090-28879112 CCTGCTAGTCCCCTCCACCTTCT No data
Right 1145959475 17:28879117-28879139 GTGATGGAGCCAGGTGTTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 214
1145959469_1145959475 -7 Left 1145959469 17:28879101-28879123 CCTCCACCTTCTGCCTGTGATGG No data
Right 1145959475 17:28879117-28879139 GTGATGGAGCCAGGTGTTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 214
1145959467_1145959475 -5 Left 1145959467 17:28879099-28879121 CCCCTCCACCTTCTGCCTGTGAT No data
Right 1145959475 17:28879117-28879139 GTGATGGAGCCAGGTGTTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 214
1145959465_1145959475 5 Left 1145959465 17:28879089-28879111 CCCTGCTAGTCCCCTCCACCTTC No data
Right 1145959475 17:28879117-28879139 GTGATGGAGCCAGGTGTTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 214
1145959468_1145959475 -6 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959475 17:28879117-28879139 GTGATGGAGCCAGGTGTTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145959475 Original CRISPR GTGATGGAGCCAGGTGTTCC AGG Intergenic
900435484 1:2628891-2628913 GTGAGGCAGCCAGGTGAGCCCGG + Intronic
900618074 1:3574228-3574250 GAGATGGAGCCAGGCGTTGCTGG - Intronic
900941454 1:5801319-5801341 CTGATGGCCCCAGGTGTTCTTGG - Intergenic
901331665 1:8414110-8414132 GTGAAGGGGCCAGGTGGGCCAGG - Intronic
902142664 1:14369920-14369942 GTGTTAGAGCCAGTTGTTTCTGG - Intergenic
902762732 1:18594242-18594264 GGGAAGGAGCTAGGTTTTCCTGG + Intergenic
903715133 1:25359748-25359770 ATGATGAAGGCAGGTGTTTCGGG - Intronic
903853142 1:26320334-26320356 GTGATGGTGGCAGCTGTTTCAGG - Exonic
903925380 1:26827436-26827458 GGCATGGAGGCTGGTGTTCCTGG - Intronic
904054190 1:27659503-27659525 GTGCTGGTGCTAGGTGCTCCAGG - Intergenic
905222573 1:36458950-36458972 GTGATGGAGCCATGTGGTCGGGG - Intronic
905349807 1:37337653-37337675 CTGATGAAGCCAGTTCTTCCTGG - Intergenic
905851614 1:41279128-41279150 AAGATGGAGACAGGTATTCCCGG + Intergenic
907304486 1:53506148-53506170 GTGACAGAGCCAGGTGTTCAGGG - Intergenic
908921352 1:69197455-69197477 CTGATTGAGCCCGGTGTGCCAGG - Intergenic
912386055 1:109271723-109271745 GTGAGGGAGCCAGGGGTCTCAGG + Intronic
912392293 1:109311905-109311927 GGGATGGAGTCAGTTGTTCAGGG - Exonic
916395371 1:164381086-164381108 GTGGTGGCGCCATGTATTCCTGG - Intergenic
920365814 1:205447907-205447929 GTGAAGGAGTGAGGTTTTCCTGG + Intronic
922535139 1:226373983-226374005 GTGTTGGAGAGAGTTGTTCCTGG - Intronic
922559793 1:226560992-226561014 ATGATGGAGGAAGGTGTACCAGG - Intronic
923048011 1:230369565-230369587 GAGATGGAGCCAGGTGTGTGGGG - Intronic
924559595 1:245146750-245146772 GAGAGGGAGCCAGGAGTTCAAGG - Intergenic
1065519280 10:26555681-26555703 TAGATGGAACCAGGTGTTCGAGG - Intronic
1065988373 10:30980514-30980536 GTGATATACCCAGTTGTTCCAGG - Intronic
1066654811 10:37687567-37687589 GTGATGGAGCCAAGTGAACCAGG + Intergenic
1067989011 10:51188650-51188672 TTGTGGGAGCCTGGTGTTCCTGG + Intronic
1068185580 10:53581316-53581338 GTGATGGAGCCAGCTTGTACTGG - Intergenic
1068492159 10:57737740-57737762 GAGATGGAGCCAGCGGGTCCTGG + Intergenic
1069604125 10:69729223-69729245 GTGATGGAGCCGGATGATCAGGG + Intergenic
1070304217 10:75228827-75228849 GAAATGAAGGCAGGTGTTCCTGG + Intronic
1070797274 10:79223948-79223970 GTGATGGTCCCTGGGGTTCCAGG + Intronic
1074840294 10:117344709-117344731 ATGAGGGAGCCCTGTGTTCCTGG - Intronic
1074867574 10:117553815-117553837 GTGCTGGAGCCTGGTCCTCCCGG + Intergenic
1075639215 10:124052586-124052608 GTGCTGGAGCCAGGTTGCCCAGG + Intronic
1076447406 10:130526143-130526165 GTCAGGGAGCCAGGTGCACCTGG - Intergenic
1077109175 11:854539-854561 GTCTCGGAGCCAGGTGGTCCAGG + Intronic
1077522592 11:3045169-3045191 GTGCTGGAGGCTGGTGATCCAGG + Intronic
1078019138 11:7640813-7640835 GTGAGGGGACCAAGTGTTCCTGG - Intronic
1079970425 11:27029777-27029799 GTGCTGGAGCCAGGTATTACAGG + Intergenic
1081874735 11:46400897-46400919 GAGCTGGAGCCGGGTGTCCCAGG - Intronic
1084897019 11:72280233-72280255 GTCATGGAGACAGGTGCTCTCGG + Intergenic
1085868182 11:80319542-80319564 CTGATGGGGCAAGGTATTCCAGG - Intergenic
1089156872 11:116409452-116409474 GGGATGCAGCCAGCTCTTCCTGG + Intergenic
1089599693 11:119605696-119605718 GGGATGGAGACAGGGGTTCTTGG - Intergenic
1090974712 11:131671368-131671390 AGGATGGAGACAGGTGTCCCTGG - Intronic
1091433856 12:458962-458984 GTGAAGGATCAAAGTGTTCCTGG - Intergenic
1091983184 12:4883180-4883202 GTTTTGGAGCCAGATATTCCTGG + Intergenic
1092211782 12:6651101-6651123 GTGCTGGGGCCAGGGGTTCAGGG - Exonic
1092768008 12:11870440-11870462 GTATTGGAGGCAGGTGTTGCTGG + Intronic
1092924101 12:13258237-13258259 GAGATGGAGGCAGTTGCTCCAGG + Intergenic
1093448886 12:19292600-19292622 GTGGTGGCACCAGGTGTGCCTGG + Intronic
1095472995 12:42556287-42556309 GGGGAGGAGCCAGGTCTTCCAGG - Intronic
1096112390 12:49037317-49037339 TGGATGGAGCCAGGCGTTGCTGG + Exonic
1096431490 12:51547568-51547590 GTGCTGGAGCCAGCTTGTCCTGG + Intergenic
1096676581 12:53229637-53229659 CTGATGGAGCCAGGAGTTTGGGG + Intronic
1096796656 12:54082196-54082218 ATGTTTCAGCCAGGTGTTCCTGG + Intergenic
1102050454 12:109858091-109858113 GAGATGGAGCCAGGTAGGCCTGG + Intronic
1102529148 12:113533241-113533263 GAGATGGAGGAAGGGGTTCCAGG - Intergenic
1104284042 12:127406809-127406831 GTGAGGGAACCATCTGTTCCAGG + Intergenic
1107303692 13:38994757-38994779 AAGATGTATCCAGGTGTTCCAGG + Intergenic
1109651431 13:65332124-65332146 ATGATGGAGAGAGGTGTTCAGGG + Intergenic
1110964566 13:81676394-81676416 GTGGTGGACCCAAGTGTTCTTGG + Intergenic
1111757923 13:92421999-92422021 GTGATGATGCCAGGAGTTCCGGG - Intronic
1112713743 13:102160072-102160094 GAGATGGAGGAAGGTGTGCCAGG - Intronic
1113583804 13:111449033-111449055 GTGGTAGTGCCAGGCGTTCCGGG - Intergenic
1113593996 13:111518577-111518599 GTGGTGGAGCCTGTTGCTCCTGG + Intergenic
1115027524 14:28761704-28761726 GTGACGCTGCCAGGTGTTCCAGG - Intergenic
1115062842 14:29214676-29214698 GTGGAGGAGCCAGGAGTTCAGGG + Intergenic
1115533977 14:34355244-34355266 GAGATGGAGCTAGGTGAACCTGG - Intronic
1116734461 14:48671244-48671266 CTGGTGGATCCAGGTGCTCCTGG - Intergenic
1116958555 14:50947181-50947203 GTGATGGAACCAGGTGATTTAGG + Intergenic
1119772366 14:77228224-77228246 GTGGTGGAGGCAGGAATTCCTGG + Intronic
1121550259 14:94794046-94794068 GTTAAGGAGCCAGGAGTTCGAGG + Intergenic
1121667518 14:95684574-95684596 GATATGGACCCAGCTGTTCCTGG - Intergenic
1121710255 14:96032291-96032313 GTGATGGAGCCAGGTGGGTGGGG + Intergenic
1121882348 14:97512185-97512207 CTGATGAAGGCATGTGTTCCAGG + Intergenic
1123772810 15:23546115-23546137 GTGCTGGAGCAAGGTTCTCCAGG - Intergenic
1126106531 15:45150565-45150587 GCGTTTGAGCCAGGTCTTCCTGG + Intronic
1127723964 15:61729277-61729299 GTGATCCAGGCAGATGTTCCGGG + Intergenic
1127910239 15:63410750-63410772 GAGGTGGGGCCAGGGGTTCCAGG - Intergenic
1128344923 15:66847709-66847731 GTGGTGCAGCCAGTTGATCCTGG - Intergenic
1130650018 15:85757139-85757161 GTGATGGGGCAAGGTCTCCCTGG - Intergenic
1130917767 15:88319150-88319172 TTGATGGAGCCAGGAGGTCAAGG + Intergenic
1132556828 16:576266-576288 GGGGTGGAGCCCGGTGTCCCGGG + Intronic
1133248899 16:4467172-4467194 CTCATGGCTCCAGGTGTTCCTGG - Intronic
1133340617 16:5033477-5033499 GTGCTGGAGCCCGGTGGACCCGG - Exonic
1133401952 16:5494597-5494619 CTTCTGGAGGCAGGTGTTCCTGG + Intergenic
1134264377 16:12680800-12680822 GTGATGGGTCCACGTGCTCCTGG + Intronic
1135279490 16:21141553-21141575 GTGATGAAGCCAGTTCTTCAGGG - Intronic
1136061972 16:27732791-27732813 GGGAAGGAGCCAGGGGTTCTGGG - Intronic
1136061982 16:27732814-27732836 GTGCTGGAGCCAGCACTTCCGGG + Intronic
1137046335 16:35666046-35666068 GTGATGGAGACAGATCTACCAGG + Intergenic
1139846853 16:69927475-69927497 GAGGTCGAGCCAGGTGTTCCTGG + Intronic
1140502943 16:75450741-75450763 TTGCTGGAGCCAGGAGGTCCAGG - Intronic
1141453459 16:84121179-84121201 GGCATGGAGACAGGTGCTCCCGG - Intergenic
1141705824 16:85663924-85663946 GGGGAGGTGCCAGGTGTTCCAGG + Intronic
1142010029 16:87709255-87709277 GAGATGGACCCAGGTGAGCCAGG - Exonic
1142246668 16:88973345-88973367 CTGCTGGTCCCAGGTGTTCCTGG - Intronic
1142644491 17:1303063-1303085 GGGACGGGGCCAGGTGCTCCTGG - Intergenic
1144419258 17:15081118-15081140 GTGCTGGAGCCAGGTGGTACTGG - Intergenic
1145959475 17:28879117-28879139 GTGATGGAGCCAGGTGTTCCAGG + Intergenic
1146595708 17:34166622-34166644 GTGATGGAGCTGGGTGTGCAGGG + Intronic
1146901707 17:36593044-36593066 GTGATGGAGCCAGGTGACCTTGG - Intronic
1147028326 17:37609088-37609110 GTGCTGGACGCTGGTGTTCCGGG - Intronic
1148819226 17:50350912-50350934 GGGTTGGAGCCAGGAGTGCCAGG + Intronic
1151596647 17:75082092-75082114 GTTATGGAGACAGGTGTTCATGG - Intergenic
1151973474 17:77471121-77471143 GTGAAGGGGCCAACTGTTCCAGG - Intronic
1152053283 17:77999549-77999571 GTGATGGAGTCAGGCCTTCTGGG - Intergenic
1152299095 17:79485040-79485062 AGGATGGAGGCAGGTGGTCCAGG + Intronic
1152377793 17:79927726-79927748 GTGCTGGAACCAGGAGTTCAGGG + Intergenic
1152751504 17:82064615-82064637 GTGGTGGAGCCAGGGCTGCCAGG - Intronic
1152883087 17:82831560-82831582 GAGATGGAGCCAGGTGCTTAGGG + Exonic
1154287381 18:13072382-13072404 TTGGTTGAGCCAGGTATTCCAGG + Intronic
1155327091 18:24675550-24675572 GTTATGGAGCCAGGGTCTCCAGG - Intergenic
1156235222 18:35196511-35196533 TTGTTTGAGCCAGGAGTTCCAGG + Intergenic
1160553183 18:79708494-79708516 GACGTGGAGCCAGGCGTTCCGGG + Intronic
1160996000 19:1882118-1882140 GTGCTGGAGCCGGGCGTTTCGGG - Intronic
1161013306 19:1970446-1970468 GGGACGGAGCCAGGTGGGCCAGG - Intronic
1161100921 19:2421505-2421527 ATGATGAAGTCAGGAGTTCCAGG - Intronic
1161597368 19:5157453-5157475 CTGGTGGCCCCAGGTGTTCCTGG + Intergenic
1162510181 19:11113265-11113287 GCGATGGAGCCTGGGGGTCCGGG - Exonic
1163136509 19:15315343-15315365 GTGAGTGAGGCAGGTGTTTCAGG - Intronic
1164840793 19:31390689-31390711 CTGGTGGCTCCAGGTGTTCCTGG + Intergenic
1166335154 19:42101507-42101529 GTGATGGAGAGATCTGTTCCAGG - Intronic
1166565286 19:43761373-43761395 GAGATGGAGCCAGGAGTGTCAGG + Intergenic
925290955 2:2748472-2748494 ATGAAGAAGGCAGGTGTTCCAGG - Intergenic
927517216 2:23679407-23679429 GTGGTGGTGCCAGGGGTCCCTGG + Intronic
929217527 2:39431475-39431497 GGGATGGATCCAGGTTTTACGGG - Intronic
929822711 2:45286214-45286236 GTGATGGAGCCTGTCTTTCCTGG - Intergenic
932702518 2:74001541-74001563 GTGATGGAGCCTGGAGTTTGTGG + Intronic
932876645 2:75459299-75459321 CTGCTGGATCCAGCTGTTCCAGG + Intergenic
935616901 2:105095428-105095450 GTCATGGAGCCAGATGGTCGAGG + Intronic
937004785 2:118501417-118501439 GGGATGGAGCCAGGGCTTCGAGG + Intergenic
940293720 2:152101256-152101278 GTGAGGGAGCCCTGTGTTCTTGG - Intergenic
940861471 2:158774397-158774419 GAGATGGAGAAAGGAGTTCCTGG + Intergenic
946507815 2:220320179-220320201 GGCACCGAGCCAGGTGTTCCTGG + Intergenic
949006278 2:241650444-241650466 GTGATGAAGGCAGATGCTCCGGG - Intronic
1170762471 20:19262998-19263020 GTGATGGAGCGAGGGATTCTAGG - Intronic
1170804992 20:19621803-19621825 ATGGTGGAGCCAGGGGTTCCAGG - Intronic
1171238014 20:23543723-23543745 GTCATGGAGCCAGGAGTTGCAGG + Intergenic
1171524702 20:25799697-25799719 GTGTGGAAGCCAAGTGTTCCAGG + Intronic
1171552125 20:26056186-26056208 GTGTGGAAGCCAAGTGTTCCAGG - Intergenic
1171848119 20:30290209-30290231 ATGTTTCAGCCAGGTGTTCCTGG + Intergenic
1173021741 20:39273238-39273260 GTAAAGGAGCCAGTTGTTCATGG + Intergenic
1173745795 20:45435944-45435966 GTGATGAAGCCAGGGGCACCAGG + Intergenic
1174692970 20:52527432-52527454 GTGATGGAGCCAGGTCTACCTGG + Intergenic
1175303026 20:57956386-57956408 GTGCTGGAGCCAGCTCCTCCTGG + Intergenic
1175373049 20:58505612-58505634 GGGATGGCACCAGGTGTTTCTGG - Intronic
1175665474 20:60854894-60854916 GTGAAGGAGCCAGGTGTGTTGGG - Intergenic
1175759189 20:61549920-61549942 GTGAAGGTGCCAGCTGGTCCTGG + Intronic
1175830496 20:61962769-61962791 TTGCTTGAGCCAGGAGTTCCAGG + Intronic
1176418609 21:6496020-6496042 GTCATGGAGACAGGTGCTCTCGG - Intergenic
1177243913 21:18497727-18497749 CTGATGGCTCCAGATGTTCCTGG - Intergenic
1178197462 21:30364114-30364136 GTATTGAAGCCAGGAGTTCCAGG - Intronic
1178884711 21:36476102-36476124 GAGATGGAGACAGGTGTCTCTGG + Intronic
1179694103 21:43104342-43104364 GTCATGGAGACAGGTGCTCTCGG - Exonic
1181727643 22:24822591-24822613 GAGAGGGAGCCAGGTGGTGCTGG + Intronic
1182062612 22:27408533-27408555 GCGGTGCCGCCAGGTGTTCCTGG + Intergenic
1182233347 22:28855991-28856013 GTGATGGAGCCAAGATTTCATGG - Intergenic
1182691755 22:32169016-32169038 GTGATGGAATCAAGTGTTCCTGG + Intergenic
1184713397 22:46266565-46266587 TTGCTGGAGCCAGGAGTTCAAGG + Intergenic
1185115268 22:48930866-48930888 GTGATGGAGTCATGTGATACAGG + Intergenic
950481364 3:13246324-13246346 GAAATGGAGTCAGGGGTTCCAGG + Intergenic
950812200 3:15659497-15659519 ATGATGGAGCCAGGGGTGGCTGG - Intergenic
951802956 3:26617048-26617070 GTTTTGGAGACAGGTGATCCTGG + Intergenic
955885917 3:63598237-63598259 GAGATGGAGACAGGTTTACCTGG + Intronic
956619519 3:71207069-71207091 ATGATGGGGCCAGGTGTTCTGGG + Intronic
959156164 3:102668437-102668459 GTGAAGGAGGCAGGAGTCCCGGG + Intergenic
961302329 3:125930287-125930309 ATGCTGGAGCCAGGTGGGCCGGG - Intronic
962812553 3:138972062-138972084 GGCAGGGAGCCAGGTGGTCCCGG + Intergenic
966494677 3:180566539-180566561 GGGAGGGAGCCAGGTGATCTTGG - Intergenic
966896470 3:184448688-184448710 GTGCTGGAATCAGGTGTCCCAGG + Intronic
967190225 3:186978448-186978470 CTTCTGGAGCCTGGTGTTCCAGG + Intronic
967851775 3:194087986-194088008 GTGGTGAAGACAGGTGGTCCAGG + Intergenic
967948327 3:194821699-194821721 CTGATGGCGCCAGATGTTTCTGG + Intergenic
968815398 4:2819015-2819037 TCGATTGAGCCAGGAGTTCCAGG - Intronic
968919754 4:3516449-3516471 CTGATGGAGGCAGGTGTTTCTGG - Intronic
971884367 4:32424037-32424059 GTGATGGAGCCTGTAGTCCCAGG - Intergenic
973548411 4:52005805-52005827 GTGCTGGAGCCAGGTGCTGCTGG - Intronic
976167476 4:82271323-82271345 AGGATGGAGCCAGGAGTTCGAGG + Intergenic
978415888 4:108475580-108475602 GTGATGGAGGCATCTGTTGCAGG + Intergenic
979388237 4:120095519-120095541 GTGATAGGGCCATGTGTTACAGG + Intergenic
981239456 4:142458900-142458922 GTGATGCAGACAGGTGTCCTGGG + Intronic
982067354 4:151665992-151666014 GTGAGGGAGCCAAGGGTTCCTGG + Intergenic
982376065 4:154692295-154692317 GAGATGGAGATAGGTGTCCCTGG - Intronic
984725733 4:183018735-183018757 GTGATGAAACGAGGTGTTTCTGG - Intergenic
988626495 5:32881252-32881274 ATGGTGAAGCCATGTGTTCCTGG + Intergenic
997787529 5:136727356-136727378 TTGATTGAGCCAGGAGTTCAAGG - Intergenic
999609282 5:153351695-153351717 GAGATGGAGCCAGGTTTTGTGGG - Intergenic
999872381 5:155765904-155765926 GTGAAGGAGACAGCTGTGCCTGG + Intergenic
1001425904 5:171622208-171622230 GGGCTGGAGCCGGGTGTTCCTGG - Intergenic
1001924869 5:175628667-175628689 GGGATGGAGCCAGGGTTTCCGGG - Intergenic
1002043051 5:176528327-176528349 GAGAGGGAGCCCTGTGTTCCCGG - Exonic
1002819492 6:711327-711349 GGGAGGAAGCCAGGTCTTCCAGG + Intergenic
1002933974 6:1656062-1656084 GCCATGGAGACAGGTGTTCTGGG - Intronic
1004454719 6:15781807-15781829 GTGTTGGTGCCAGCTGTTCCAGG - Intergenic
1004714961 6:18208078-18208100 GGGATGGAACCACGTGATCCAGG - Intronic
1011044435 6:83066120-83066142 ATGATGGAGGCAAGTGTTACAGG + Intergenic
1012641152 6:101616082-101616104 GTGATGGAGCCAGGTGTCTCAGG - Intronic
1013116237 6:107105791-107105813 CTGCTGGGGCCAGGTCTTCCTGG - Intronic
1015395623 6:132731530-132731552 GTGAAGGAGGCAGGTGTCCATGG + Intronic
1015693808 6:135957131-135957153 GAGATAGAGACAGGTGTGCCTGG + Intronic
1017897184 6:158690870-158690892 GTGATGATGCCAGGTTGTCCTGG - Intronic
1018811278 6:167300106-167300128 GTCCTCAAGCCAGGTGTTCCCGG - Intronic
1018859701 6:167702416-167702438 GTGGTGGAGCCTGTTGCTCCAGG + Intergenic
1021943993 7:25707453-25707475 GTCATGGAGCCAGGCGGACCGGG - Intergenic
1022171274 7:27834477-27834499 GGCCTGGAGCCAGGTGTTCAGGG - Intronic
1023611783 7:41978975-41978997 GGGATGGAGCCTGGCATTCCAGG + Intronic
1023613909 7:41999233-41999255 GTGATGAAGGCAGGTGTCCTAGG - Intronic
1023892173 7:44400716-44400738 CTGGTGGCTCCAGGTGTTCCTGG + Intronic
1028400341 7:90418725-90418747 GTGCTGGAGCCAAGTGGTACTGG + Intronic
1030086178 7:105817839-105817861 TTGCTTGAGCCAGGAGTTCCAGG + Intronic
1030937802 7:115607288-115607310 GTGATGGTGGGAGGTGTTTCAGG - Intergenic
1032515671 7:132504366-132504388 GTGAAGGAGGCAGGTGGCCCAGG + Intronic
1032938211 7:136758348-136758370 ATGGTGGAGGCAGGTGTCCCAGG + Intergenic
1035454685 7:159000262-159000284 CTCAGGGAGCCAGCTGTTCCTGG - Intergenic
1037403275 8:18515309-18515331 GTCATGGGGCCAGGGGCTCCAGG + Intergenic
1038081119 8:24137390-24137412 GTGATTGAGCTATGTCTTCCTGG - Intergenic
1045288458 8:100811809-100811831 GTGATGGGTCCAGGTGTTACCGG + Intergenic
1047948758 8:129910149-129910171 ATCTTGGAGCCAGGAGTTCCAGG - Intronic
1048024966 8:130577924-130577946 GAGATCGAGCCAGGAGATCCTGG - Intergenic
1049343538 8:142126636-142126658 GTTGTGGAGTCAGGTGTCCCTGG + Intergenic
1051023366 9:12573288-12573310 GTGATGGAGAAAGGTCTTCCAGG + Intergenic
1051679259 9:19590669-19590691 GGTAAGGAGCCAGGTGTTGCAGG - Intronic
1052101415 9:24450531-24450553 GTGATGGTGTCAGGTGTTCATGG + Intergenic
1052534555 9:29730888-29730910 GTGATAGAGTCAGGATTTCCGGG - Intergenic
1053786252 9:41654861-41654883 ATGTTTCAGCCAGGTGTTCCTGG + Intergenic
1054158800 9:61659338-61659360 ATGTTTCAGCCAGGTGTTCCTGG - Intergenic
1054174964 9:61868805-61868827 ATGTTTCAGCCAGGTGTTCCTGG + Intergenic
1054449826 9:65397849-65397871 ATGTTTCAGCCAGGTGTTCCTGG + Intergenic
1054478574 9:65590343-65590365 ATGTTTCAGCCAGGTGTTCCTGG - Intergenic
1054662573 9:67711988-67712010 ATGTTTCAGCCAGGTGTTCCTGG - Intergenic
1054833786 9:69654585-69654607 GTGGTGGAGCCATCAGTTCCTGG - Intronic
1057459808 9:95250975-95250997 GTGCTGGAGCCATGTTTTGCAGG - Intronic
1060572176 9:124652140-124652162 GTGGTGGAGGTAGGTATTCCAGG + Intronic
1189875514 X:45432768-45432790 CTGATGAAGCCATGTTTTCCTGG + Intergenic
1191207796 X:57852947-57852969 GGGAGGGACCTAGGTGTTCCTGG + Intergenic
1195140750 X:101957009-101957031 GTGATGGAGCCAGGAGTCCTAGG + Intergenic
1197281839 X:124546109-124546131 GGGATGTAGACAGGAGTTCCTGG + Intronic
1200767707 Y:7094364-7094386 GTGATGGAGCCTGGGGTCCAAGG - Intergenic
1201722201 Y:17112003-17112025 GAGATGGAGCCATTTGTTACTGG + Intergenic