ID: 1145959476

View in Genome Browser
Species Human (GRCh38)
Location 17:28879118-28879140
Sequence TGATGGAGCCAGGTGTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145959465_1145959476 6 Left 1145959465 17:28879089-28879111 CCCTGCTAGTCCCCTCCACCTTC No data
Right 1145959476 17:28879118-28879140 TGATGGAGCCAGGTGTTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 230
1145959469_1145959476 -6 Left 1145959469 17:28879101-28879123 CCTCCACCTTCTGCCTGTGATGG No data
Right 1145959476 17:28879118-28879140 TGATGGAGCCAGGTGTTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 230
1145959467_1145959476 -4 Left 1145959467 17:28879099-28879121 CCCCTCCACCTTCTGCCTGTGAT No data
Right 1145959476 17:28879118-28879140 TGATGGAGCCAGGTGTTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 230
1145959468_1145959476 -5 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959476 17:28879118-28879140 TGATGGAGCCAGGTGTTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 230
1145959471_1145959476 -9 Left 1145959471 17:28879104-28879126 CCACCTTCTGCCTGTGATGGAGC No data
Right 1145959476 17:28879118-28879140 TGATGGAGCCAGGTGTTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 230
1145959466_1145959476 5 Left 1145959466 17:28879090-28879112 CCTGCTAGTCCCCTCCACCTTCT No data
Right 1145959476 17:28879118-28879140 TGATGGAGCCAGGTGTTCCAGGG 0: 1
1: 0
2: 1
3: 14
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145959476 Original CRISPR TGATGGAGCCAGGTGTTCCA GGG Intergenic
900618073 1:3574227-3574249 AGATGGAGCCAGGCGTTGCTGGG - Intronic
900886506 1:5419275-5419297 AGCTGGAGGCAGGAGTTCCAAGG - Intergenic
901226322 1:7614831-7614853 AGATGGAGCCAGGGCTTTCAGGG - Intronic
901331664 1:8414109-8414131 TGAAGGGGCCAGGTGGGCCAGGG - Intronic
901829268 1:11882152-11882174 TGGTGGCTCCAGGTGTTCCTTGG - Intergenic
903715132 1:25359747-25359769 TGATGAAGGCAGGTGTTTCGGGG - Intronic
903853141 1:26320333-26320355 TGATGGTGGCAGCTGTTTCAGGG - Exonic
904054189 1:27659502-27659524 TGCTGGTGCTAGGTGCTCCAGGG - Intergenic
905851615 1:41279129-41279151 AGATGGAGACAGGTATTCCCGGG + Intergenic
905866994 1:41382001-41382023 TGATGGCGCCAGGGCCTCCAGGG - Exonic
905873361 1:41417235-41417257 TGATGCAGCCAAGTGCGCCAAGG - Intergenic
908378509 1:63571964-63571986 TGATTTAGCCAGGGGTTCAAAGG + Intronic
910790639 1:91046274-91046296 AGATGGAGCCAGGCTTTACAAGG + Intergenic
911174523 1:94805817-94805839 TGCTTGAGCCAGGAGTTCAAAGG + Intergenic
913127435 1:115805745-115805767 TGATGAGGCCAGGGGTCCCAAGG + Intergenic
913973407 1:143434301-143434323 TGGTGCAACCAGGTGATCCAAGG - Intergenic
914067794 1:144259908-144259930 TGGTGCAACCAGGTGATCCAAGG - Intergenic
914111361 1:144706446-144706468 TGGTGCAACCAGGTGATCCAAGG + Intergenic
915470728 1:156124256-156124278 TGAGGGGGGCAGCTGTTCCAGGG - Intronic
916143739 1:161722346-161722368 TGCTGGAGCCTGGGGTTCTATGG + Intronic
919011458 1:191970582-191970604 TTATGGAGACTAGTGTTCCATGG + Intergenic
920041206 1:203098668-203098690 TGAGGGAGCCAGGAGATCCTAGG + Intronic
922604550 1:226881355-226881377 TGATGGAGACTGGTTTTCCCAGG - Intronic
922720978 1:227900181-227900203 TGACGGAGTCATGTGTTTCAAGG - Intergenic
924508277 1:244706418-244706440 GGATGAAAGCAGGTGTTCCATGG - Exonic
924603955 1:245516242-245516264 TGATGAAGCAAGCTCTTCCATGG + Intronic
1063436333 10:6035231-6035253 TGAGAGAGCCAGGGGTTCCTTGG + Intronic
1066261938 10:33737798-33737820 AGATGGAGCCAGTCCTTCCATGG + Intergenic
1069342845 10:67432511-67432533 TGGTGGTTCCAGGTGTTCCCTGG + Intronic
1069567576 10:69474062-69474084 TGATTCAGCCAGGTGTCCCCTGG + Intronic
1070975966 10:80605916-80605938 TGATGGAGCCACATGGACCATGG + Intronic
1071905100 10:90164154-90164176 TGAGAGAGCCAGTTCTTCCAAGG + Intergenic
1074523797 10:114247721-114247743 TGATGGAGGCAGGAGTCCAATGG + Intronic
1075125841 10:119698205-119698227 TGGTGGTCCCAGGTGTTCCTTGG + Intergenic
1075318056 10:121467906-121467928 TGGTGGCGCCAAGTGTTCCTTGG - Intergenic
1075512980 10:123087099-123087121 TCGTGGAGCCAGATGTCCCACGG + Intergenic
1075618839 10:123910872-123910894 TGGTGGCCCCAGGTGTTCCTTGG + Intronic
1076100076 10:127770130-127770152 TGTTGTAGCCAGGACTTCCAAGG - Intergenic
1077109176 11:854540-854562 TCTCGGAGCCAGGTGGTCCAGGG + Intronic
1077400988 11:2357301-2357323 TTAGGGAGCCAGGTGATCAATGG + Intergenic
1077522593 11:3045170-3045192 TGCTGGAGGCTGGTGATCCAGGG + Intronic
1078608145 11:12795651-12795673 TGATGTTGCCAGTTGGTCCATGG - Intronic
1079427379 11:20356548-20356570 TGATGGCTCCAGGCGTTCCTCGG - Intergenic
1080200973 11:29669521-29669543 TGATGGAGGCAGGTCTCCCTTGG - Intergenic
1082137693 11:48568313-48568335 TCATGGACCAAGTTGTTCCAAGG + Intergenic
1082614477 11:55341699-55341721 TCATGGACCAAGTTGTTCCAAGG + Intergenic
1084445640 11:69202061-69202083 TGAGGGAGCCAGGGGTTACCTGG + Intergenic
1084978465 11:72815854-72815876 TGATGGGGGAGGGTGTTCCAGGG + Intronic
1085085792 11:73665878-73665900 TGATGGAGGCAGGTGGTCTCAGG - Intergenic
1090912984 11:131137728-131137750 TGGTGGCTCCAGGTGTTGCACGG - Intergenic
1091179987 11:133595889-133595911 TGATGGAGGCAGGTCTTCTCAGG - Intergenic
1092924102 12:13258238-13258260 AGATGGAGGCAGTTGCTCCAGGG + Intergenic
1093421731 12:18981857-18981879 TTTTGGAGACAGGTGTTCTATGG - Intergenic
1094641441 12:32279709-32279731 TAATGGAGGCAGGTATCCCATGG + Intronic
1095472994 12:42556286-42556308 GGGAGGAGCCAGGTCTTCCAGGG - Intronic
1096676582 12:53229638-53229660 TGATGGAGCCAGGAGTTTGGGGG + Intronic
1098284440 12:68893498-68893520 TCAGGGAGTCAGGTGTCCCAGGG + Intronic
1099662490 12:85582262-85582284 TGCTGGAGCCAGAAGTTCTAGGG - Intergenic
1100667807 12:96773350-96773372 TGAGGGAGACAGGTGATTCAAGG - Intronic
1100882310 12:99032426-99032448 TGGTGGCTCCAGGTGTTCCTTGG + Intronic
1101491824 12:105216619-105216641 TGGTGGCTCCAGGTGTTCCTTGG - Intronic
1102340409 12:112117078-112117100 AGATGGAGTTAGGTCTTCCAAGG - Intergenic
1103840915 12:123863555-123863577 TGGTGGTTCCAGGTGTTCCTTGG + Intronic
1105061334 12:133153874-133153896 TGCTGGCCCCAGGTGTTCCTTGG + Intronic
1106575245 13:30968395-30968417 TGATGAAGCCTGGCTTTCCAAGG - Intronic
1107519344 13:41163685-41163707 TGCTTGAGCCAGGAGTTCAAGGG + Intergenic
1107725289 13:43292971-43292993 TGATGGAGGCAGCTGTGGCAAGG - Intronic
1111182324 13:84685549-84685571 TGGTGGTCCCAGGTGTTCCTAGG - Intergenic
1111547004 13:89751719-89751741 TGATTCAGCCTGGTGTTCCCAGG + Intergenic
1112713742 13:102160071-102160093 AGATGGAGGAAGGTGTGCCAGGG - Intronic
1116734460 14:48671243-48671265 TGGTGGATCCAGGTGCTCCTGGG - Intergenic
1116958556 14:50947182-50947204 TGATGGAACCAGGTGATTTAGGG + Intergenic
1118070006 14:62235941-62235963 TGCTGGAGCAAGTTGTTTCAAGG - Intergenic
1118106606 14:62666896-62666918 TGATTGAGACATGTGGTCCAAGG + Intergenic
1121341029 14:93105237-93105259 TGCTGGAGCCAGAGGTTCCCAGG - Intronic
1121882349 14:97512186-97512208 TGATGAAGGCATGTGTTCCAGGG + Intergenic
1123772809 15:23546114-23546136 TGCTGGAGCAAGGTTCTCCAGGG - Intergenic
1124820444 15:33040052-33040074 GGATGGTGCCACGTCTTCCATGG - Intronic
1127599654 15:60522684-60522706 TGTTGGAGCCAGGAGTTTGAGGG + Intronic
1131176052 15:90210498-90210520 TGCTGCAGCCAGGTGGCCCAGGG + Intronic
1131394053 15:92072679-92072701 TGATAGATCCAGGCGTTCCTTGG + Intronic
1133248898 16:4467171-4467193 TCATGGCTCCAGGTGTTCCTGGG - Intronic
1133334458 16:4997794-4997816 TGGTGGACCCAGGTGTTCCTTGG + Intronic
1135815801 16:25632321-25632343 TGAGGTAGCCAGGTGATACAGGG + Intergenic
1136141944 16:28293544-28293566 TGGTGGAGCCCGTTGTGCCATGG + Intronic
1136428153 16:30183064-30183086 CGATGAAGCCAGGAGATCCAGGG + Intronic
1138204799 16:55116739-55116761 TGATGTTGCCAGGGGTTGCATGG - Intergenic
1139846854 16:69927476-69927498 AGGTCGAGCCAGGTGTTCCTGGG + Intronic
1140226178 16:73079185-73079207 TGATGGAGGCAGGTGTGCCGTGG - Intergenic
1140395126 16:74619860-74619882 TCATGGAGCCTGGTGCTCTAAGG - Intergenic
1141762158 16:86035774-86035796 TGGTGGCTCCAGGTGTTCCTTGG - Intergenic
1142246667 16:88973344-88973366 TGCTGGTCCCAGGTGTTCCTGGG - Intronic
1143126220 17:4642385-4642407 TGCTGGAGCCATGTGTTCCCCGG + Intergenic
1143400813 17:6640772-6640794 TTAAGGATCCAGGTGTTGCAAGG + Exonic
1145268992 17:21394347-21394369 TGATGGAGCCTGTTGCTCCTAGG - Intronic
1145959476 17:28879118-28879140 TGATGGAGCCAGGTGTTCCAGGG + Intergenic
1146901706 17:36593043-36593065 TGATGGAGCCAGGTGACCTTGGG - Intronic
1148819227 17:50350913-50350935 GGTTGGAGCCAGGAGTGCCAGGG + Intronic
1149189072 17:54036786-54036808 TGGTGGCGCCAGGTGTTGCTTGG + Intergenic
1149638959 17:58191038-58191060 TCAGGGAGCCAGGTGCTCCCCGG - Intergenic
1150413477 17:64966943-64966965 TGATGGAGCATGGTGTTTTATGG - Intergenic
1150798343 17:68258291-68258313 TGATGGAGCATGGTGTTTTATGG + Intergenic
1151664937 17:75540410-75540432 TGATGGAGCCAGGAGGACCAAGG - Intronic
1151953751 17:77370295-77370317 TGGTGGCCCCAGGTGTTCCTTGG + Intronic
1152083092 17:78200648-78200670 TGGTGGCTCCAGGCGTTCCAAGG - Intronic
1152299096 17:79485041-79485063 GGATGGAGGCAGGTGGTCCAGGG + Intronic
1152862702 17:82705128-82705150 TGACGGAGCCACTTCTTCCAGGG - Intergenic
1154339648 18:13492537-13492559 TGATGAGGCCAGGCGTTCTACGG - Intronic
1156112543 18:33745394-33745416 TGGTGGAGCCAGATGTTAAAGGG + Exonic
1156346292 18:36259936-36259958 TGATGAAGTTAGGTGTTACATGG + Intronic
1156392456 18:36663667-36663689 TGGTGGAGATAGGTGTTCAAGGG - Intronic
1156632256 18:38984301-38984323 TGAAGGAGGCATGTCTTCCATGG - Intergenic
1160106551 18:75983416-75983438 TGGTGGACCCAGGTGTTCCTTGG - Intergenic
1160151232 18:76395847-76395869 TGCAGGAGCCAAGTGTTTCAGGG + Intronic
1160996370 19:1883943-1883965 TGAGGGAGCCAGGAGTGGCAGGG - Intronic
1161385153 19:3987722-3987744 GGATGGAGCCAGGTGTTGGCAGG + Intergenic
1161597369 19:5157454-5157476 TGGTGGCCCCAGGTGTTCCTGGG + Intergenic
1163136508 19:15315342-15315364 TGAGTGAGGCAGGTGTTTCAGGG - Intronic
1164840794 19:31390690-31390712 TGGTGGCTCCAGGTGTTCCTGGG + Intergenic
1165108050 19:33486147-33486169 TTCAGGAGCCAAGTGTTCCAGGG + Intronic
1166129865 19:40739733-40739755 TGATGGGGCCAGGTGCTACCTGG - Exonic
1167582951 19:50357294-50357316 AGAAAGAGCCTGGTGTTCCAGGG - Intronic
1167584909 19:50368815-50368837 GGAGAGAGCCTGGTGTTCCAGGG - Intronic
1168721406 19:58556780-58556802 TCCTGGAGCCAGGTGGGCCAGGG - Exonic
925699326 2:6617730-6617752 AGATGGTGCCTGGTGTTCGAAGG - Intergenic
926149504 2:10416867-10416889 TGATGGAGGCAGGGGGTGCAGGG + Intronic
926874400 2:17458583-17458605 TGATGGCTCCAGGTGTTCCTTGG - Intergenic
926957667 2:18319312-18319334 TGATGGAGCCCAGGGTTCCATGG + Intronic
929322847 2:40566309-40566331 TGCTAGAGCCAGTTGTGCCATGG + Intronic
931756078 2:65375818-65375840 AGATGGAGAAAGGAGTTCCACGG + Intronic
932297911 2:70642130-70642152 GGCTGGAACCAGGAGTTCCATGG + Intronic
932309104 2:70725638-70725660 TGATGGCTCCTGGTGTTCCTTGG - Intronic
932876646 2:75459300-75459322 TGCTGGATCCAGCTGTTCCAGGG + Intergenic
934054322 2:88239387-88239409 TGATGGCCCCAGGAGTTCCTTGG + Intergenic
934178100 2:89595268-89595290 TGGTGCAACCAGGTGATCCAAGG - Intergenic
934288400 2:91669559-91669581 TGGTGCAACCAGGTGATCCAAGG - Intergenic
935195142 2:100809311-100809333 TGGAGAAGCCAGGGGTTCCAGGG + Intergenic
935362617 2:102260154-102260176 TGATGGAGCCCGGGGTATCAAGG + Intergenic
935684466 2:105671328-105671350 TGATGGAGGCTTGTGTTCCCTGG + Intergenic
937215966 2:120313841-120313863 CGATGGAGCCCGGTGCTCCTCGG - Intergenic
938967840 2:136404345-136404367 AGATGGAGACAGCTGGTCCATGG - Intergenic
939191567 2:138922353-138922375 TCATAGAGAAAGGTGTTCCAAGG - Intergenic
942406249 2:175659688-175659710 TGGTGGCTCCAGGTGTTCCATGG - Intergenic
947223135 2:227813740-227813762 TGATGGGGCCAGTTGATCAATGG + Intergenic
1169081111 20:2798243-2798265 TGATGGAGCCTGGTGTGCTGAGG - Exonic
1170804991 20:19621802-19621824 TGGTGGAGCCAGGGGTTCCAGGG - Intronic
1171939320 20:31309600-31309622 TGATGGAAAAAGATGTTCCATGG - Intergenic
1173610549 20:44364155-44364177 TGATGGAGCCAGAGGTTGAAGGG - Intronic
1174200572 20:48803833-48803855 AGTTGGATCCAGGTGTTCCCTGG - Intronic
1174919496 20:54686573-54686595 TCATGGAGCCAGGCCTTACATGG - Intergenic
1175552657 20:59827267-59827289 TCCTGGAGCCGGGTGTTCCAAGG - Intronic
1175666027 20:60860807-60860829 TGAGGATGCAAGGTGTTCCATGG - Intergenic
1177243912 21:18497726-18497748 TGATGGCTCCAGATGTTCCTGGG - Intergenic
1177315718 21:19458534-19458556 TCATGGAACAAGGTGTTCAAAGG - Intergenic
1178752676 21:35319441-35319463 AGAAGGAGCCAGGTATTCAAAGG + Intronic
1179593841 21:42429142-42429164 TGGTGGCCCCAGGTGTTCCTTGG - Intronic
1179821754 21:43941074-43941096 TGATGGTACCAGGTGGTGCAGGG + Intronic
1180066125 21:45413386-45413408 TGGAGGAGACAGGTGTTCCCTGG - Intronic
1181878357 22:25957709-25957731 TGATGGCTCCAGGTGCTCCTTGG + Intronic
1182872849 22:33663912-33663934 TTATTGAGCCAGGTGTTGGAGGG - Intronic
1183869368 22:40729523-40729545 TGGTGGCGCCAGGTGTCCCTTGG + Intergenic
1184497190 22:44848799-44848821 TGCTGGAGCCATGTGTCCTAGGG - Intronic
1184536497 22:45091290-45091312 TGAGGGAACCAGGTGGTTCAGGG - Intergenic
1185089964 22:48760837-48760859 GGTTGGCGCCAAGTGTTCCATGG + Intronic
950481365 3:13246325-13246347 AAATGGAGTCAGGGGTTCCAGGG + Intergenic
954791365 3:53135785-53135807 TGAAGGAGGCAGCTTTTCCAAGG - Intergenic
954981072 3:54745709-54745731 TGAAGGAGACAGGTGTTTCTTGG - Intronic
956619520 3:71207070-71207092 TGATGGGGCCAGGTGTTCTGGGG + Intronic
960272200 3:115687579-115687601 TGCTGGAGCCTGGAGTTCCATGG + Intronic
961680779 3:128598629-128598651 TGATGGAGACATGGGTACCAAGG - Intergenic
962982836 3:140506425-140506447 TGAAGGACCCTGGGGTTCCAGGG - Intronic
964323502 3:155522924-155522946 TCATTTAGCCAGGTGATCCAAGG - Intronic
965434121 3:168625999-168626021 TGCTGGACCCAGGTTATCCAAGG - Intergenic
968860025 4:3160467-3160489 GGATGGAGCCTGGTTCTCCAGGG + Intronic
969119699 4:4899045-4899067 TGGTGGCTCTAGGTGTTCCATGG + Intergenic
969449615 4:7265572-7265594 TGATGGCTCCAGATGTTCCCAGG + Intronic
969831151 4:9798125-9798147 TGGTGCAACCAGGTGATCCAAGG + Intronic
970439257 4:16066018-16066040 TGATGGCTCCAGATGTTCCTTGG - Intronic
974366699 4:60959323-60959345 TGATGGAGCCAGTGGTGCAATGG + Intergenic
978322278 4:107510777-107510799 TGATAGCCCCAGGTGTTCCTTGG - Intergenic
978415889 4:108475581-108475603 TGATGGAGGCATCTGTTGCAGGG + Intergenic
980103857 4:128568068-128568090 TGGTGGGTCCAGGTGTTCCTTGG + Intergenic
980974563 4:139598496-139598518 TGGTGGATCCAGGCGTTCCTTGG - Intronic
982693960 4:158579127-158579149 TGATGGCTCCTGGTGTTCCTTGG - Intronic
982952383 4:161716098-161716120 TGATGGAGACCCGTGTACCAAGG - Intronic
984786434 4:183571685-183571707 GGAGGAACCCAGGTGTTCCAAGG - Intergenic
985907817 5:2854776-2854798 AGCTGGAGCCAGGTGTTCTCAGG - Intergenic
986649654 5:9950372-9950394 TGGTGGCTCCAGGTGTTCCTTGG - Intergenic
990742604 5:58927598-58927620 TGAAGGTGCAAGGTTTTCCAAGG - Intergenic
998000238 5:138619257-138619279 TGGTGGAGGCAATTGTTCCAGGG + Intronic
1000024427 5:157346527-157346549 TGATGGCTCCCGGTGTTCCTTGG - Intronic
1001038760 5:168316793-168316815 TGAGGGAGTCAGGTATTACAAGG + Intronic
1001425903 5:171622207-171622229 GGCTGGAGCCGGGTGTTCCTGGG - Intergenic
1002645343 5:180649838-180649860 TGATGGAGCCTGGTGGGCAAAGG + Intergenic
1002819493 6:711328-711350 GGAGGAAGCCAGGTCTTCCAGGG + Intergenic
1006439948 6:34047704-34047726 TGATGCATCCAGGTGTTTCGAGG + Intronic
1009747356 6:67834521-67834543 TCATGGAGCTAGGTCTCCCAAGG + Intergenic
1013287867 6:108696425-108696447 TTTTGGGGCCTGGTGTTCCAAGG - Intergenic
1015798101 6:137033193-137033215 TGGTGGCCCCAGGTGTTCCTTGG + Intronic
1016864158 6:148748566-148748588 TGCGGGAGCCAGGGGTGCCAGGG + Intronic
1018424127 6:163664526-163664548 TGATGGAGACAGCACTTCCAGGG + Intergenic
1018859702 6:167702417-167702439 TGGTGGAGCCTGTTGCTCCAGGG + Intergenic
1019321702 7:419000-419022 GGATGGAGCCAAGGGTTCCCTGG - Intergenic
1021874985 7:25040358-25040380 TGATGGAACCAGGTCTGGCATGG + Intergenic
1022908906 7:34881347-34881369 TGATAGCCCCAGGTGTTCCTTGG + Intergenic
1023892174 7:44400717-44400739 TGGTGGCTCCAGGTGTTCCTGGG + Intronic
1023997421 7:45169624-45169646 TGGTGGCCCCAGGTGTTCCTTGG + Intronic
1024757549 7:52553222-52553244 TTCTGGAGCCTGCTGTTCCAAGG + Intergenic
1029327986 7:99826143-99826165 TGAAGGAGCCAGGGGCTCAATGG + Intergenic
1030116108 7:106063467-106063489 TGATGCAGCCAGGTTTTCTCAGG - Intergenic
1030161254 7:106510546-106510568 GGCTGGAGCGAGGAGTTCCATGG - Intergenic
1031053854 7:116972785-116972807 TGAGGGAGAAAGGTGTTCCCAGG - Intronic
1032337014 7:131034683-131034705 TCATGGTGCCACGTGTTCCCTGG - Intergenic
1035055869 7:156035825-156035847 TGATGGAGGCGGGTGCACCATGG - Intergenic
1036219592 8:6910321-6910343 TGCTGGAGCCAGATGTCCCCTGG + Intergenic
1037403276 8:18515310-18515332 TCATGGGGCCAGGGGCTCCAGGG + Intergenic
1037579323 8:20235410-20235432 TGGTGGCCCCAGGTGTTCCTTGG - Intergenic
1038118600 8:24586098-24586120 TGATGGAACCAGGTGAGGCATGG - Intergenic
1041703474 8:60818169-60818191 TCATGGCTTCAGGTGTTCCATGG + Intronic
1042488002 8:69367887-69367909 CTATGGAGCAATGTGTTCCAAGG + Intergenic
1045750555 8:105478796-105478818 TGAAGAAGCCATGTCTTCCAAGG - Intronic
1047876256 8:129141069-129141091 TGGTGGCTCCAGGTGTTCCTTGG + Intergenic
1047921896 8:129643923-129643945 TGATCTAGCCAGGTTCTCCAAGG - Intergenic
1049265902 8:141667787-141667809 AGAAGGAGCCACGTGTGCCAGGG + Intergenic
1049363619 8:142225930-142225952 TGGTGGTGCCAGGTGTTTCTAGG + Intronic
1049777135 8:144411821-144411843 TGGTGGCCCCAGGTGTTCCTTGG - Intronic
1050163960 9:2745254-2745276 AGATGCAGCCAGGTTCTCCAGGG - Intronic
1051679258 9:19590668-19590690 GTAAGGAGCCAGGTGTTGCAGGG - Intronic
1052496481 9:29232043-29232065 TGAGGGAGCGAGGTGCTCTAAGG - Intergenic
1054796688 9:69308803-69308825 TGGTGGTGCTAGGTGTTCCTCGG - Intergenic
1055764153 9:79643710-79643732 TGGTGAAGCTAGGTGATCCATGG + Intronic
1057163990 9:92912416-92912438 GGCTGGAGCCATGTGTTCCCTGG - Intergenic
1057459807 9:95250974-95250996 TGCTGGAGCCATGTTTTGCAGGG - Intronic
1057667568 9:97057831-97057853 TGCAGGAGCCTGGGGTTCCACGG - Intergenic
1058908770 9:109501814-109501836 TGATGGAACCACCTGGTCCATGG + Intergenic
1059107450 9:111524028-111524050 TGAAGGAGCAAGGTGATTCAAGG - Intergenic
1060652624 9:125342310-125342332 TGAAGGAGCCAGGAAGTCCATGG - Intronic
1061393958 9:130333181-130333203 GGAAGGAGCCAGGTGTGCCCAGG - Intronic
1061714831 9:132512184-132512206 TGGTGGCCCCAGGTGTTCCTTGG + Intronic
1062130410 9:134889708-134889730 TGAAGGAGCCAAGTCTTTCAGGG - Intergenic
1189286179 X:39854052-39854074 TGAAAGAGCCAGGTGGCCCATGG + Intergenic
1190931432 X:54951988-54952010 AGATGGAGCGAGGTGTGACATGG + Exonic
1191612072 X:63127714-63127736 TGGTGGAGCCAGGTATTTCTTGG - Intergenic
1192658046 X:73013002-73013024 TTATGGAGTCAGGTGATCAATGG - Intergenic
1195381840 X:104278408-104278430 TGGTGGCTCCAGGTGTTCCTTGG + Intergenic
1200085578 X:153602897-153602919 TGATGGAGACAGGGGTGACAAGG + Intergenic