ID: 1145959477

View in Genome Browser
Species Human (GRCh38)
Location 17:28879122-28879144
Sequence GGAGCCAGGTGTTCCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1466
Summary {0: 1, 1: 0, 2: 5, 3: 137, 4: 1323}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145959466_1145959477 9 Left 1145959466 17:28879090-28879112 CCTGCTAGTCCCCTCCACCTTCT No data
Right 1145959477 17:28879122-28879144 GGAGCCAGGTGTTCCAGGGCTGG 0: 1
1: 0
2: 5
3: 137
4: 1323
1145959468_1145959477 -1 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959477 17:28879122-28879144 GGAGCCAGGTGTTCCAGGGCTGG 0: 1
1: 0
2: 5
3: 137
4: 1323
1145959472_1145959477 -8 Left 1145959472 17:28879107-28879129 CCTTCTGCCTGTGATGGAGCCAG No data
Right 1145959477 17:28879122-28879144 GGAGCCAGGTGTTCCAGGGCTGG 0: 1
1: 0
2: 5
3: 137
4: 1323
1145959465_1145959477 10 Left 1145959465 17:28879089-28879111 CCCTGCTAGTCCCCTCCACCTTC No data
Right 1145959477 17:28879122-28879144 GGAGCCAGGTGTTCCAGGGCTGG 0: 1
1: 0
2: 5
3: 137
4: 1323
1145959469_1145959477 -2 Left 1145959469 17:28879101-28879123 CCTCCACCTTCTGCCTGTGATGG No data
Right 1145959477 17:28879122-28879144 GGAGCCAGGTGTTCCAGGGCTGG 0: 1
1: 0
2: 5
3: 137
4: 1323
1145959471_1145959477 -5 Left 1145959471 17:28879104-28879126 CCACCTTCTGCCTGTGATGGAGC No data
Right 1145959477 17:28879122-28879144 GGAGCCAGGTGTTCCAGGGCTGG 0: 1
1: 0
2: 5
3: 137
4: 1323
1145959467_1145959477 0 Left 1145959467 17:28879099-28879121 CCCCTCCACCTTCTGCCTGTGAT No data
Right 1145959477 17:28879122-28879144 GGAGCCAGGTGTTCCAGGGCTGG 0: 1
1: 0
2: 5
3: 137
4: 1323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145959477 Original CRISPR GGAGCCAGGTGTTCCAGGGC TGG Intergenic
900164549 1:1239531-1239553 GGAGCCAGGGGAGGCAGGGCTGG - Intergenic
900243828 1:1628829-1628851 GGAGCCAGGCGTTCTGGGGGTGG + Intronic
900252172 1:1676656-1676678 GGAACCAGCTCTTCCAGTGCTGG + Exonic
900262582 1:1739514-1739536 GGAACCAGCTCTTCCAGTGCTGG + Exonic
900366244 1:2313042-2313064 GGGGCCACCTGCTCCAGGGCTGG - Intergenic
900394175 1:2446384-2446406 GTAGCCAGGTCTCCCGGGGCTGG + Intronic
900814776 1:4835160-4835182 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
900893911 1:5469720-5469742 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
901281126 1:8035955-8035977 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
901631242 1:10649219-10649241 AGAGCCTGGGGCTCCAGGGCGGG + Intronic
901829087 1:11881249-11881271 TGAGCCAGATGTTGCAGAGCTGG + Intergenic
901833870 1:11911042-11911064 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
902209623 1:14895243-14895265 AGAGCCAGGGGAACCAGGGCTGG - Intronic
902606263 1:17571052-17571074 AGAGCCTGGAGTTCAAGGGCAGG + Intronic
903218079 1:21854166-21854188 GGAGCCAGGTGTGGCTGGGCCGG - Intronic
903315088 1:22497037-22497059 GGAGCCTGATGTTCGAGGGCAGG + Intronic
903329539 1:22590210-22590232 AGAGACAGGTGGGCCAGGGCTGG - Intronic
904328340 1:29741966-29741988 GCATCCAGGTCCTCCAGGGCTGG - Intergenic
904335476 1:29794451-29794473 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
904578101 1:31518732-31518754 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
905262281 1:36728342-36728364 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
905345138 1:37306137-37306159 GGAGCCAGGAGACCAAGGGCCGG + Intergenic
905464782 1:38144646-38144668 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
905764986 1:40592900-40592922 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
905789361 1:40782328-40782350 AGAGCCGGGTGCCCCAGGGCAGG - Intergenic
906059034 1:42936459-42936481 GGAGCCAGATGTTCCAGGTGGGG + Intronic
906106883 1:43300009-43300031 GGAGCAACGGGTGCCAGGGCAGG + Intergenic
906144739 1:43553181-43553203 GAACCCAGGTGTTCCAAGTCTGG - Intronic
906206709 1:43991086-43991108 GGAGGCAGGAGCCCCAGGGCCGG + Exonic
906747204 1:48230505-48230527 GGTGCCTGGTGTTGCTGGGCAGG + Intronic
906885139 1:49637081-49637103 GGAGTCCAGTGTTCAAGGGCAGG - Intronic
906930585 1:50165954-50165976 GGAGTCCGATGTTCAAGGGCAGG + Intronic
906930976 1:50169110-50169132 GGAGTCCGATGTTCAAGGGCAGG + Intronic
907618692 1:55953044-55953066 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
907767604 1:57425470-57425492 GGAGCCAGTAGGTCCAGGGCTGG + Intronic
908395627 1:63722923-63722945 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
908397401 1:63739037-63739059 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
908618362 1:65948434-65948456 GGAGTCTGATGTTCAAGGGCAGG + Intronic
908947606 1:69518434-69518456 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
909046159 1:70712508-70712530 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
909190127 1:72540374-72540396 GGAGTCTGATGTTTCAGGGCAGG + Intergenic
909209478 1:72805836-72805858 GGAGTCTGATGTTCTAGGGCAGG - Intergenic
909287881 1:73844085-73844107 CGAGTCAGATTTTCCAGGGCAGG + Intergenic
909549383 1:76880577-76880599 GGAGTCCAGTGTTCGAGGGCAGG + Intronic
910443966 1:87281979-87282001 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
910561413 1:88596084-88596106 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
910562227 1:88602579-88602601 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
910789895 1:91040120-91040142 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
911041507 1:93594533-93594555 GGAGGCTGGCGGTCCAGGGCTGG - Intronic
911233068 1:95380826-95380848 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
911255947 1:95633799-95633821 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
911263056 1:95710179-95710201 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
911343715 1:96671967-96671989 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
911471142 1:98319524-98319546 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
911686606 1:100784281-100784303 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
911842729 1:102704698-102704720 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
911883895 1:103273003-103273025 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
912067325 1:105759570-105759592 GGAGTCTGATGTTCCAGGACAGG - Intergenic
912251698 1:108018844-108018866 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
912522800 1:110257747-110257769 AGAGGCAGGTGTTCCAGGGCTGG + Intronic
912550237 1:110480685-110480707 GGAGCCAGGTGTCCTGTGGCTGG - Intergenic
912978475 1:114350361-114350383 GTAGGCAAGTGGTCCAGGGCTGG + Intergenic
913039070 1:115005456-115005478 GGAGTCAGATGTTTGAGGGCAGG + Intergenic
913549875 1:119907059-119907081 GGAGCCTGATGTTCAAGGGCAGG - Intergenic
913653387 1:120939299-120939321 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
914167715 1:145189734-145189756 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
914264161 1:146023370-146023392 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
914519075 1:148399423-148399445 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
914643570 1:149633462-149633484 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
914708358 1:150190079-150190101 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
914927001 1:151897447-151897469 GGAGTCCGATGTTCGAGGGCAGG - Intronic
915114104 1:153584321-153584343 GGAGGTTGGTGGTCCAGGGCTGG - Intergenic
915345711 1:155195847-155195869 GGAGGCAGCTGCTCCAGGGAAGG - Exonic
915396564 1:155589680-155589702 GGAGTCCAGTGTTCGAGGGCGGG + Intergenic
915412364 1:155711884-155711906 GGAGTCCAGTGTTCGAGGGCGGG + Intronic
915667336 1:157457040-157457062 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
915880254 1:159663206-159663228 GGAGCCCGATGTTCGAGGACAGG + Intergenic
916170991 1:162001538-162001560 GGAGGCAGGCAGTCCAGGGCTGG - Intronic
916206997 1:162324862-162324884 GAAGCCTGGGATTCCAGGGCTGG - Intronic
916527711 1:165627274-165627296 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
916919559 1:169449663-169449685 GGAGTCTGATGTTCGAGGGCAGG + Intronic
917217664 1:172694805-172694827 GGAGTCCGATGTTCTAGGGCAGG + Intergenic
917542344 1:175926560-175926582 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
917791119 1:178499558-178499580 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
917932155 1:179830091-179830113 GGAGTCAGGTGTTCAAAGACTGG + Intergenic
918547946 1:185707277-185707299 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
918714884 1:187773204-187773226 GGAGTCTGATGTTCCAGAGCAGG + Intergenic
918815414 1:189174193-189174215 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
918895456 1:190337556-190337578 GGAGTCTGATGTTCGAGGGCAGG - Intronic
918911814 1:190582635-190582657 GGAGTCCGTTGTTCCAGGGTAGG + Intergenic
919000807 1:191828711-191828733 GGAGTCCGAAGTTCCAGGGCAGG + Intergenic
919209304 1:194457757-194457779 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
919268372 1:195304313-195304335 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
919316859 1:195981766-195981788 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
920188640 1:204178426-204178448 AGAGCCAGGAGGTCCAGAGCAGG + Intergenic
921352090 1:214246316-214246338 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
921579155 1:216874886-216874908 GGAGTCTGATGTTCAAGGGCAGG - Intronic
921597377 1:217069244-217069266 GGAGTCAGATGTTCGAGGGCAGG - Intronic
921700663 1:218265328-218265350 GGAGTCTGATATTCCAGGGCAGG + Intergenic
921940044 1:220829771-220829793 GGAGTCTGTTGTTCGAGGGCAGG + Intergenic
921954886 1:220971967-220971989 GGATTCAGATGTTCGAGGGCAGG + Intergenic
922011291 1:221591004-221591026 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
922019055 1:221685427-221685449 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
922043275 1:221918109-221918131 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
922156903 1:223047674-223047696 GGAGGCTGATGTTCAAGGGCAGG + Intergenic
922170816 1:223153027-223153049 GGAGCCTGATGTCCAAGGGCAGG + Intergenic
922211536 1:223490367-223490389 GGAGCCAGGAGGCCAAGGGCTGG - Intergenic
922388071 1:225108180-225108202 GGAGTCTGATGTTCAAGGGCAGG - Intronic
922484804 1:225965379-225965401 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
922546245 1:226459433-226459455 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
922636906 1:227182891-227182913 GGAGTCTGATGTCCCAGGGCAGG - Intronic
922916801 1:229264468-229264490 GGAGGCTGATGTTCAAGGGCAGG - Intergenic
923768864 1:236919556-236919578 GGAGTCCAGTGTTCGAGGGCAGG - Intergenic
923864446 1:237924224-237924246 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
923907367 1:238400174-238400196 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
924514821 1:244757146-244757168 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
924692913 1:246368825-246368847 GGAGCCTGATGTTTGAGGGCAGG - Intronic
924693774 1:246378508-246378530 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1064018050 10:11787938-11787960 AGAGCCAGGTGCACCTGGGCAGG - Intergenic
1064177879 10:13091017-13091039 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1064179222 10:13100295-13100317 GGCGGCAGGTGAGCCAGGGCAGG + Exonic
1064220175 10:13433599-13433621 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1064325794 10:14350084-14350106 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1064402379 10:15032244-15032266 GGAGTCTGATGTTCAAGGGCGGG - Intronic
1064414732 10:15139121-15139143 GGAGCCTGATGTTCGAGGGCAGG - Intronic
1064423150 10:15207457-15207479 GGAGCCTGATGTTCGAGGGCAGG + Intergenic
1064469272 10:15618734-15618756 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1064517254 10:16165144-16165166 AGAGTCTGCTGTTCCAGGGCAGG + Intergenic
1064917508 10:20476816-20476838 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1064990228 10:21250357-21250379 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1065501024 10:26382461-26382483 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1065724528 10:28656955-28656977 GGAGCAAGGGCTTCCAGGTCAGG + Intergenic
1066220965 10:33335898-33335920 GGTGGCAGGAGCTCCAGGGCCGG - Intronic
1067017619 10:42769831-42769853 GGAGCCAGCAGTTGCAGAGCAGG - Intergenic
1067051446 10:43023750-43023772 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1067065563 10:43102255-43102277 GGAGGCAGGAGCTCCAGGGCTGG - Intronic
1067686174 10:48466974-48466996 GGAAGCAGGTGTTCCAGGTGAGG + Intronic
1067853376 10:49769243-49769265 GGCATCAGGTGCTCCAGGGCAGG + Intergenic
1067989013 10:51188655-51188677 GGAGCCTGGTGTTCCTGGTTGGG + Intronic
1068425697 10:56860737-56860759 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1068557437 10:58474735-58474757 GGAGTCCAGTGTTCCAGGGAAGG - Intergenic
1068569089 10:58608353-58608375 GGAGCCAGATGGTACAGGCCAGG - Intronic
1068648885 10:59499789-59499811 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1068980324 10:63056110-63056132 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1069108330 10:64410984-64411006 GGAGTCTGATGTTCAAGGGCGGG + Intergenic
1069163512 10:65119428-65119450 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1069342562 10:67428841-67428863 GGAGTCCGATGTTCAAGGGCAGG - Intronic
1069640734 10:69953977-69953999 GGAGCCGGGGTTACCAGGGCTGG + Intronic
1069662893 10:70135389-70135411 GGGCTCAGGTGTGCCAGGGCTGG + Intergenic
1071069683 10:81677204-81677226 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1071183179 10:83010407-83010429 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1071251934 10:83827499-83827521 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1071364139 10:84881901-84881923 GGAGTCCGATATTCCAGGGCAGG + Intergenic
1071374301 10:84986926-84986948 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1071382988 10:85088353-85088375 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1071670308 10:87602964-87602986 GGAGTCCAGTGTTCAAGGGCAGG - Intergenic
1072057266 10:91772368-91772390 GGAGCCTGATGTTTGAGGGCAGG - Intergenic
1072116241 10:92372947-92372969 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
1072290795 10:93962651-93962673 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1072619144 10:97068250-97068272 GGAGCCTGGGGTTCGAGGCCTGG + Intronic
1073556897 10:104462447-104462469 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1073918157 10:108429803-108429825 GGAGCCTGATGTTCAAGGGTAGG + Intergenic
1074491442 10:113942947-113942969 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
1074666384 10:115730924-115730946 GGAGTCCAGTGTTCGAGGGCAGG + Intronic
1074854288 10:117462029-117462051 GGAGCCAGCTCTGCCAGGGGCGG - Intergenic
1074878055 10:117629903-117629925 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1074982512 10:118631116-118631138 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1075223308 10:120602826-120602848 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1075607142 10:123820055-123820077 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1075674463 10:124286801-124286823 GGATCCAGGTGTTCCAGTGATGG + Intergenic
1075814461 10:125254147-125254169 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1075872171 10:125778922-125778944 GGAGTCCGATGTTCCAGGGCAGG + Intergenic
1076061663 10:127418276-127418298 GGAGCCACGTGCTCTGGGGCAGG - Intronic
1076302025 10:129435747-129435769 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1076718495 10:132381253-132381275 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1076927845 10:133502669-133502691 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1076992569 11:283136-283158 GGAGGAAGGTGTTCAAGCGCAGG + Intronic
1077056788 11:597776-597798 GGAGCCAGGTATTGAGGGGCAGG + Intronic
1077499100 11:2901286-2901308 AGAGCCAGGTGGCCCAAGGCCGG - Intronic
1077522594 11:3045174-3045196 GGAGGCTGGTGATCCAGGGAAGG + Intronic
1077533537 11:3108200-3108222 GGGGACAGGTGTGCCAGGGGAGG + Intronic
1077906707 11:6539859-6539881 AGACCCAGCTGTTCCAGGTCTGG + Exonic
1077957896 11:7040476-7040498 GGAGGCAGGGGTGGCAGGGCAGG - Intronic
1078268321 11:9771653-9771675 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1078696956 11:13643971-13643993 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1078777657 11:14408577-14408599 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1078883282 11:15474689-15474711 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1078925201 11:15868572-15868594 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1079182807 11:18208806-18208828 GGAGCCTGATGTTCGAGGGCAGG - Intronic
1079446982 11:20566503-20566525 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1079447895 11:20572943-20572965 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1079473498 11:20803939-20803961 GGAGTCCGATGTTCGAGGGCAGG - Intronic
1079623806 11:22590961-22590983 GGAGTCTGATGTTCTAGGGCAGG + Intergenic
1079739368 11:24037619-24037641 GGAGTCCGATGTTCCAGGGCAGG - Intergenic
1079871312 11:25801589-25801611 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1079913697 11:26341833-26341855 GGAGTCTGATGTTCCAGGACAGG + Intronic
1079990911 11:27246022-27246044 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1080061226 11:27958919-27958941 GGAGACAGGTGTTCCATTCCTGG - Intergenic
1080186330 11:29491479-29491501 GGAGTTTGGTGTTCGAGGGCAGG - Intergenic
1081110859 11:39131349-39131371 GAGTCCAGATGTTCCAGGGCAGG - Intergenic
1081589927 11:44415110-44415132 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1081757460 11:45554710-45554732 GGAGCCACGTGCTGGAGGGCTGG - Intergenic
1082213853 11:49542567-49542589 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1082649873 11:55776601-55776623 GGAATCTGATGTTCCAGGGCAGG - Intergenic
1082804231 11:57437305-57437327 GGAGACAGCAGTTCCAGGCCTGG - Intergenic
1082807044 11:57458266-57458288 GGAGCCAGGGATTCCCGGACGGG + Intergenic
1082919680 11:58479561-58479583 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1083083589 11:60119193-60119215 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1083914887 11:65735429-65735451 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1084022202 11:66424466-66424488 GGAGTCAGCTGTTCATGGGCAGG - Exonic
1084581619 11:70027712-70027734 GTGGCCACGTGTGCCAGGGCAGG + Intergenic
1086053787 11:82624762-82624784 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1086054899 11:82635115-82635137 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1086148121 11:83577175-83577197 GGAGTCCGATGTTCGAGGGCAGG - Intronic
1086868304 11:92006825-92006847 GGAGTCCGATGTTCCAGGGTAGG - Intergenic
1086961988 11:92987361-92987383 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1087286594 11:96271015-96271037 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1087951020 11:104220395-104220417 GGAGTCTGATGTCCCAGGGCAGG - Intergenic
1087957688 11:104309110-104309132 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1088097539 11:106117777-106117799 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1088212632 11:107473465-107473487 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1088264704 11:107978089-107978111 GGAGTCAAATGTTCGAGGGCAGG - Intergenic
1088407278 11:109496042-109496064 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
1088542348 11:110926228-110926250 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1088730503 11:112677498-112677520 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1088810405 11:113387982-113388004 TCAGCCAGGTGTTCCAGGCGCGG + Exonic
1088977723 11:114830618-114830640 GTAGCCAGTCGTTCCATGGCAGG + Intergenic
1089200425 11:116721424-116721446 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
1089347943 11:117803617-117803639 GGATTCAGGTTTTGCAGGGCTGG - Intronic
1089835224 11:121364625-121364647 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1089903187 11:122010118-122010140 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1089981604 11:122777227-122777249 GGAGCCAGGCTTCCCAGGGGTGG - Intronic
1090209149 11:124905445-124905467 GGAGTCTGATGTTCTAGGGCAGG + Intergenic
1090577581 11:128124037-128124059 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1090730035 11:129564512-129564534 AGAGTCAGATGTTCAAGGGCAGG + Intergenic
1091859252 12:3764748-3764770 AGAGTCCGCTGTTCCAGGGCAGG + Intronic
1092924103 12:13258242-13258264 GGAGGCAGTTGCTCCAGGGCAGG + Intergenic
1093050142 12:14495026-14495048 GGAGGCCAATGTTCCAGGGCAGG + Intronic
1093663528 12:21785235-21785257 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
1093776704 12:23083963-23083985 GGAGTCTGATGTTCCAGGACAGG + Intergenic
1093964874 12:25313565-25313587 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1094062106 12:26325417-26325439 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1094271749 12:28624828-28624850 GGAGACAGCAGTTTCAGGGCAGG + Intergenic
1094346376 12:29473938-29473960 GGAGTCCAGTGTTCTAGGGCAGG - Intronic
1094371304 12:29740463-29740485 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1094487723 12:30938320-30938342 TGAGGCAGGTGTCCAAGGGCTGG - Intronic
1094604352 12:31937789-31937811 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1094679133 12:32652116-32652138 GGAGTCTGTTGTTCAAGGGCAGG - Intergenic
1095164261 12:38953250-38953272 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1095855921 12:46861066-46861088 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
1096457997 12:51803240-51803262 GGAGTCTGATGTTCCAGGGCAGG + Intronic
1096919443 12:55068302-55068324 GAATGCTGGTGTTCCAGGGCTGG + Intergenic
1096922883 12:55107828-55107850 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1097058626 12:56266357-56266379 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1097431932 12:59519728-59519750 GGAGCCCAATGTTCAAGGGCAGG + Intergenic
1097628551 12:62031353-62031375 GGAGTCTTATGTTCCAGGGCAGG - Intronic
1097821003 12:64129290-64129312 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1097843808 12:64346240-64346262 GGAGCCCGACGTTCGAGGGCAGG + Intronic
1098078178 12:66755963-66755985 GGAAGCAGTGGTTCCAGGGCTGG - Intronic
1098175156 12:67782351-67782373 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1098215137 12:68208291-68208313 GAAGCAAGGTGTTCAAAGGCTGG + Intronic
1098787734 12:74781108-74781130 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1098995482 12:77114590-77114612 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1099242642 12:80156273-80156295 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1099282238 12:80665196-80665218 GGAGTCCGATGTTCTAGGGCAGG + Intronic
1099399982 12:82192336-82192358 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1099423921 12:82499829-82499851 GGAGTCTGATTTTCCAGGGCGGG - Intergenic
1099490364 12:83281630-83281652 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
1099542374 12:83928292-83928314 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1099577665 12:84402062-84402084 GGAGTCAGAAGTTCAAGGGCAGG - Intergenic
1099583457 12:84483934-84483956 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1100148164 12:91702503-91702525 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1100203774 12:92326475-92326497 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1100438994 12:94598227-94598249 GGAGCCAGGTGCACTTGGGCTGG - Intronic
1100899850 12:99225675-99225697 GGAGTCTGTTGTTTCAGGGCAGG - Intronic
1101304388 12:103513141-103513163 TGAGGCAGGTGTTCCGGAGCTGG + Intergenic
1101695693 12:107123871-107123893 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1102340407 12:112117074-112117096 GGAGTTAGGTCTTCCAAGGCGGG - Intergenic
1102669910 12:114609376-114609398 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
1102740072 12:115199248-115199270 GGAGCCCTGGATTCCAGGGCTGG + Intergenic
1102763487 12:115410278-115410300 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
1102790167 12:115638093-115638115 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1102860449 12:116331556-116331578 GGAGTCCGATGTTCCAGGGCAGG + Intergenic
1103395935 12:120607254-120607276 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1103396874 12:120614068-120614090 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1103761284 12:123251965-123251987 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1103992710 12:124809933-124809955 GCAGCCAGGTGGTGCTGGGCTGG - Intronic
1104086133 12:125475619-125475641 GGAGTCCGATGTTCAAGGGCAGG - Intronic
1104261045 12:127182293-127182315 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1104269253 12:127267558-127267580 GAAGCCAGGTGTTTCAAGGAAGG + Intergenic
1104291460 12:127473075-127473097 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1104370199 12:128217599-128217621 GGAGTCCCATGTTCCAGGGCAGG + Intergenic
1104531870 12:129579590-129579612 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1104810579 12:131617855-131617877 GCAGGCACGTGTTCCAGGACAGG + Intergenic
1104985375 12:132593639-132593661 GCAGCCAGGGGTCCCAGAGCAGG + Intergenic
1105042320 12:132970181-132970203 GGAGTCCAGTGTTCGAGGGCAGG - Intergenic
1105421748 13:20258565-20258587 GGAGCCAGGTGACCCAGAACAGG + Intergenic
1105434131 13:20362654-20362676 GGAACAAGGTGCTGCAGGGCGGG + Intergenic
1105515316 13:21084462-21084484 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
1105578900 13:21675524-21675546 AGCGCCAGGTGTGCCAGAGCCGG - Intronic
1105632253 13:22181971-22181993 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1105676556 13:22678404-22678426 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1106051534 13:26194761-26194783 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1106169569 13:27277468-27277490 GGAGTCTGATGTTCTAGGGCAGG + Intergenic
1106365878 13:29080540-29080562 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1106760832 13:32865959-32865981 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1106792406 13:33168966-33168988 AGAGGCAGGCGTTCCGGGGCAGG - Intronic
1106899758 13:34342782-34342804 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1106931437 13:34670012-34670034 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1107411561 13:40162905-40162927 GGAGTCCGATGTTCCAGGGCAGG - Intergenic
1108117603 13:47146586-47146608 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1108466477 13:50721177-50721199 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1108606428 13:52044152-52044174 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1108876021 13:55052058-55052080 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1109171068 13:59097577-59097599 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1109241830 13:59899039-59899061 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1109462895 13:62687040-62687062 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1109609900 13:64751087-64751109 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1109712365 13:66178247-66178269 GGAGTCTGGTGTTCGAGAGCAGG + Intergenic
1109797484 13:67335660-67335682 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1109797691 13:67338140-67338162 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1109927077 13:69157882-69157904 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1109950657 13:69499294-69499316 GGAGCCCGATGTTCAAGGACAGG + Intergenic
1110084712 13:71363896-71363918 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1110322700 13:74178032-74178054 GGAGTCAGGTGGTCCGTGGCTGG + Intergenic
1110363069 13:74649971-74649993 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1110409526 13:75188935-75188957 GGAGTCCGATGTTCCAGGACAGG + Intergenic
1110409743 13:75191236-75191258 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1110668757 13:78150655-78150677 GGAGTCAGCTGTTCAAGGGCAGG - Intergenic
1110742538 13:79014763-79014785 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1110825556 13:79967607-79967629 GGAGTCAGATGTTCAAGGGCAGG - Intergenic
1110935722 13:81285905-81285927 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
1111087791 13:83399321-83399343 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1111363287 13:87206397-87206419 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
1111373010 13:87341567-87341589 GGAGTCCGATGTTCCCGGGCAGG - Intergenic
1111535527 13:89597911-89597933 CGAGTCTGATGTTCCAGGGCAGG - Intergenic
1111741401 13:92209923-92209945 GGAGTCCAGTGTTCCAGGACAGG + Intronic
1111811662 13:93099130-93099152 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1111932022 13:94522363-94522385 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1111938443 13:94582797-94582819 GGAGTCAGATGTTCGAGGGCAGG - Intronic
1111958772 13:94786272-94786294 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1111977545 13:94982746-94982768 GGAGCCTGATGTTCAAGAGCAGG - Intergenic
1112230797 13:97587560-97587582 GGAGTCGGATGTTCAAGGGCAGG + Intergenic
1112245114 13:97726339-97726361 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1112249615 13:97767728-97767750 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1112250369 13:97773672-97773694 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1112487767 13:99835292-99835314 GTAGCCGGGTGGTCCAAGGCAGG + Intronic
1112603734 13:100882645-100882667 GGAGTCCAGTGTTCGAGGGCAGG - Intergenic
1112742101 13:102486610-102486632 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1112875756 13:104036572-104036594 GGAGTCCAGTGTTCCAGGCCAGG + Intergenic
1112953435 13:105030898-105030920 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
1113076005 13:106468585-106468607 GGAGGCAGGAGTTTCAGGGATGG - Intergenic
1113094607 13:106650471-106650493 AGAGTCCAGTGTTCCAGGGCAGG - Intergenic
1113128969 13:107013442-107013464 GGAGACTGATGTTCAAGGGCAGG - Intergenic
1113218688 13:108072908-108072930 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
1113267253 13:108633416-108633438 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1113493340 13:110709594-110709616 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1114205478 14:20567649-20567671 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1114526117 14:23367690-23367712 GCAGCCAGGTCCCCCAGGGCTGG - Intergenic
1114757913 14:25281268-25281290 GGAGTCCAGTGTTCCAGGGCAGG + Intergenic
1114758681 14:25287159-25287181 GGAGTCCAGTGTTCCAGGGCAGG + Intergenic
1115059361 14:29171066-29171088 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
1115060033 14:29176495-29176517 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1115718725 14:36136047-36136069 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1115956075 14:38780964-38780986 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1116166772 14:41343556-41343578 GAAGCCCGATGTTCAAGGGCAGG + Intergenic
1116248710 14:42454659-42454681 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1116266126 14:42692715-42692737 GGAGTCTGATGTTCCAGGGTAGG + Intergenic
1116327373 14:43547680-43547702 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1116747874 14:48845027-48845049 GGAGGCTGATGTTCAAGGGCAGG - Intergenic
1116759891 14:48998943-48998965 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1116774557 14:49165331-49165353 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1116779761 14:49224087-49224109 GGAGTCAGGTGTGTGAGGGCAGG + Intergenic
1117060591 14:51958581-51958603 GGAGCCAGGTGTCTCACTGCAGG - Intronic
1117491309 14:56250589-56250611 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1117535419 14:56698251-56698273 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1117545804 14:56794359-56794381 GGAGGCAGGTACTCCAGGTCGGG + Intergenic
1117645052 14:57842987-57843009 GGAGACTGATGTTCGAGGGCAGG - Intronic
1118761245 14:68881436-68881458 GGATTCAGGTGGGCCAGGGCAGG - Intronic
1119059374 14:71459587-71459609 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1119107218 14:71936242-71936264 GGAGTCAGATGTTTGAGGGCAGG + Intronic
1119107922 14:71941602-71941624 GGAGTCAGATGTTTGAGGGCAGG + Intronic
1119132291 14:72185087-72185109 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1120350535 14:83352235-83352257 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1120356308 14:83438790-83438812 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
1120537585 14:85715786-85715808 GGAGTCTGGTGTACAAGGGCAGG + Intergenic
1120556431 14:85933879-85933901 GGAGTCGGATGTTCCAGGGCAGG + Intergenic
1120654778 14:87176886-87176908 GGAGTCTGATGTTTCAGGGCAGG - Intergenic
1120821693 14:88917357-88917379 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1120907090 14:89630214-89630236 GAGACCAGGTGTTCCAGGCCAGG - Intronic
1121048136 14:90802773-90802795 AGAGCCGGGTGTAACAGGGCAGG + Intronic
1121082525 14:91119883-91119905 GGAGTCAGATGTTTGAGGGCAGG - Intronic
1121341028 14:93105233-93105255 GGAGCCAGAGGTTCCCAGGCTGG - Intronic
1121422905 14:93828107-93828129 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1121427620 14:93863850-93863872 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1121565717 14:94908048-94908070 GGAGCCTGGCCTTCCAGGGAAGG + Intergenic
1121654128 14:95582862-95582884 GGAGTCCGATATTCCAGGGCAGG + Intergenic
1121851636 14:97226698-97226720 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1122264529 14:100540445-100540467 GGAGCCCGGTGGTCCCGGGGCGG + Intronic
1122378406 14:101284859-101284881 GGAGCCCGATGTTTGAGGGCAGG - Intergenic
1123037607 14:105477852-105477874 GGAGGCAGGTGTTGGAGCGCGGG + Intronic
1123110627 14:105865358-105865380 GGAGCCAGGTGTACTGGGCCAGG - Intergenic
1123184599 14:106504869-106504891 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1124065666 15:26341399-26341421 GGAGTCCGATGTTTCAGGGCAGG + Intergenic
1124987116 15:34630978-34631000 GGAGTCTGCTGTTCCAGGGCAGG + Intergenic
1125423172 15:39525040-39525062 GGAGTCAGATGTTCGAGGGCAGG + Intergenic
1126110115 15:45170013-45170035 GGAGCCAGGTCAGCCAGGGTGGG + Intronic
1126314699 15:47357546-47357568 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1126318492 15:47396534-47396556 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1126452198 15:48820527-48820549 GGAGTCTGGTGTTCGAGGGCAGG + Intergenic
1126768624 15:52033464-52033486 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1127139498 15:55960425-55960447 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1127279290 15:57475226-57475248 GGAGCCAGGTGGTGGAGTGCAGG - Intronic
1128212099 15:65909944-65909966 CGAGCTAGGTGTTCCATGACAGG + Intronic
1128342899 15:66835079-66835101 GGAGCCGGGTAGTCCAGGCCTGG + Intergenic
1128481016 15:68038323-68038345 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1129605769 15:77024305-77024327 GGAGCCTGGGGATCCAGGCCTGG - Intronic
1130022003 15:80239547-80239569 GGAGTCAGATGTTCGAGGGCAGG - Intergenic
1130066392 15:80608447-80608469 GGAGCCCGATGTTCAAGGGCAGG - Intergenic
1130342308 15:83010256-83010278 GGAGCCAGGTTTTGCATGGATGG + Exonic
1130541561 15:84823920-84823942 GGAGCCAGGAGTTCAAGACCAGG - Intronic
1130772549 15:86939350-86939372 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1131176053 15:90210502-90210524 GCAGCCAGGTGGCCCAGGGTCGG + Intronic
1131272755 15:90957038-90957060 GGAGCGGGGTGTTCCTGGGAAGG - Intronic
1131344788 15:91636574-91636596 GGAGCGAGGTATCACAGGGCTGG + Intergenic
1131651883 15:94409261-94409283 GGAGTCCGATGTTCAAGGGCAGG - Intronic
1131753972 15:95540367-95540389 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1131896513 15:97037174-97037196 GGAGGCTGATGTTCGAGGGCAGG - Intergenic
1131986630 15:98048709-98048731 GGAGTCTGGTGGTCGAGGGCAGG - Intergenic
1132036431 15:98488682-98488704 GGAGTCGGATGTTCGAGGGCAGG - Intronic
1132217949 15:100081221-100081243 GGGGTCTGATGTTCCAGGGCAGG - Intronic
1132299886 15:100768843-100768865 GGAGCCAGAGGTGCCAGGGGTGG + Intergenic
1132564896 16:617478-617500 GGAATCAGGTTTTCCGGGGCAGG - Intronic
1132723002 16:1326170-1326192 GGAGCCAGAGGTTGGAGGGCTGG - Exonic
1132782359 16:1634561-1634583 GGAGCCTGCTGTGCCAGGTCAGG - Intronic
1132982448 16:2745409-2745431 GAAGCCCTGTGTGCCAGGGCTGG - Intergenic
1133334459 16:4997798-4997820 GGACCCAGGTGTTCCTTGGCTGG + Intronic
1133392155 16:5419324-5419346 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1133425355 16:5683604-5683626 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1133623589 16:7549635-7549657 GGAGTCTGTTGTTCAAGGGCAGG + Intronic
1133648597 16:7788019-7788041 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1133727371 16:8550062-8550084 GGAATCTGATGTTCCAGGGCAGG + Intergenic
1133925200 16:10186719-10186741 GGAGTCCGATGTTCCAGGGCAGG - Intergenic
1134374885 16:13662579-13662601 CGAGTCTGATGTTCCAGGGCAGG - Intergenic
1134504899 16:14797086-14797108 GGAGTCCAATGTTCCAGGGCAGG + Intronic
1134575674 16:15331823-15331845 GGAGTCCAATGTTCCAGGGCAGG - Intergenic
1134726771 16:16424679-16424701 GGAGTCCAATGTTCCAGGGCAGG + Intergenic
1134778287 16:16872026-16872048 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1134861401 16:17563733-17563755 GGAATCCGATGTTCCAGGGCAGG + Intergenic
1134940663 16:18287184-18287206 GGAGTCCAATGTTCCAGGGCAGG - Intergenic
1135216401 16:20575503-20575525 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1135959545 16:26984319-26984341 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1136061971 16:27732786-27732808 GGAGCCAGGGGTTCTGGGCCAGG - Intronic
1136408758 16:30064717-30064739 TGAGCTAGGGGTTCCCGGGCTGG - Intronic
1136751160 16:32637574-32637596 GGAGCTAGGTGCTGCGGGGCTGG + Intergenic
1137004111 16:35256086-35256108 GGAGCCAGGAGATTCAGGACGGG - Intergenic
1137365984 16:47859825-47859847 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1137543392 16:49380054-49380076 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1137668008 16:50262914-50262936 GGAGCACTGTGTGCCAGGGCTGG + Intronic
1138033899 16:53583150-53583172 GGAGCTCAATGTTCCAGGGCAGG - Intergenic
1138377530 16:56576166-56576188 GGAGCCAGGGCTTCCAGAGGTGG - Intergenic
1138883190 16:61041762-61041784 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1138907060 16:61349607-61349629 GGAGTCTGATGTTCTAGGGCAGG + Intergenic
1139677633 16:68535931-68535953 AGAGCCGGGTGTTCCAAGTCAGG - Intronic
1139972783 16:70786476-70786498 GGAGACAGGCGTCTCAGGGCAGG + Intronic
1140209534 16:72959684-72959706 TGAGCCAGCTGACCCAGGGCGGG - Exonic
1140222038 16:73050650-73050672 AGAGCCAGGGCTTCCAGAGCTGG - Intronic
1140336781 16:74114571-74114593 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1140502941 16:75450736-75450758 GGAGCCAGGAGGTCCAGGCTGGG - Intronic
1140710390 16:77672140-77672162 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1140764600 16:78145431-78145453 GGAGTCCGATGTTCCAGGGCAGG + Intronic
1141547625 16:84781867-84781889 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
1141844514 16:86598218-86598240 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1142231295 16:88901456-88901478 AGGGCCAGGTGTTTCAGGGGAGG - Intronic
1142312979 16:89324674-89324696 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1203053294 16_KI270728v1_random:896829-896851 GGAGCTAGGTGCTGCGGGGCTGG + Intergenic
1142785770 17:2221368-2221390 GGAGGCACGTCTTCCATGGCTGG - Intronic
1143359609 17:6358300-6358322 GAAGCCTGGTGGTCCAGGCCAGG + Intergenic
1144154604 17:12486966-12486988 GGAGTCTGGTGTTTGAGGGCAGG + Intergenic
1144155222 17:12493854-12493876 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1144191797 17:12853207-12853229 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1144567222 17:16369534-16369556 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1144714019 17:17421854-17421876 GGACCCAGGCGTTCCAGGGCAGG - Intergenic
1144760844 17:17706458-17706480 GGATCCAGGTGGACAAGGGCTGG + Intronic
1144805853 17:17966918-17966940 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1145224296 17:21115068-21115090 GGAGTCCGTTGTTCGAGGGCAGG + Intergenic
1145266604 17:21382764-21382786 GCAGCCAGGTGTGCCAGGATGGG + Intronic
1145959477 17:28879122-28879144 GGAGCCAGGTGTTCCAGGGCTGG + Intergenic
1146237700 17:31183843-31183865 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1146837295 17:36122250-36122272 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1147215927 17:38899001-38899023 TGAGCCAGGGGGTGCAGGGCTGG - Intronic
1148337967 17:46854023-46854045 GGAGCCACCTCTTCCAGGTCAGG + Intronic
1148675286 17:49441373-49441395 GGAGCGAGCTGTTCCTGGGCTGG - Intronic
1149051078 17:52306281-52306303 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1149100685 17:52902827-52902849 GGAGTCTGATGTTCCAGGACAGG - Intergenic
1149236456 17:54596114-54596136 GGAGTCTGATATTCCAGGGCAGG + Intergenic
1149468074 17:56894979-56895001 GGAGACAGGAGATGCAGGGCAGG + Intronic
1149638957 17:58191034-58191056 GGAGCCAGGTGCTCCCCGGGTGG - Intergenic
1150069489 17:62139271-62139293 AGCGCCAGGTGTACGAGGGCCGG - Intergenic
1150133222 17:62680356-62680378 GGGGCCAGGAATTCCAGGGAGGG + Intronic
1150304277 17:64071208-64071230 AGAGCCGGGTGTTCCTGAGCAGG + Intronic
1150517305 17:65827069-65827091 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1150767510 17:68013888-68013910 GGAGTCAGATATTCGAGGGCAGG + Intergenic
1150989209 17:70236187-70236209 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1151069047 17:71187242-71187264 GGAGTCAAATGTTCAAGGGCAGG + Intergenic
1151162543 17:72177252-72177274 GGGGCCAGGTATTCCTGAGCAGG + Intergenic
1151184147 17:72351097-72351119 GGGGCCAGGTGGGCCAGGCCGGG + Intergenic
1151337278 17:73447434-73447456 AGAGCCAGGGGTGCCTGGGCAGG - Intronic
1151368554 17:73632404-73632426 GGAGTCCGATGTTCAAGGGCAGG - Intronic
1151488396 17:74416848-74416870 GAAGCCAGGAGTTCAAGAGCAGG + Intergenic
1151504249 17:74516103-74516125 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1151664936 17:75540406-75540428 GGAGCCAGGAGGACCAAGGCAGG - Intronic
1152229739 17:79108502-79108524 GGAGCCTGGGGTCACAGGGCTGG + Intronic
1152262480 17:79274592-79274614 GGAGCCCTGTGGTGCAGGGCTGG + Intronic
1152398934 17:80052302-80052324 GGAGTCCAGTGTTCAAGGGCAGG + Intronic
1152688489 17:81706862-81706884 GGAGCCAGGTGACAAAGGGCTGG - Intronic
1153067344 18:1061065-1061087 GGAGTCTGGTGTTCAAGGGTAGG - Intergenic
1153101171 18:1471336-1471358 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1153149242 18:2071306-2071328 TGAGACAGGTGTTCCTGGGGTGG - Intergenic
1153602132 18:6791191-6791213 GGAGTCCGATGTTCGAGGGCAGG + Intronic
1154068035 18:11127553-11127575 GGAGCCTGATGTTCGAGGGCAGG - Intronic
1154071480 18:11156168-11156190 GGAGTCCGATGTTCTAGGGCAGG + Intergenic
1154252222 18:12754150-12754172 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1154505767 18:15039409-15039431 GGAGTTCGATGTTCCAGGGCAGG - Intergenic
1155551241 18:26967926-26967948 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1156632255 18:38984297-38984319 GGAGGCATGTCTTCCATGGCTGG - Intergenic
1156973892 18:43193034-43193056 GGAGTCCGGTGTTTGAGGGCAGG + Intergenic
1157335620 18:46735097-46735119 GGAGTCCGATTTTCCAGGGCAGG - Intronic
1157800528 18:50616712-50616734 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1157821117 18:50770116-50770138 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1157892620 18:51432522-51432544 GGAGTCAGGTGTCCAAGGACAGG - Intergenic
1157974073 18:52306224-52306246 GGAGTCCGATGTTCGAGGGCGGG - Intergenic
1158175855 18:54654908-54654930 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1158542479 18:58369663-58369685 GGAGCCTGGGGTGCCAGGTCTGG + Intronic
1158808422 18:61002815-61002837 GGAGCCGGATGTTCCAGGACAGG + Intergenic
1159200719 18:65180487-65180509 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1159287363 18:66372002-66372024 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1159455028 18:68650629-68650651 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1159559508 18:69978550-69978572 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1159704429 18:71668804-71668826 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1159708788 18:71727435-71727457 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1159711667 18:71767064-71767086 GGAGTCTGATGTTCCAGGGCAGG - Intronic
1159736031 18:72098972-72098994 GGAGTCTGATGTTCCAGTGCAGG + Intergenic
1159756879 18:72376638-72376660 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1159819476 18:73121605-73121627 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1160204339 18:76821403-76821425 GAAGCTAGGAGTTCCAGAGCAGG + Intronic
1160715137 19:572989-573011 GGAGCCAGGGGGTCCTGGCCAGG + Intronic
1161013260 19:1970201-1970223 GGAGGCAGGTGGCCCAGAGCAGG + Intronic
1161013305 19:1970441-1970463 GGAGCCAGGTGGGCCAGGTGCGG - Intronic
1161362565 19:3859216-3859238 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1161478282 19:4498237-4498259 GGGGCCAGCTGTTCAAGGGCAGG - Intronic
1161624081 19:5315842-5315864 GGGGCCAGGAGTTCCAGATCAGG - Intronic
1161698398 19:5782769-5782791 GGAGTCTGATGTTCCAGGGCTGG + Intergenic
1161724157 19:5918798-5918820 GGGAGCAGGTGTGCCAGGGCTGG - Intronic
1162688126 19:12405088-12405110 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1163060068 19:14754146-14754168 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1163169939 19:15524279-15524301 GGTGCCAGGGGCTCCAGGGAGGG + Intronic
1163195530 19:15717087-15717109 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1163334380 19:16661334-16661356 TGAGCCAGGTGAGCCGGGGCGGG + Exonic
1163633397 19:18428000-18428022 GGACTCAGGGGCTCCAGGGCGGG + Intronic
1163643250 19:18473803-18473825 GGGGCCAGGTGGTGCAGGGGTGG - Intronic
1163665045 19:18599317-18599339 GAAGCCAGGAGTTCGAGGCCAGG - Intronic
1164097595 19:22025413-22025435 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1164117771 19:22238774-22238796 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1164200541 19:23014412-23014434 GGAATCTGGTGTTCAAGGGCAGG + Intergenic
1164404798 19:27935260-27935282 GTAGCCAGCTTTCCCAGGGCTGG - Intergenic
1164405070 19:27937077-27937099 GTAGCCAGCTTTCCCAGGGCTGG + Intergenic
1164521985 19:28986376-28986398 GGAGCCAGCTGGTTCAGGGATGG + Intergenic
1164875543 19:31683414-31683436 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1164880180 19:31726360-31726382 GGAGCCCAATGTTCAAGGGCAGG - Intergenic
1165093921 19:33400487-33400509 GGGGCCAGCTGTGCCTGGGCCGG + Intronic
1165146026 19:33730912-33730934 GGAGTCCGATGTTCGAGGGCAGG + Intronic
1165358138 19:35316663-35316685 GGGGACAGGTGTGTCAGGGCAGG - Intergenic
1165950083 19:39469402-39469424 GGTGCCCGGTGTTCTCGGGCAGG + Intronic
1165969047 19:39609939-39609961 GAAGCCAGGGGTTCCAGGATAGG - Intergenic
1166049831 19:40252116-40252138 GGAGGCAGGGGTTGCAGGGCAGG - Intronic
1166076958 19:40419367-40419389 GGTGGCAGTTGTGCCAGGGCTGG + Intergenic
1166079271 19:40433830-40433852 GGAGCCAGGAATTCAAAGGCTGG + Intergenic
1166678612 19:44754357-44754379 GGAGCTAGGTCTTCTTGGGCTGG + Intronic
1166810177 19:45509542-45509564 AGGGCCAGGGCTTCCAGGGCTGG - Intronic
1166856755 19:45786092-45786114 GGTGCCAGGTGTGCCAGGGAGGG + Exonic
1166864020 19:45825453-45825475 GGAGCTAATTGTTCTAGGGCAGG + Intronic
1166893992 19:46012135-46012157 GCAGTGAGGAGTTCCAGGGCAGG + Intronic
1167003119 19:46757384-46757406 GGAGCCAGGTGGGCCTGGGGGGG + Exonic
1167213675 19:48149779-48149801 GGAGCCAGGGGCTCCAGGAAAGG - Exonic
1167499955 19:49840472-49840494 GGATCCAACAGTTCCAGGGCAGG - Intergenic
1167524908 19:49977596-49977618 GCAGCCAGCTCCTCCAGGGCAGG - Intronic
1167582595 19:50354998-50355020 GGAGTCCGATGTTCGAGGGCAGG + Intronic
1168593493 19:57655263-57655285 GGATCCAGGTGTTCTAGGATGGG - Intergenic
925020851 2:566604-566626 AGAGACAGGTGTCACAGGGCAGG - Intergenic
925106816 2:1298930-1298952 GGAGTCTGATGTTCAAGGGCAGG - Intronic
925115976 2:1378606-1378628 GGAGGCAGGTGCTCCAGCCCTGG - Intronic
925142080 2:1557641-1557663 GGGGCCAGGTGTGGCAGGGATGG - Intergenic
925461076 2:4063067-4063089 GGAGCCCAATGTTCAAGGGCAGG - Intergenic
925480057 2:4260855-4260877 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
925497948 2:4473135-4473157 GGAGTCTGATGTTCGAGGGCTGG + Intergenic
925499832 2:4490368-4490390 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
925516864 2:4692472-4692494 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
925551806 2:5084448-5084470 GGAGCCAAGTGCTCCTGTGCAGG + Intergenic
925574162 2:5343505-5343527 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
925585859 2:5463535-5463557 GGAGGCAAGGGTACCAGGGCAGG + Intergenic
925655344 2:6141774-6141796 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
925713258 2:6762118-6762140 GGAGTCAGATGTTTGAGGGCAGG - Intergenic
925847573 2:8047608-8047630 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
925876234 2:8313250-8313272 AGAGCCAGGGGGTCTAGGGCAGG - Intergenic
926135235 2:10331503-10331525 GCAGCGAGGTTTTCCGGGGCAGG + Intronic
926176087 2:10593670-10593692 GGGGCCAGGCTTTCCAGAGCTGG - Intronic
926401044 2:12497096-12497118 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
926647231 2:15302914-15302936 GGAGTCTGATGTTCAAGGGCAGG - Intronic
926733183 2:16052757-16052779 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
926810065 2:16748110-16748132 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
926810833 2:16754135-16754157 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
926840023 2:17070082-17070104 GGAGTCTGCTGTTCGAGGGCAGG + Intergenic
926841850 2:17089653-17089675 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
927355667 2:22170275-22170297 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
927425166 2:22973419-22973441 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
927463522 2:23320353-23320375 GGACCCCTGTGGTCCAGGGCAGG + Intergenic
928186444 2:29115375-29115397 GGAGCCAGGCGAGCCAGCGCAGG + Intronic
928388986 2:30894740-30894762 GAAGCCAGCTGTTGCAGGGGAGG + Intergenic
928594523 2:32847335-32847357 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
928747649 2:34434120-34434142 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
929012245 2:37456603-37456625 GCAGCCAGGACTTACAGGGCTGG + Intergenic
929743709 2:44632848-44632870 GGAGTCTGATGTTCGAGGGCAGG - Intronic
930061665 2:47294656-47294678 GAAGTCCGATGTTCCAGGGCAGG - Intergenic
930537019 2:52655783-52655805 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
930997370 2:57736738-57736760 GGAGTCAGATGCTCAAGGGCAGG + Intergenic
931579967 2:63761589-63761611 GGAGTCTCATGTTCCAGGGCAGG + Intronic
932036104 2:68248579-68248601 GGATTCAGTTGTTCCAGGGTGGG + Intronic
932343707 2:70982332-70982354 GGAGCCAGGGGCCCCAGGGCAGG - Intronic
932404204 2:71503022-71503044 GGGGCCAGGCCTTCCAGGGATGG + Intronic
932905000 2:75739537-75739559 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
932953767 2:76326492-76326514 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
933052902 2:77622498-77622520 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
933163328 2:79051011-79051033 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
933193334 2:79361754-79361776 GGAGTCAGATGTTCAAGGGCAGG + Intronic
933446241 2:82383312-82383334 GGAGTCTAATGTTCCAGGGCAGG + Intergenic
933632520 2:84673661-84673683 GGAGTCCGATGTTCAAGGGCAGG + Intronic
933915940 2:86993647-86993669 GGAGTCTGATGTTCAAGGGCAGG + Intronic
934007053 2:87776255-87776277 GGAGTCTGATGTTCAAGGGCAGG - Intronic
934607172 2:95705106-95705128 GGCACCAGGAGTTCCAGGCCAGG + Intergenic
934615744 2:95769564-95769586 GGATCCAGGTGTGGCAGGACAGG - Intergenic
934655497 2:96115109-96115131 GTGGCCAGGTGCTCCTGGGCAGG - Exonic
935366348 2:102295389-102295411 GTAGCCAGGTGCTCTAGGGATGG + Intergenic
935563972 2:104587656-104587678 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
935770696 2:106417162-106417184 GGAGTCTGATGTTCAAGGGCAGG - Intronic
935824938 2:106936519-106936541 GGAGTCTGCTGTTCAAGGGCAGG + Intergenic
935882911 2:107584322-107584344 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
935909390 2:107878774-107878796 GGAGTCTGATGTTCAAGGGCAGG + Intronic
936002827 2:108851207-108851229 GGAGCGTGGTGCTCCAGGGAGGG - Intronic
936131168 2:109843912-109843934 GGAGTCTGATGTTCAAGGGCAGG + Intronic
936213529 2:110527573-110527595 GGAGTCTGATGTTCAAGGGCAGG - Intronic
936422666 2:112382133-112382155 GGAGTCTGATGTTCAAGGGCAGG - Intronic
936541804 2:113358260-113358282 GGAGCCAAGTGTCCCATGCCGGG + Intergenic
936665825 2:114594234-114594256 GGAGTCTGATGTTCTAGGGCAGG - Intronic
936940558 2:117879731-117879753 GGAGTCAGATGTTTGAGGGCTGG - Intergenic
936965992 2:118128067-118128089 GGAGCCAGGTCCTGAAGGGCTGG - Intergenic
937582726 2:123507722-123507744 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
937620257 2:123977079-123977101 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
937732624 2:125252800-125252822 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
937765951 2:125660716-125660738 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
937785757 2:125895524-125895546 GGGGTCTGATGTTCCAGGGCTGG + Intergenic
937852246 2:126646116-126646138 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
937906703 2:127056021-127056043 AGAGCAAGGTGTGCCAGGCCAGG - Intronic
938509087 2:131921256-131921278 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
938574498 2:132591357-132591379 GGAGTCCAGTGTTCAAGGGCAGG - Intronic
938639750 2:133266429-133266451 GGAGCCAGGTGCCGAAGGGCTGG + Intronic
938683356 2:133714059-133714081 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
938861881 2:135378004-135378026 GGAGTCCAATGTTCCAGGGCAGG - Intronic
938948350 2:136234867-136234889 GGAGGCAGGCCTTCCAGGGAAGG + Intergenic
939214193 2:139214851-139214873 GGAGCCTGATGCTCAAGGGCAGG - Intergenic
939321358 2:140627422-140627444 GGAGACCGATGTTCGAGGGCAGG - Intronic
939456689 2:142446258-142446280 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
939481479 2:142753391-142753413 AGAGTCATGTGTTCCACGGCCGG - Intergenic
939707191 2:145469735-145469757 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
939990964 2:148876277-148876299 GGAGCCAGGTGTAACACCGCGGG - Intronic
940094512 2:149959127-149959149 GGAGCCCAGTGTTCGAGGTCAGG - Intergenic
940138130 2:150462104-150462126 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
940207785 2:151223236-151223258 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
940319227 2:152358141-152358163 GGAGTCTGATGTTCGAGGGCAGG - Intronic
940357680 2:152763483-152763505 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
940414970 2:153409018-153409040 GGAGTCTGGTGTTTGAGGGCAGG - Intergenic
940550422 2:155148403-155148425 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
940753445 2:157654678-157654700 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
940977759 2:159965308-159965330 GTTGCCAGGTGTTGCAGGGAGGG - Intronic
941667519 2:168257321-168257343 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
941672017 2:168304339-168304361 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
942619503 2:177832426-177832448 GGAGACCGATGTTCGAGGGCAGG - Intronic
942708862 2:178809251-178809273 GGAGTCCGATGTTCGAGGGCAGG - Intronic
943073313 2:183167260-183167282 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
943150997 2:184113088-184113110 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
943168021 2:184357253-184357275 GGAGGCTGGTGTGCCAGAGCAGG + Intergenic
943170075 2:184386635-184386657 GGAGCCTGATGTTTGAGGGCAGG - Intergenic
943384453 2:187184334-187184356 GGAGTCAGGTATTCAAGGGCAGG + Intergenic
943470752 2:188291864-188291886 GGAGCCCGGCGTTCCCGGCCGGG + Intronic
943831089 2:192463150-192463172 GGAGTCCAATGTTCCAGGGCAGG - Intergenic
943966198 2:194337073-194337095 GGAGCCCAATGTTCGAGGGCAGG - Intergenic
943967081 2:194350650-194350672 GGAGTCTGGTGTTCAAGGGCAGG - Intergenic
944336479 2:198541037-198541059 GGAGTCTGATGTTCGAGGGCAGG - Intronic
944422292 2:199544330-199544352 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
944537538 2:200725718-200725740 GAAGCCAGGCGTTCCAGTGTTGG - Intergenic
944619375 2:201498356-201498378 GGAGTCTGATGTCCCAGGGCAGG + Intronic
945320499 2:208416835-208416857 GGAGTCCAGTGTTCAAGGGCAGG - Intronic
945320803 2:208420940-208420962 GTTGCCAGGTGTTGCAGGGAAGG - Intronic
945377796 2:209099480-209099502 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
945725516 2:213468870-213468892 GGAGTCTGATGTTCCAGAGCAGG + Intronic
945763622 2:213945457-213945479 GGAGTCAGTTGTTTGAGGGCAGG + Intronic
945898995 2:215517060-215517082 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
946228502 2:218277564-218277586 GGAGTGGGGTGTTCCTGGGCCGG - Intronic
946588940 2:221221730-221221752 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
946817411 2:223593364-223593386 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
946847272 2:223870365-223870387 GGAGTCTGATGTTCGAGGGCAGG - Intronic
946901517 2:224377452-224377474 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
947030586 2:225788585-225788607 GGAGACTAATGTTCCAGGGCAGG - Intergenic
947056029 2:226104703-226104725 GGAGTCCGTTGTTCAAGGGCAGG - Intergenic
947059246 2:226144049-226144071 GGAGTCAGATGTTTGAGGGCAGG + Intergenic
947078346 2:226368288-226368310 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
947440790 2:230119839-230119861 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
947769401 2:232659112-232659134 TGAGACAGGTGTTCCAGATCTGG - Intronic
947993425 2:234505744-234505766 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
948095285 2:235328590-235328612 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
948131020 2:235600627-235600649 GGAGCCTGATGTTCGAGGGCAGG + Intronic
948322794 2:237084235-237084257 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
948376485 2:237524429-237524451 GGAGTCCGATGTTCGAGGGCAGG + Intronic
948600547 2:239105499-239105521 GGAGCCACGTCTTGCTGGGCCGG + Intronic
948769459 2:240242512-240242534 GGAGTCCGATGTTCTAGGGCAGG + Intergenic
949060523 2:241953865-241953887 GGAGCCAGATGTGCCCAGGCCGG + Intergenic
1169012220 20:2260165-2260187 AGAGCCAGATATTCCAGAGCAGG + Intergenic
1169345373 20:4824143-4824165 GGCGCCAGGAGGTCCAGGGATGG - Intergenic
1169746489 20:8948228-8948250 TGACTCAGGTGTTCCAGGACAGG + Intronic
1169774701 20:9239877-9239899 GGAGTCCAGTGTTCAAGGGCAGG + Intronic
1169836033 20:9880135-9880157 AGAGACAGGGGTTCCAGTGCAGG - Intergenic
1169838402 20:9906445-9906467 AGAGTCCGATGTTCCAGGGCAGG + Intergenic
1170503837 20:17003594-17003616 GGAGCCTGATGCTTCAGGGCAGG + Intergenic
1170714653 20:18821188-18821210 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1171231482 20:23490638-23490660 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1171405332 20:24909104-24909126 GGAGCCAGGAGGTCCCTGGCAGG - Intergenic
1171409549 20:24936822-24936844 GGAGCCAGGACTTCTAAGGCTGG - Intergenic
1171984169 20:31647889-31647911 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1171987501 20:31670758-31670780 GGGGCGTGCTGTTCCAGGGCGGG + Intronic
1172844655 20:37922700-37922722 GGAGACAGGAGATTCAGGGCTGG + Intronic
1173466970 20:43290904-43290926 GGATCCAGGTGTTCCAGGCATGG - Intergenic
1173583305 20:44162615-44162637 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1174094515 20:48077665-48077687 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1174103506 20:48145476-48145498 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1174288404 20:49488938-49488960 GGAGTCCGATGTTCCAGGGCAGG - Intergenic
1174546065 20:51326088-51326110 GGAGCCAGGTTCTCTAGGGAAGG + Intergenic
1174666196 20:52260290-52260312 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1174794574 20:53511354-53511376 GGAGTCTGGTGTTTAAGGGCAGG - Intergenic
1174878106 20:54249293-54249315 GAAACCAGGTGTTCTAAGGCAGG + Intergenic
1174956113 20:55100361-55100383 GGAGTCTGGTGTTCAAGGGCAGG + Intergenic
1175056771 20:56205838-56205860 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1175203253 20:57292216-57292238 GCAGCCAGGGGGACCAGGGCAGG + Intergenic
1175698101 20:61117545-61117567 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1175758128 20:61543009-61543031 GGAGTCTGATGTTCCAGGGCAGG + Intronic
1175839288 20:62016495-62016517 GGAGTCTGAAGTTCCAGGGCAGG - Intronic
1176074075 20:63240583-63240605 GGAGCCAGCTGGACCTGGGCAGG - Intergenic
1176117545 20:63439648-63439670 GGAGCCTGCCGTTCCAGGTCTGG + Exonic
1176249671 20:64114510-64114532 GGAGCCAGCAGCTGCAGGGCTGG + Intergenic
1176276764 20:64276827-64276849 GGAGTCCTGTGTTCGAGGGCCGG + Intronic
1176408954 21:6437397-6437419 GCAGCCAAGTGAGCCAGGGCAGG - Intergenic
1176792095 21:13329617-13329639 GGAGTTCGATGTTCCAGGGCAGG + Intergenic
1177030042 21:15971048-15971070 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
1177268037 21:18809558-18809580 GGAGCCTGATGTTTGAGGGCAGG - Intergenic
1177535527 21:22422303-22422325 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
1177555390 21:22681722-22681744 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1177597026 21:23257880-23257902 GGAGTCTGATGTTGCAGGGCGGG + Intergenic
1177701529 21:24645471-24645493 GAAGGGAGATGTTCCAGGGCGGG + Intergenic
1177991493 21:28040604-28040626 GGAGTTCGATGTTCCAGGGCAGG + Intergenic
1178011480 21:28291366-28291388 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1178061733 21:28860313-28860335 GGAGTCCAGTGTTCCAGGACAGG - Intergenic
1178159414 21:29894397-29894419 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1178167506 21:29996712-29996734 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1178284267 21:31311986-31312008 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1178781980 21:35612338-35612360 GGAGTCAGATGTTCAAGGGCAGG + Intronic
1178910906 21:36672687-36672709 GGAGTCCGATGTTCCAGGGCAGG - Intergenic
1179084027 21:38201421-38201443 GGAGTCTGATGTTCCAGGGCAGG - Intronic
1179414803 21:41189924-41189946 GGAGTCCAGTGTTCAAGGGCAGG + Intronic
1179467943 21:41590224-41590246 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1179684447 21:43045719-43045741 GCAGCCAAGTGAGCCAGGGCAGG - Intergenic
1180934160 22:19613256-19613278 GGCGCAAGGGGTTCCAGGGCAGG + Intergenic
1181473791 22:23156496-23156518 GCAGCCAGGTGGTGCTGGGCAGG + Intronic
1181952571 22:26565045-26565067 GGTGACAGGTCTTCCTGGGCTGG - Intronic
1181953161 22:26569332-26569354 GGAGCAAGGTGTCCTGGGGCAGG + Intronic
1182193540 22:28489978-28490000 GGAGTCCGATGTTCGAGGGCAGG + Intronic
1182585328 22:31341514-31341536 GGGCCCAGGTTTTCAAGGGCTGG + Intronic
1182606507 22:31509446-31509468 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1182622879 22:31627464-31627486 GGAGCCTGGTGGGCCAGGGAGGG - Intronic
1182661901 22:31931090-31931112 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1182926699 22:34131812-34131834 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1182962671 22:34490206-34490228 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1183039089 22:35162697-35162719 CGAGCCAGGGGTTGCAGGTCAGG + Intergenic
1183162041 22:36120971-36120993 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1183359641 22:37376797-37376819 GGATCAAGGTGCTCCAGGGAAGG - Intronic
1183385261 22:37510464-37510486 GGAGCCACGGGTTACAGGGGTGG + Intronic
1183420717 22:37709829-37709851 AGAGGCAGGGGATCCAGGGCTGG - Intronic
1183591841 22:38783574-38783596 GGAGCCTGGTGTGCCAGGGAGGG - Intronic
1183645094 22:39120986-39121008 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1183754734 22:39749829-39749851 TGAGCGAAGGGTTCCAGGGCTGG + Intronic
1183938737 22:41280330-41280352 GGTGCCAGGTGATTCAGGGTTGG + Intronic
1184178904 22:42806144-42806166 GGAGCCAGGCATTCCAAGCCTGG - Intronic
1184367867 22:44063936-44063958 GGGGCCAGGTGTTCCGTGGATGG + Intronic
1184401687 22:44278242-44278264 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1184507045 22:44910169-44910191 GGGCCCAGGGGGTCCAGGGCGGG + Intronic
1184604009 22:45561845-45561867 GGAGTCCGATGTTCAAGGGCAGG + Intronic
1184681024 22:46072102-46072124 CGAGCCAGGACTTGCAGGGCCGG - Intronic
1184735993 22:46398156-46398178 GGAGCCAGGGGTTCCAGCTACGG - Intronic
1184797669 22:46741308-46741330 GGAGCCAGGTGGCCCATGGGTGG - Intergenic
1184938779 22:47745269-47745291 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
1184959171 22:47916677-47916699 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1185335455 22:50269266-50269288 GGGGCCGGGGGTCCCAGGGCAGG - Intronic
949126085 3:446585-446607 GGAGTCCGATGTTCCAGGGCAGG + Intergenic
949347083 3:3086489-3086511 GAAGCCAGCTGATCTAGGGCAGG + Intronic
949412651 3:3782697-3782719 GGAGTCTGATGTTCCAGGGCAGG + Intronic
949417259 3:3828295-3828317 GGGGTCTGATGTTCCAGGGCAGG + Intronic
949418090 3:3834728-3834750 GGAGTCTGATGTTCGAGGGCAGG + Intronic
949425854 3:3915024-3915046 GGAGTCCGATGTTCAAGGGCAGG - Intronic
949445942 3:4133672-4133694 GGAGTCCGATGTTCAAGGGCAGG - Intronic
949846702 3:8378368-8378390 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
949929147 3:9064633-9064655 GGAGCCAGGAGTAACAGGGAGGG - Intronic
950209064 3:11104558-11104580 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
950512872 3:13443128-13443150 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
950932479 3:16804353-16804375 GGAGTCTGATGTTCGAGGGCAGG - Intronic
950988283 3:17400814-17400836 GGAGTCTGATGTTCGAGGGCAGG - Intronic
951112627 3:18822839-18822861 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
951290958 3:20871890-20871912 GGAGTCCAGTGTTCCAGGGCAGG - Intergenic
951302108 3:21010420-21010442 GGAGCCCGATGTTCAAGGGTGGG - Intergenic
951529005 3:23681521-23681543 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
951858533 3:27225131-27225153 GGAGTCCAGTGTTCAAGGGCAGG + Intronic
951900734 3:27655328-27655350 AAAGCAAGGTCTTCCAGGGCCGG - Intergenic
951905699 3:27704699-27704721 GGAGTCAGATGTTCGAGGTCAGG - Intergenic
951993511 3:28701921-28701943 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
952191860 3:31031308-31031330 GTTGCCAGGGGTTCCAGGGGAGG - Intergenic
952313080 3:32208035-32208057 GGAGTCAGATGTTCGAGGGTAGG + Intergenic
953180675 3:40591545-40591567 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
953678450 3:45021419-45021441 GGCCCCATGTTTTCCAGGGCTGG - Intronic
953681605 3:45043121-45043143 TGAGCCAGGTAGTCCAGTGCTGG + Intergenic
953812221 3:46123049-46123071 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
953897874 3:46816274-46816296 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
954054549 3:48010857-48010879 GGAGTCCGATGTTCGAGGGCAGG - Intronic
954239011 3:49278685-49278707 GGAGCTAGGTGTGACAGAGCTGG - Intronic
954333689 3:49903991-49904013 GGAGCCAGGCCTCCAAGGGCCGG - Exonic
954372595 3:50176593-50176615 CCAGCCAGGTCTCCCAGGGCAGG - Intronic
954381647 3:50222023-50222045 GGAGCCAAGGGTTCCAGGCAAGG - Intergenic
955499070 3:59566120-59566142 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
955535228 3:59916239-59916261 GGAGTCCGATGTTCGAGGGCAGG - Intronic
955851944 3:63230033-63230055 GGAGCAAGGAGGTACAGGGCTGG - Intronic
956096307 3:65720382-65720404 AGAGCCAAGTCTTCCAGGGTAGG - Intronic
956364738 3:68488238-68488260 GGAGTCCGATGTTCAAGGGCAGG + Intronic
956703517 3:71980009-71980031 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
956713176 3:72056253-72056275 TGGGCCAGGGGTTCCAGGGTAGG - Intergenic
956722599 3:72131582-72131604 GGAGTCTGGTGTGCAAGGGCAGG + Intergenic
957247973 3:77736788-77736810 GGAGTCTGGTGTTCGAGGGCAGG + Intergenic
957633996 3:82758579-82758601 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
958060139 3:88468878-88468900 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
958258984 3:91357504-91357526 GGAGTCTGATGTTTCAGGGCAGG + Intergenic
958438203 3:94123666-94123688 GGAGCAAGGTGAGCCAGGGGTGG - Intronic
958697114 3:97542003-97542025 GGAGTCCGATGTTCGAGGGCAGG + Intronic
958806613 3:98818756-98818778 GGAGTCTGATGTTCAAGGGCAGG - Intronic
959298187 3:104565008-104565030 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
959310171 3:104726030-104726052 GGAGTCTGATGTTCTAGGGCAGG + Intergenic
959339637 3:105112689-105112711 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
959425136 3:106178039-106178061 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
959743873 3:109753695-109753717 GGAGCCAGGTTTTCCAGCAATGG + Intergenic
959745695 3:109774661-109774683 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
959927142 3:111935652-111935674 GGAGTCCAGTGTTCAAGGGCAGG + Intronic
960149016 3:114232299-114232321 GGGGCCTGGAGGTCCAGGGCTGG + Intergenic
960231371 3:115231485-115231507 GGAGTCCAGTGTTCCAGGGCAGG - Intergenic
960939445 3:122923781-122923803 GGTGCCAGGTCTTACAGGGAGGG - Intronic
961256171 3:125555183-125555205 GGAGTCCGATGTTCAAGGGCAGG - Intronic
961510119 3:127395746-127395768 GGAGCCAGGTGCTCAGGGGATGG - Intergenic
961866323 3:129955984-129956006 GGAGCCAGGCGATCAATGGCCGG + Intergenic
961961294 3:130858020-130858042 GGAGTCCGATGTTCCAGTGCAGG + Intronic
962013375 3:131415796-131415818 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
962031413 3:131604636-131604658 GGAGTCCGATGTTCGAGGGCAGG - Intronic
962146654 3:132846762-132846784 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
962292495 3:134148184-134148206 GGAGTCCAGTGTTCGAGGGCAGG - Intronic
962349263 3:134644800-134644822 GGAGGCAGGCTTTCCAGGGCAGG - Intronic
962601260 3:136992345-136992367 GGGGCCAGGTGTTGCAAGACTGG + Intronic
962953741 3:140245132-140245154 ATAACCACGTGTTCCAGGGCTGG + Intronic
963420331 3:145053712-145053734 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
963462408 3:145633408-145633430 GGAGTCTGATGTTCAAGGGCGGG - Intergenic
963660944 3:148128609-148128631 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
963661740 3:148135057-148135079 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
963969980 3:151419358-151419380 GGAGTCCGGTGTTTGAGGGCAGG + Intronic
964076431 3:152698255-152698277 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
964908240 3:161744666-161744688 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
964977641 3:162639510-162639532 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
965071108 3:163916474-163916496 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
965071322 3:163918285-163918307 GGAATCTGATGTTCCAGGGCAGG - Intergenic
965138453 3:164804768-164804790 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
965219766 3:165913964-165913986 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
965291433 3:166886959-166886981 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
965461047 3:168963737-168963759 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
965958065 3:174395864-174395886 GGAGTCAGATGTTCAAGGGCAGG - Intergenic
965995889 3:174883043-174883065 GGAGTCCGATGTTCAAGGGCAGG + Intronic
966191345 3:177274287-177274309 GGAGCTAGGCCTTTCAGGGCTGG + Intergenic
966219002 3:177532288-177532310 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
966221589 3:177556961-177556983 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
966262574 3:177997354-177997376 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
966272249 3:178121376-178121398 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
966287215 3:178312061-178312083 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
966446028 3:180001184-180001206 GGAGTCCGATGTTCAAGGGCAGG - Intronic
966473812 3:180322043-180322065 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
966742214 3:183244268-183244290 GGAGTCTGATGTTCCAGGGCAGG - Intronic
966925043 3:184639261-184639283 GGAGCAAGTTGCACCAGGGCTGG + Intronic
967195017 3:187018512-187018534 GGAGTCTGATGTTCGAGGGCAGG + Intronic
967764024 3:193257874-193257896 GGAGTCGGATGTTCAAGGGCAGG - Intronic
967811148 3:193762141-193762163 GGATCCAGTTATTCCAGTGCAGG - Intergenic
967841423 3:194007972-194007994 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
968519749 4:1030031-1030053 GGAGCCTTGTGTCCCAGGGCCGG - Intergenic
968559548 4:1271713-1271735 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
968577213 4:1373288-1373310 GGAGTCTGATGTTCGAGGGCAGG + Intronic
968753123 4:2400671-2400693 GGAGGCCGATGTTCCAGGGCAGG + Intronic
968810987 4:2799623-2799645 GGGGACAGCTATTCCAGGGCTGG + Intronic
969035924 4:4253725-4253747 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
969071800 4:4545601-4545623 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
969389132 4:6877608-6877630 GGAGTCCGATGTTCGAGGGCAGG + Intronic
969562812 4:7960240-7960262 GGAGCCCGGTGTTCCCTGTCGGG - Intergenic
969837971 4:9858960-9858982 GGAGTCTGATGTTCAAGGGCAGG - Intronic
969854019 4:9984755-9984777 GGAGCCAGCTGTTCAGGGGAAGG - Intronic
969874922 4:10129187-10129209 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
969966447 4:11001675-11001697 GGAGCCCAATGTTCAAGGGCAGG - Intergenic
970084648 4:12333116-12333138 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
970171510 4:13295432-13295454 GGAGCTGGGTGTTTGAGGGCAGG + Intergenic
970188251 4:13484690-13484712 GCAGCCAGGAGTTCGAGGACCGG + Intergenic
970547578 4:17145469-17145491 GGAGTCAGATGTTTGAGGGCAGG - Intergenic
970913215 4:21303662-21303684 GAAGCCAGGTTTTTCAGGGTAGG - Intronic
971126767 4:23762976-23762998 GGAGTCTGATGTTCGAGGGCAGG - Intronic
971189143 4:24410761-24410783 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
971225702 4:24749680-24749702 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
971512397 4:27443287-27443309 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
971559877 4:28064578-28064600 GGAGTCAGATGTTCGAGGGCAGG - Intergenic
971790748 4:31167341-31167363 GGAGTCTGATATTCCAGGGCAGG + Intergenic
971912041 4:32806655-32806677 GGAGTCCAGTGTTCAAGGGCAGG - Intergenic
972022412 4:34332433-34332455 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
972095811 4:35345418-35345440 GGAGTCCAGTGTTCAAGGGCAGG - Intergenic
972150522 4:36083984-36084006 GGAGTCTGATGTTCAAGGGCAGG - Intronic
972192483 4:36611795-36611817 GGAGTCAGATGTTCAAGGGCAGG - Intergenic
972266314 4:37463466-37463488 GAAGCCAAGTGTTCTAGGGGTGG + Intronic
972382651 4:38533855-38533877 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
972554885 4:40171841-40171863 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
972891955 4:43568189-43568211 GGAGTCCGATGTTCCAGGACAGG + Intergenic
972964731 4:44495416-44495438 GGAGTCCAATGTTCCAGGGCAGG + Intergenic
973092578 4:46156863-46156885 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
973317853 4:48780127-48780149 GGAGCCAGGGGCCCGAGGGCGGG - Exonic
974255787 4:59452671-59452693 GGAGTCCAGTGTTCCAGGGCAGG - Intergenic
974289882 4:59915360-59915382 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
974345780 4:60679377-60679399 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
975098395 4:70484096-70484118 GGAGTCAGATGTTCGAGAGCAGG - Intergenic
975202078 4:71602944-71602966 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
975835764 4:78421038-78421060 GGAGTCCGATGTTCAAGGGCAGG + Intronic
975934497 4:79562097-79562119 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
975983030 4:80180462-80180484 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
976033884 4:80793237-80793259 GGAGTCTGATGTTCAAGGGCAGG + Intronic
976284726 4:83360506-83360528 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
976354610 4:84102567-84102589 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
976549414 4:86377827-86377849 GGAGTCCGATGTTCGAGGGCAGG + Intronic
976788801 4:88853893-88853915 GGAGTCTGATGTTCAAGGGCAGG - Intronic
976854042 4:89581942-89581964 GGAGTCTGTTGTTCGAGGGCAGG - Intergenic
977265296 4:94846562-94846584 GGAGTCCGATGTTCAAGGGCAGG - Intronic
977387518 4:96361576-96361598 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
977651915 4:99479959-99479981 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
977758149 4:100698253-100698275 GGAGTCTGATGTTCAAGGGCAGG + Intronic
978062610 4:104356428-104356450 GGAGCCTTGTGTTTGAGGGCAGG - Intergenic
978090163 4:104706281-104706303 GGAGCCAAGTGTTCCAGCAGAGG + Intergenic
978335911 4:107668649-107668671 GGAGTCTGATGTTCGAGGGCAGG - Intronic
978341242 4:107722952-107722974 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
978702108 4:111660069-111660091 GGAGCCCGCTGTCCAAGGGCGGG - Intergenic
979026443 4:115583547-115583569 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
979160883 4:117459671-117459693 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
979398595 4:120219821-120219843 GGAGGCCAATGTTCCAGGGCAGG - Intergenic
979699654 4:123653750-123653772 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
979883117 4:125987518-125987540 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
980322580 4:131298033-131298055 GGAGACTGATGTTCGAGGGCAGG - Intergenic
980346468 4:131627992-131628014 GAAGTCAGATGTTCAAGGGCAGG - Intergenic
980475152 4:133304744-133304766 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
980628243 4:135404205-135404227 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
980763390 4:137266582-137266604 GGAGTCTGATGTTCCAGAGCAGG - Intergenic
980792155 4:137633515-137633537 GGAGCCTGATGTTCAAGGGCAGG - Intergenic
980854727 4:138425398-138425420 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
980879165 4:138691989-138692011 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
980936208 4:139228016-139228038 GGAGGCAGTGGTTACAGGGCTGG + Intergenic
981535254 4:145793453-145793475 GGAGTCTGATGTTCAAGGGCAGG + Intronic
981676406 4:147348063-147348085 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
981873866 4:149517820-149517842 GGAGTCTGGTGTTCCAGGGCAGG - Intergenic
981882081 4:149626258-149626280 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
982162536 4:152584575-152584597 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
982222852 4:153139815-153139837 GGAGCCTGATGTTCGAGGGCAGG - Intergenic
982265738 4:153536868-153536890 GGAGTCTGATGTTCCAGGGCAGG + Intronic
982481854 4:155921791-155921813 GGAGTCTGTTATTCCAGGGCAGG + Intergenic
982913497 4:161175575-161175597 GGAGTCTGCTGTTCTAGGGCAGG - Intergenic
982945418 4:161616420-161616442 GGAGTCTGGTGTTCAAAGGCAGG - Intronic
983049131 4:163023536-163023558 GGAGTCCAGTGTTCGAGGGCAGG - Intergenic
983050735 4:163044311-163044333 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
983284920 4:165727265-165727287 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
983459048 4:168004179-168004201 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
984103738 4:175518094-175518116 AGAGCCTGATGTTCAAGGGCAGG - Intergenic
984400711 4:179260626-179260648 GGAGTCTGGTGTTCAAGGGTAGG - Intergenic
984403660 4:179299644-179299666 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
984436635 4:179718391-179718413 GGAGGCTGATGTTCAAGGGCAGG + Intergenic
984713842 4:182907901-182907923 GGAGCCAAGGGTTCCAGGTTTGG - Intronic
984786433 4:183571681-183571703 GAACCCAGGTGTTCCAAGGTAGG - Intergenic
984876577 4:184373504-184373526 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
984924664 4:184796208-184796230 GGAGTCTGATGTTCGAGGGCAGG - Intronic
985037134 4:185851795-185851817 GGAGTCTGATGTTCGAGGGCAGG - Intronic
985191725 4:187381854-187381876 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
985830651 5:2226925-2226947 GGAGTCCAGTGTTCAAGGGCAGG - Intergenic
986040198 5:3986767-3986789 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
986147312 5:5090647-5090669 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
986181097 5:5393563-5393585 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
986356375 5:6931371-6931393 GGAGTCCGATGTTCTAGGGCAGG - Intergenic
986421731 5:7591696-7591718 AGAGCCAGATGTTCCAGCTCTGG + Intronic
986547303 5:8912423-8912445 GCAGCCTGATGTTCTAGGGCAGG + Intergenic
986743279 5:10722354-10722376 GGAGTCCGATGTTCGAGGGCAGG - Intronic
986927375 5:12772614-12772636 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
987059925 5:14232906-14232928 GGAGCTGGGGGTGCCAGGGCAGG + Intronic
987125173 5:14805239-14805261 GGAGTCTGATGTTCGAGGGCAGG - Intronic
987151673 5:15046900-15046922 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
987153907 5:15068636-15068658 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
987320571 5:16765349-16765371 GGAGTCCGATGTTCTAGGGCAGG - Intronic
987450095 5:18072531-18072553 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
987521781 5:18994725-18994747 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
987664263 5:20916207-20916229 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
987668688 5:20980613-20980635 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
987731052 5:21773470-21773492 GGAGTCTGATGTTCGAGGGCAGG - Intronic
987781013 5:22435262-22435284 GGAGTCCGATGTTCGAGGGCAGG - Intronic
987920304 5:24271751-24271773 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
988056786 5:26107478-26107500 GGAGTCCGATGTCCCAGGGCAGG + Intergenic
988185400 5:27854567-27854589 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
988229080 5:28450736-28450758 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
988232692 5:28501534-28501556 GGAGTCTGATGTTCCAGGGAAGG + Intergenic
988304257 5:29474264-29474286 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
988361060 5:30237133-30237155 GGAGCCTTATGTTCGAGGGCAGG - Intergenic
988565593 5:32317904-32317926 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
988758422 5:34285992-34286014 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
988770490 5:34427853-34427875 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
988858350 5:35251466-35251488 GGAGTCCAGTGTTTCAGGGCAGG - Intergenic
988882313 5:35516827-35516849 GGAGCCAGTTTTTCCATGGAAGG - Intergenic
989044824 5:37264677-37264699 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
989097345 5:37793558-37793580 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
989757318 5:44971069-44971091 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
990078799 5:51886273-51886295 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
990181213 5:53162757-53162779 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
990221129 5:53589858-53589880 GGAGTCTGATGTTCAAGGGCAGG - Intronic
990544048 5:56804438-56804460 AGAGTCAGGAGTTCCAGGCCAGG - Intergenic
991033893 5:62108522-62108544 GGAGCCCGATGTTTGAGGGCAGG - Intergenic
991310499 5:65235647-65235669 GGAGTCAAATGTTCGAGGGCAGG - Intronic
992029774 5:72709441-72709463 GGAGCCCTGTGATCCTGGGCAGG - Intergenic
994440583 5:99798209-99798231 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
994531191 5:100973984-100974006 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
995177163 5:109192231-109192253 GGAACCAGTTATTCCAAGGCAGG + Exonic
995291595 5:110462533-110462555 GGAGTCTGATGTTCGAGGGCAGG - Intronic
995790920 5:115885447-115885469 GGAGTCTGATGTTTCAGGGCAGG + Intronic
996164615 5:120209792-120209814 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
996165421 5:120216287-120216309 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
996230310 5:121055808-121055830 GGAGCCCGATGTTTGAGGGCAGG + Intergenic
996249783 5:121315839-121315861 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
996922509 5:128785341-128785363 GGAGTCCGATGTTCGAGGGCAGG + Intronic
997385237 5:133467352-133467374 GAAGCCAGGTTTCCCACGGCTGG + Intronic
997589151 5:135062392-135062414 GCAGCCAGATGCTCCAAGGCAGG - Intronic
997653725 5:135540145-135540167 GTAGCCAGATGTTCCAAGGTGGG + Intergenic
998975589 5:147642986-147643008 GGAGTCTGATGTTCCAGGGCAGG - Intronic
999284571 5:150386563-150386585 GGAGCCAGGTGTGCTAAGTCAGG + Intronic
999576103 5:152979063-152979085 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1000223169 5:159233749-159233771 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1000240330 5:159402959-159402981 GGAGCTGGGTGGCCCAGGGCTGG + Intergenic
1000448187 5:161350812-161350834 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1000604351 5:163312422-163312444 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1000730761 5:164830924-164830946 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1000836100 5:166156088-166156110 GGAACCAGGTCTGCCAGAGCAGG + Intergenic
1001063236 5:168512643-168512665 GGAGTCAGATATTCGAGGGCAGG + Intronic
1001375280 5:171250815-171250837 GAATCCAGGTGTTCCAGTGTTGG - Intronic
1001415956 5:171545023-171545045 GGAGCAAAGTGTTCCATGCCAGG + Intergenic
1001543509 5:172555646-172555668 GGAGTCCGGTGTTCGAGGGCAGG - Intergenic
1001570518 5:172727595-172727617 GCAGCCAGGTGTGGCAGAGCAGG - Intergenic
1001924868 5:175628662-175628684 GGAGCCAGGGTTTCCGGGTCTGG - Intergenic
1001992932 5:176133040-176133062 GGAGCTAGGTGCTCCGGGGCTGG + Intergenic
1002027911 5:176407947-176407969 GAAGCCAGCTCCTCCAGGGCGGG + Intronic
1002164545 5:177336316-177336338 GGAGCCAGAGGTGGCAGGGCTGG + Intronic
1002173096 5:177386129-177386151 GAAGCCAGGTGGGCCTGGGCTGG + Exonic
1002458841 5:179362401-179362423 GGAGCCAGGTGATGGAGGGTGGG + Intergenic
1002792926 6:448868-448890 TGAGCCACGTGTGGCAGGGCTGG - Intergenic
1002938170 6:1692118-1692140 GGAGTCTGATGTTCCAGGGCAGG - Intronic
1002988675 6:2217193-2217215 GCAGCCAGGTGTCCCAGTGTGGG - Intronic
1002998315 6:2307380-2307402 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1003299101 6:4860769-4860791 GGAGTCCGATGTTCAAGGGCAGG + Intronic
1003695558 6:8403548-8403570 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
1003758939 6:9152680-9152702 GGAGTCTGATATTCCAGGGCAGG - Intergenic
1003761098 6:9179938-9179960 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1004107979 6:12684080-12684102 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1004256597 6:14070068-14070090 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1005173222 6:23012265-23012287 GGAATCCGATGTTCCAGGGCAGG - Intergenic
1005178179 6:23071960-23071982 GGGGTCTGATGTTCCAGGGCAGG + Intergenic
1005265685 6:24109844-24109866 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1006114348 6:31767335-31767357 GGAGGGAGGTGTTCCTGGGAAGG - Intronic
1006374056 6:33662259-33662281 GGAGAGAGGTGGTCCAGGGTGGG + Intronic
1007222228 6:40287814-40287836 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1007637134 6:43306371-43306393 GGAGGGAGGTGATCCAAGGCAGG - Intronic
1008340196 6:50355078-50355100 GGAGCCTGATGTTTGAGGGCAGG - Intergenic
1008390654 6:50947611-50947633 GGAGTCTGATGTTCCAGGGCGGG + Intergenic
1008996270 6:57663083-57663105 GGAGTCTGATGTTTCAGGGCAGG - Intergenic
1009021191 6:57949552-57949574 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1009184789 6:60561865-60561887 GGAGTCTGATGTTTCAGGGCAGG - Intergenic
1009348899 6:62650040-62650062 GGAGCTTGATGTTCAAGGGCAGG - Intergenic
1009806046 6:68603250-68603272 GGAGTCTGGTGTTTGAGGGCAGG - Intergenic
1009806806 6:68609561-68609583 GGAGACTGATGTTCAAGGGCAGG - Intergenic
1009852074 6:69210278-69210300 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1009986031 6:70782564-70782586 GGAGTCCGATGTTTCAGGGCAGG - Intronic
1010107627 6:72187986-72188008 GCAGTCAGGTGTTGGAGGGCAGG + Intronic
1010291812 6:74146435-74146457 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1010325943 6:74562018-74562040 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1010542011 6:77103287-77103309 GGAGTCTGATGTTCAAGGGCGGG - Intergenic
1010831763 6:80540072-80540094 GGAGGCTGATGTTCAAGGGCAGG + Intergenic
1011227972 6:85128565-85128587 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1011662300 6:89604966-89604988 GAAGGCAGGAGTTCCAGGGAGGG - Intronic
1011752334 6:90465724-90465746 GGAGTCCGATGTTTCAGGGCAGG + Intergenic
1012071812 6:94630039-94630061 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1012416707 6:99020682-99020704 GGAGTCAAGTGTTCAAGGCCAGG + Intergenic
1012870544 6:104668100-104668122 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1012965460 6:105668646-105668668 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1013038657 6:106411841-106411863 GGAGTCAGATGTCCAAGGGCAGG + Intergenic
1013116236 6:107105786-107105808 GGGGCCAGGTCTTCCTGGACTGG - Intronic
1013305372 6:108842444-108842466 GGAGTCCGATGTTCCAGGGCAGG - Intergenic
1013887506 6:114988069-114988091 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1013953055 6:115808190-115808212 GGACACAGCTGTTCCAAGGCAGG + Intergenic
1014220476 6:118794132-118794154 GGAGTCCAGTGTTCTAGGGCAGG - Intergenic
1014222856 6:118815822-118815844 AGAGACAGGTGTTCCATGGAGGG - Exonic
1014498967 6:122163071-122163093 GGAGCCTGATGTTCAAGGGCAGG + Intergenic
1014521987 6:122455470-122455492 GGAGCCTGATGTTCAAGGGCAGG - Intronic
1014700951 6:124687002-124687024 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1014860714 6:126464585-126464607 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1014926536 6:127277601-127277623 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1014969818 6:127800784-127800806 GGAGTCCGATGTTCAAGGGCAGG - Intronic
1014983002 6:127967224-127967246 GGAGTCAGATGTTCAAGGGCAGG - Intergenic
1015022071 6:128488183-128488205 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1015205275 6:130631052-130631074 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1015442941 6:133269940-133269962 GGAGCCTGATGTTCAAGGACAGG + Intronic
1015470403 6:133599106-133599128 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
1015676520 6:135756024-135756046 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1015967048 6:138704685-138704707 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1016575933 6:145569977-145569999 GGAGCCCGATGTTCGAGGGCAGG + Intronic
1016657584 6:146539662-146539684 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1016856554 6:148676518-148676540 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1016857853 6:148689105-148689127 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1017043702 6:150327756-150327778 TGAGCCAGGGCCTCCAGGGCAGG - Intergenic
1017220463 6:151960369-151960391 GGAGACAGCAGTGCCAGGGCAGG + Intronic
1017395844 6:153999180-153999202 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1017461623 6:154656342-154656364 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1017475117 6:154782734-154782756 GGAGTCCAGTGTTCGAGGGCAGG + Intronic
1017564347 6:155668077-155668099 GGAGTCAGATGTTCAAGGGCAGG - Intergenic
1018113886 6:160564416-160564438 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1018190756 6:161307389-161307411 GGAGTTTGATGTTCCAGGGCAGG + Intergenic
1018208328 6:161456331-161456353 GGAGTCTGATGTTCCAGGGCAGG - Intronic
1018278265 6:162156515-162156537 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1018382473 6:163271120-163271142 GGAGTCTGATGTTCTAGGGCAGG + Intronic
1018425579 6:163677477-163677499 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1018530232 6:164755241-164755263 GGACTCTGATGTTCCAGGGCAGG - Intergenic
1018537003 6:164831378-164831400 GGAGTCTGATGTTCCAGGTCAGG - Intergenic
1018599423 6:165524067-165524089 GGAGTCTGATGTTGCAGGGCAGG - Intronic
1018600226 6:165530130-165530152 GGAGTCCCATGTTCCAGGGCAGG - Intronic
1018645430 6:165943574-165943596 AGAACCTGGTGTTCCAGGGCCGG + Intronic
1018654016 6:166015258-166015280 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1019003150 6:168772388-168772410 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1019020274 6:168912197-168912219 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1019045055 6:169139469-169139491 GGCGCCAGGGGAACCAGGGCCGG + Intergenic
1019093987 6:169564186-169564208 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1019256031 7:51789-51811 GGAGTCCGGTATTCAAGGGCAGG + Intergenic
1019312575 7:369854-369876 GGAGTCAGGTGGGCCCGGGCTGG - Intergenic
1019913216 7:4114239-4114261 GGAGCGAGGTGGTGCGGGGCCGG + Exonic
1019942471 7:4302321-4302343 AGAGCCAGCTGCTCCAGGCCGGG - Intergenic
1020040345 7:4996665-4996687 GGAGGCAGGTGTGCAAGGCCTGG - Intronic
1020567449 7:9816228-9816250 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1020612626 7:10419387-10419409 GGAGCAAGGTGTCACAGGGAGGG - Intergenic
1020623723 7:10551206-10551228 GGAGTCTGGTGTTCCAGGGCAGG - Intergenic
1020709889 7:11594155-11594177 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1020883509 7:13793627-13793649 GGAGCCTGATGTTCAAAGGCAGG + Intergenic
1020978157 7:15033481-15033503 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1021646139 7:22791384-22791406 GAAGCCAGGTGCTGCAGAGCAGG + Intergenic
1022001153 7:26227542-26227564 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1022078456 7:26996893-26996915 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1022079869 7:27009133-27009155 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1022471700 7:30685557-30685579 GGAGACAGGGGTCCCAGGCCAGG + Intronic
1022866636 7:34428487-34428509 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1022914437 7:34933715-34933737 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1022979268 7:35588805-35588827 GGAGCCTGATGTCCAAGGGCAGG - Intergenic
1023304912 7:38815789-38815811 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1023374746 7:39544846-39544868 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1023576845 7:41636898-41636920 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1024185265 7:46942524-46942546 GGAGCCAGCTCTTCCAGGAGAGG + Intergenic
1024715289 7:52073024-52073046 GGAGCCAGGCTATCCAGTGCAGG - Intergenic
1024725163 7:52185830-52185852 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1024744582 7:52391354-52391376 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1025030393 7:55552085-55552107 GGAGCCAGGTTAGCCAGGTCAGG + Intronic
1025660551 7:63555769-63555791 GGGGACGGGTGTTCCTGGGCGGG - Intergenic
1025995595 7:66525398-66525420 GGAGGCAGTTGTCCCAGGGCAGG + Intergenic
1026046152 7:66906555-66906577 GGAGTCCGATGTTCTAGGGCAGG + Intergenic
1026080605 7:67215772-67215794 GGAGTCCGATGTTCGAGGGCAGG + Intronic
1026104706 7:67411584-67411606 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1026165326 7:67904134-67904156 GGAGCCTGATGTCCAAGGGCAGG + Intergenic
1026181241 7:68042780-68042802 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1026181345 7:68043820-68043842 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1026507894 7:71002220-71002242 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1026559188 7:71434020-71434042 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1026613432 7:71881115-71881137 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1026696485 7:72598257-72598279 GGAGTCCGATGTTCGAGGGCAGG - Intronic
1026897071 7:74015518-74015540 TGAGCCAGCTGTTCCTGGGGTGG - Intergenic
1026972666 7:74477680-74477702 GAGGACAGGTGTCCCAGGGCAGG - Intronic
1026987252 7:74562264-74562286 GGAGGCAGGTGTCCCAGGGCAGG + Intronic
1027347039 7:77271340-77271362 GGAGTCCGATGTTCGAGGGCAGG - Intronic
1027407241 7:77874517-77874539 GGAATCCGCTGTTCCAGGGCAGG + Intronic
1027655757 7:80929427-80929449 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1027807867 7:82852484-82852506 GGAGTCTGATGTTCTAGGGCAGG - Intronic
1028244046 7:88454491-88454513 GAAGCCAGGAGTTCCAGACCAGG - Intergenic
1028269112 7:88766096-88766118 GAAGCCAGGTGTTCTAGACCAGG + Intronic
1028669717 7:93387515-93387537 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1028710485 7:93902196-93902218 GAAGTCAGGTGTTCAAGGGCAGG + Intronic
1029257038 7:99276514-99276536 GGAGCCTGGCGCTCCAGTGCAGG + Intergenic
1029612153 7:101632247-101632269 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1030355742 7:108540101-108540123 GGAGTCTGATGTTCCAGGGCAGG - Intronic
1030360192 7:108587545-108587567 GGAGTCTTATGTTCCAGGGCAGG + Intergenic
1030406005 7:109114430-109114452 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1030511886 7:110492902-110492924 GAACCCAGGTGTTGCAGGGTAGG + Intergenic
1030532706 7:110730362-110730384 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1030784891 7:113646821-113646843 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1030810946 7:113971352-113971374 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1031441016 7:121794595-121794617 GGAGTCCAATGTTCCAGGGCAGG - Intergenic
1031861480 7:126984527-126984549 GGAGTCTGGTGTTCAAGGGCAGG - Intronic
1031922366 7:127611621-127611643 GGACCCAGTGGTTCCAGGGCAGG + Exonic
1031940385 7:127782668-127782690 GGAGCCAAGTGTTCCAAGTAAGG - Intronic
1032027628 7:128456086-128456108 GCAGCCTCGCGTTCCAGGGCTGG + Intronic
1032337013 7:131034679-131034701 GGTGCCACGTGTTCCCTGGCTGG - Intergenic
1032923837 7:136579218-136579240 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1033290848 7:140081533-140081555 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1033422911 7:141218715-141218737 GGACCCTGGGGTTCAAGGGCAGG - Intronic
1033487939 7:141809865-141809887 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1034082380 7:148291428-148291450 GGAGTCCAATGTTCCAGGGCAGG + Intronic
1034115618 7:148581266-148581288 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1034119020 7:148610434-148610456 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1034170348 7:149058127-149058149 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1034945674 7:155260282-155260304 GGACCCAGGTTCTCCTGGGCTGG - Intergenic
1034986090 7:155516423-155516445 GGACCCCAGTGTTTCAGGGCTGG + Intronic
1034986271 7:155517334-155517356 GGATCAAGGTGTCTCAGGGCTGG - Intronic
1035188635 7:157145565-157145587 GTTGCCAGGTGTTACAGGGATGG - Intronic
1035216683 7:157372786-157372808 AGACCCAGGTATTGCAGGGCTGG + Intronic
1035523141 8:291211-291233 AGAGCAAGGTGTGGCAGGGCTGG - Intergenic
1035673262 8:1436310-1436332 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1035777140 8:2196711-2196733 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1035793536 8:2331342-2331364 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1035799267 8:2390363-2390385 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1036403445 8:8431561-8431583 GGAGTCCAGTGTTCCAGGGCAGG - Intergenic
1036491379 8:9229199-9229221 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1037186157 8:16065869-16065891 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1037262739 8:17026980-17027002 GTAGCCAGGTGTCGCCGGGCTGG + Intergenic
1037563654 8:20097736-20097758 GGAGCCCGATGTTCGACGGCAGG + Intergenic
1037621859 8:20570930-20570952 GGAGTCTAGTGTTCGAGGGCAGG - Intergenic
1037669123 8:20999173-20999195 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1037695716 8:21222159-21222181 GGAGTCAGATGTTCAAGGGCAGG - Intergenic
1037836186 8:22216056-22216078 GGAACCAGATGTTCAAGGGGTGG - Intergenic
1037935541 8:22912910-22912932 GGAGCCAGGTGTGGGAAGGCAGG - Intronic
1038083391 8:24165493-24165515 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1038411952 8:27366020-27366042 TGAGGCAGGTGTGCCAGGGCTGG - Intronic
1038526586 8:28279335-28279357 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1038738989 8:30199929-30199951 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1039778234 8:40757976-40757998 GGAGTCTGATGTTCTAGGGCAGG - Intronic
1039791878 8:40882727-40882749 GGTACCAGGTGTTTCAGAGCTGG + Intronic
1040483775 8:47851527-47851549 GAAGCCAGGTGGTCCTGAGCAGG - Intronic
1040912258 8:52531024-52531046 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1040916188 8:52568295-52568317 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1041210792 8:55549113-55549135 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1042101457 8:65279667-65279689 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1042970854 8:74407511-74407533 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1043258332 8:78162768-78162790 GGAGTCCAGTGTTCCAGGGCAGG - Intergenic
1043614033 8:82103447-82103469 GGAGTCTGATATTCCAGGGCAGG - Intergenic
1043716231 8:83490315-83490337 GGAATCTGATGTTCCAGGGCAGG + Intergenic
1043742248 8:83828616-83828638 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1044147885 8:88740423-88740445 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
1044202715 8:89455081-89455103 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1044294077 8:90506803-90506825 GGAGTCCAATGTTCCAGGGCAGG - Intergenic
1044793460 8:95872069-95872091 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1045108308 8:98915303-98915325 GGAGTCCGATGTTCGAGGGCAGG - Intronic
1045128841 8:99125279-99125301 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1045212700 8:100114976-100114998 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1045711795 8:104993299-104993321 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1045800151 8:106092801-106092823 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1046657010 8:116905954-116905976 GTAGTCTGGTGTTCAAGGGCAGG - Intergenic
1046720854 8:117617462-117617484 GGAGTCTGGTCTTCAAGGGCAGG - Intergenic
1047196447 8:122726227-122726249 GGAGTCTAGTGTTCGAGGGCAGG - Intergenic
1047239477 8:123072973-123072995 GGAGCCATCTGTTCCACCGCAGG - Intronic
1047707520 8:127514603-127514625 GTAGGCAGATGTCCCAGGGCCGG - Intergenic
1047722444 8:127653604-127653626 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1048023509 8:130562802-130562824 CTAGCCAGGTGGCCCAGGGCTGG + Intergenic
1048042934 8:130748431-130748453 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1048292555 8:133191847-133191869 GAAGCCTGCTGTTCCAGGGTGGG + Intronic
1048337257 8:133512287-133512309 GGAGTCCGATGTTCGAGGGCAGG + Intronic
1048499410 8:134962070-134962092 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1048625845 8:136184179-136184201 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1048844486 8:138594056-138594078 GGAGCCAGGTCGTCCTGGGCAGG - Exonic
1048869214 8:138783415-138783437 GGAGTTCAGTGTTCCAGGGCAGG + Intronic
1048952809 8:139510152-139510174 GGAGTCAGATGTTCAAGGGCAGG + Intergenic
1049095672 8:140546866-140546888 GCATCCAGGTATTCCAGGGCAGG - Intronic
1049363620 8:142225934-142225956 GGTGCCAGGTGTTTCTAGGCTGG + Intronic
1049689912 8:143953862-143953884 GGAGCCCGGAGGTCCGGGGCAGG + Intronic
1049822608 8:144645337-144645359 AGAGCGTGGTGTCCCAGGGCTGG - Intergenic
1049857018 8:144868660-144868682 GGAGTCAGATGTTGGAGGGCAGG - Intergenic
1050378607 9:4999651-4999673 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1050493237 9:6211930-6211952 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1050658212 9:7852872-7852894 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1050975784 9:11936403-11936425 GGAGTCTGATGTTCAAGGGCGGG + Intergenic
1051299696 9:15635432-15635454 GGAGTCTGATGTTCCAGGGCAGG + Intronic
1051547478 9:18292671-18292693 GGGGTCTGATGTTCCAGGGCAGG - Intergenic
1051716599 9:19991287-19991309 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1051742454 9:20264992-20265014 AGACCCAGATGTACCAGGGCTGG - Intergenic
1051781386 9:20692113-20692135 GGAGTCAGGAGTTCAAGGGAAGG - Intronic
1051792735 9:20826352-20826374 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1052161441 9:25265114-25265136 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1052420283 9:28234639-28234661 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1052451148 9:28633030-28633052 GGAGTCCAGTGTTCAAGGGCAGG + Intronic
1052540295 9:29802908-29802930 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1052556653 9:30027236-30027258 GGAGTCCGATGTTCGAGGGCAGG + Intergenic
1052621185 9:30912272-30912294 GGAGTCCGATGTTTCAGGGCAGG + Intergenic
1052718184 9:32144317-32144339 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1052740464 9:32387294-32387316 GGAGCCAGTGGTTTCAGAGCTGG + Intronic
1052851605 9:33381606-33381628 CGAGCCAGGGGAACCAGGGCTGG - Intergenic
1053262979 9:36686825-36686847 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1053604913 9:39647974-39647996 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1053862789 9:42404324-42404346 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1054248628 9:62694441-62694463 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1054562742 9:66728967-66728989 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1055205199 9:73721698-73721720 CGAGTCTGATGTTCCAGGGCAGG - Intergenic
1055461600 9:76524844-76524866 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1055585576 9:77756101-77756123 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1055878088 9:80967130-80967152 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1055879299 9:80979488-80979510 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1055907125 9:81307892-81307914 GGAGTCTGATGTTTCAGGGCAGG + Intergenic
1056314724 9:85376724-85376746 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1056476626 9:86958987-86959009 GGAAACAGGTGTTTCAGAGCAGG - Intergenic
1056518545 9:87378301-87378323 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1056782582 9:89562311-89562333 GGACCCGGGTGTTCCAGGCTGGG - Intergenic
1056808064 9:89743992-89744014 GTAGCCAGGAGGCCCAGGGCAGG - Intergenic
1057265929 9:93617757-93617779 GGAGTCCAGTGTTCGAGGGCAGG + Intronic
1057443779 9:95099693-95099715 GCAGCCAGGGGTTCCTGGGTGGG - Exonic
1057866393 9:98685190-98685212 GGAGTCTGATGTTCTAGGGCAGG - Intronic
1058090807 9:100803513-100803535 GGAGTCTGGTGTTCGAAGGCAGG + Intergenic
1058229436 9:102407784-102407806 GTAGTCTGATGTTCCAGGGCAGG - Intergenic
1058247551 9:102646948-102646970 GGAGTCTGATATTCCAGGGCAGG - Intergenic
1058550487 9:106109752-106109774 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1059014198 9:110496429-110496451 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1059196176 9:112373305-112373327 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1059343155 9:113610946-113610968 GGATCCAGGTGTGGCAGGGTTGG + Intergenic
1059550863 9:115227531-115227553 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1059580797 9:115546393-115546415 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1059809041 9:117835625-117835647 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1060265876 9:122111221-122111243 GGTGCCAGGTGGGCCAGGGTGGG - Intergenic
1060816505 9:126638109-126638131 GGGGGCAGCAGTTCCAGGGCAGG + Intronic
1061732917 9:132630551-132630573 GAAGCCAGGAGTTTCAGGGTTGG - Intronic
1061923440 9:133794625-133794647 GGGGCCAGGTGTCAGAGGGCAGG + Intronic
1061938892 9:133873620-133873642 GAAGCCCTGTGTCCCAGGGCTGG + Intronic
1061959974 9:133982989-133983011 GGCGGCAGATGTTCCAGCGCAGG - Intronic
1062085894 9:134648158-134648180 GGAGTCCGATGTTCGAGGGCAGG - Intronic
1062128246 9:134878087-134878109 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1062156636 9:135052661-135052683 GGAGGCACGTCTTCCATGGCTGG - Intergenic
1062179249 9:135181968-135181990 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1062259356 9:135652655-135652677 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1062285189 9:135769698-135769720 TCAGCGAGGAGTTCCAGGGCGGG - Intronic
1062358734 9:136177570-136177592 GGAGCCAGGTGGGCCTGGGAAGG - Intergenic
1062540090 9:137037821-137037843 GGAGTCCGATGTTCGAGGGCAGG - Exonic
1062720521 9:138040614-138040636 GGAGTCCGATGTTCGAGGGCAGG + Intronic
1203428988 Un_GL000195v1:71589-71611 GGAGTCTGGTGTTTGAGGGCTGG - Intergenic
1185519353 X:726299-726321 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1185545946 X:944342-944364 GCAGTCAGATGTTCGAGGGCAGG - Intergenic
1185622513 X:1461297-1461319 GGAGTCAGATGTTCAAGGGCAGG - Intergenic
1185652217 X:1656192-1656214 GGAGTCCAGTGGTCCAGGGCAGG - Intergenic
1185721660 X:2387469-2387491 GGAGTCCAGTTTTCCAGGGCAGG + Intronic
1185742484 X:2544954-2544976 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1185826599 X:3257103-3257125 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1186032443 X:5384511-5384533 GGAGTCCGATGTTCAAGGGCGGG + Intergenic
1186129952 X:6455748-6455770 GGAGCCTGATGTTCGAGGGCAGG + Intergenic
1186151268 X:6677010-6677032 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1186183209 X:6992953-6992975 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1186288243 X:8068861-8068883 GGAGTCTGGTGTCCAAGGGCAGG - Intergenic
1186304590 X:8241960-8241982 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1186334800 X:8574630-8574652 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1186549598 X:10488842-10488864 GGAGTCCGATGTTCGAGGGCAGG - Intronic
1186789836 X:12986179-12986201 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1186939013 X:14483968-14483990 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1188012579 X:25073500-25073522 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1188982286 X:36737419-36737441 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1189348199 X:40258421-40258443 GAAGCCAAGTGTTGCAGGGAGGG - Intergenic
1189938623 X:46097198-46097220 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1190461697 X:50683035-50683057 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1190524684 X:51316966-51316988 GGAGTTTGATGTTCCAGGGCAGG - Intergenic
1190545586 X:51523048-51523070 GGAGTTTGATGTTCCAGGGCAGG + Intergenic
1190578524 X:51867443-51867465 GGAGTCTGATGTTCAAGGGCAGG + Intronic
1190618670 X:52263914-52263936 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1190679026 X:52808659-52808681 GGAGTCTGTTGTTCGAGGGCAGG - Intergenic
1190793275 X:53719741-53719763 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1190996418 X:55614869-55614891 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1190996995 X:55619384-55619406 GGAGTCTGATGTTCTAGGGCAGG + Intergenic
1191095416 X:56668593-56668615 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1191226149 X:58045180-58045202 GGGGTCTGGTGTTCAAGGGCAGG - Intergenic
1191659236 X:63633462-63633484 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1191718922 X:64213110-64213132 GGAGTCTGATGTTCTAGGGCAGG + Intergenic
1191769907 X:64743572-64743594 GGAGTCCAGTGTTCAAGGGCAGG + Intergenic
1192204722 X:69088374-69088396 CCAGCCAGCTGTCCCAGGGCAGG - Intergenic
1192298148 X:69871456-69871478 GGAGTCCAGTGTTCGAGGGCAGG + Intronic
1192592364 X:72370758-72370780 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1193053826 X:77128373-77128395 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1193121076 X:77823564-77823586 GGAGTCCAATGTTCCAGGGCAGG - Intergenic
1193156058 X:78175625-78175647 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1193324566 X:80164726-80164748 GGAGTCTGATGTTCCAGAGCAGG + Intergenic
1193433303 X:81438899-81438921 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
1193450180 X:81655782-81655804 GGAGTCCGATGTTCCAGAGCAGG + Intergenic
1193568521 X:83111270-83111292 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1193573388 X:83172572-83172594 GGAGTCAGTTGTTCAAGGGCAGG + Intergenic
1193792908 X:85838094-85838116 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1193841232 X:86411160-86411182 GGAGTCCGATGTTCGAGGGCAGG + Intronic
1193914495 X:87349338-87349360 GGAGTCTGATGTTCCAGGGCAGG + Intergenic
1194071851 X:89334567-89334589 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1194198504 X:90926416-90926438 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1194209871 X:91059099-91059121 GGAGCCTGTTGTTGGAGGGCAGG - Intergenic
1194230305 X:91314441-91314463 GGAGTCTGATGTTCTAGGGCAGG + Intergenic
1194343614 X:92733694-92733716 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1194433425 X:93839436-93839458 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1194443161 X:93957573-93957595 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1194443846 X:93963716-93963738 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1194531265 X:95052011-95052033 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1194584194 X:95713341-95713363 GGAGTCTAATGTTCCAGGGCAGG - Intergenic
1194833501 X:98655319-98655341 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1194991022 X:100547052-100547074 GTATCCAGGTGTTCCAGTGTTGG - Intergenic
1195156276 X:102126599-102126621 TGAGCCAGCTGTTCCCTGGCAGG - Intronic
1195271659 X:103237133-103237155 GGAGTCCAGTGTTCGAGGGCAGG + Intergenic
1195321440 X:103724783-103724805 GGAGGCTGGAGGTCCAGGGCTGG - Intronic
1195413008 X:104589301-104589323 GGAGTCTGATGTTCGAGGGCAGG + Intronic
1195547338 X:106127076-106127098 GGAGCCCGATGTTCGAGGGCCGG + Intergenic
1195606444 X:106810781-106810803 GGACCAAGATGTTCCAGGGAGGG - Intronic
1195850465 X:109277026-109277048 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1195999690 X:110768636-110768658 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1196758315 X:119177410-119177432 GGACCCAGGGTTTCAAGGGCAGG + Intergenic
1196865059 X:120063596-120063618 GGAGTCCGATGTTCAAGGGCAGG - Intergenic
1196878042 X:120172736-120172758 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1196917026 X:120547893-120547915 GGAGTCTGATGTTCGAGGGCAGG - Intronic
1197075895 X:122351712-122351734 GGAGCCTGATGTTCAAAGGCAGG - Intergenic
1197380358 X:125730999-125731021 GGAGTCAGATGTTCAAGGGCAGG + Intergenic
1197385412 X:125795667-125795689 GGAGCCTGATGTTCAAGGGTAGG - Intergenic
1197477812 X:126945238-126945260 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1197633261 X:128886517-128886539 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1197679795 X:129370122-129370144 GGAGTCCGATGTTCGAGGGCAGG - Intergenic
1198109037 X:133486664-133486686 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1198132777 X:133715209-133715231 GGAGTCTGATGTTCAAGGGCAGG - Intronic
1198307248 X:135395359-135395381 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1198540412 X:137632839-137632861 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1198565184 X:137896879-137896901 GGAGCCTGATGTTCGAGGGCAGG - Intergenic
1198615314 X:138452235-138452257 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1198700824 X:139396485-139396507 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1199068737 X:143451420-143451442 GGAGTCTGATGTTCAAGGGCAGG - Intergenic
1199087178 X:143640987-143641009 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1199163925 X:144647921-144647943 GGAGTCCAATGTTCCAGGGCAGG + Intergenic
1199613584 X:149637745-149637767 GGAGACCGATGTTCAAGGGCAGG + Intergenic
1199634840 X:149805306-149805328 GCCCCCAGGTGGTCCAGGGCTGG - Intergenic
1199676122 X:150190620-150190642 GCAGCCATGTGTCCAAGGGCAGG - Intergenic
1199784858 X:151095999-151096021 GGAGTCCGATGTTCAAGGGCAGG + Intergenic
1200543236 Y:4486412-4486434 GGAGTCTGATGTTCGAGGGCAGG - Intergenic
1200726097 Y:6670295-6670317 GGAGTCTGATGTTCAAGGGCAGG + Intergenic
1201301860 Y:12512372-12512394 GGAGTCTGATGTTCCAGGGCAGG - Intergenic
1201428697 Y:13883616-13883638 GGAGTCTGATGTTCGAGGGCAGG + Intergenic
1201497051 Y:14599348-14599370 GGAGTCTGATGTTCCAGGGCAGG + Intronic