ID: 1145959478

View in Genome Browser
Species Human (GRCh38)
Location 17:28879123-28879145
Sequence GAGCCAGGTGTTCCAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 345}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145959468_1145959478 0 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959478 17:28879123-28879145 GAGCCAGGTGTTCCAGGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 345
1145959471_1145959478 -4 Left 1145959471 17:28879104-28879126 CCACCTTCTGCCTGTGATGGAGC No data
Right 1145959478 17:28879123-28879145 GAGCCAGGTGTTCCAGGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 345
1145959465_1145959478 11 Left 1145959465 17:28879089-28879111 CCCTGCTAGTCCCCTCCACCTTC No data
Right 1145959478 17:28879123-28879145 GAGCCAGGTGTTCCAGGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 345
1145959467_1145959478 1 Left 1145959467 17:28879099-28879121 CCCCTCCACCTTCTGCCTGTGAT No data
Right 1145959478 17:28879123-28879145 GAGCCAGGTGTTCCAGGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 345
1145959466_1145959478 10 Left 1145959466 17:28879090-28879112 CCTGCTAGTCCCCTCCACCTTCT No data
Right 1145959478 17:28879123-28879145 GAGCCAGGTGTTCCAGGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 345
1145959472_1145959478 -7 Left 1145959472 17:28879107-28879129 CCTTCTGCCTGTGATGGAGCCAG No data
Right 1145959478 17:28879123-28879145 GAGCCAGGTGTTCCAGGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 345
1145959469_1145959478 -1 Left 1145959469 17:28879101-28879123 CCTCCACCTTCTGCCTGTGATGG No data
Right 1145959478 17:28879123-28879145 GAGCCAGGTGTTCCAGGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145959478 Original CRISPR GAGCCAGGTGTTCCAGGGCT GGG Intergenic
900164548 1:1239530-1239552 GAGCCAGGGGAGGCAGGGCTGGG - Intergenic
900252173 1:1676657-1676679 GAACCAGCTCTTCCAGTGCTGGG + Exonic
900262583 1:1739515-1739537 GAACCAGCTCTTCCAGTGCTGGG + Exonic
900366243 1:2313041-2313063 GGGCCACCTGCTCCAGGGCTGGG - Intergenic
900394176 1:2446385-2446407 TAGCCAGGTCTCCCGGGGCTGGG + Intronic
900786421 1:4653347-4653369 GAGCCAGGAGGACCATGGCTTGG - Intergenic
901066221 1:6495983-6496005 GATCCTGGAGTGCCAGGGCTTGG - Intronic
901654504 1:10761788-10761810 GAGGCCGGGCTTCCAGGGCTGGG - Intronic
901829088 1:11881250-11881272 GAGCCAGATGTTGCAGAGCTGGG + Intergenic
902209622 1:14895242-14895264 GAGCCAGGGGAACCAGGGCTGGG - Intronic
902285388 1:15405125-15405147 AAGTCAGGTGTCCCTGGGCTAGG + Intergenic
902876930 1:19345960-19345982 GAGCCAGCTCTTCCTGGGCTTGG - Intronic
903029417 1:20452205-20452227 GGGACAGGAGTTCCAGAGCTTGG + Intergenic
903029743 1:20455197-20455219 GTGCCAGGTGTTCCCGTTCTGGG + Intergenic
903121084 1:21217559-21217581 CAGGCAGGTGTCCTAGGGCTGGG - Intronic
903155701 1:21440810-21440832 AAGCCAGGTGTGCCAGGTCCAGG + Intronic
903187752 1:21638899-21638921 GAGCCAGGCGTCACAGAGCTGGG + Intronic
903218078 1:21854165-21854187 GAGCCAGGTGTGGCTGGGCCGGG - Intronic
903329538 1:22590209-22590231 GAGACAGGTGGGCCAGGGCTGGG - Intronic
904187897 1:28720287-28720309 AAGAAAGGTGTTCCAGGACTTGG - Intergenic
904328339 1:29741965-29741987 CATCCAGGTCCTCCAGGGCTGGG - Intergenic
908827344 1:68146468-68146490 GAATCAGATATTCCAGGGCTAGG + Intronic
909051527 1:70773944-70773966 TAGGCAGGTGTTCCAGGCCTAGG - Intergenic
909253310 1:73385684-73385706 TAGCCAGATGTTCCAAGGCATGG + Intergenic
910479963 1:87647740-87647762 GTGACAGGTGGTCCAGGCCTAGG + Intergenic
911203694 1:95071676-95071698 CAGCCAGGGTTTCGAGGGCTGGG - Intronic
912451544 1:109770544-109770566 CACCCAGGGGATCCAGGGCTGGG - Intronic
912740058 1:112186271-112186293 GAGGCAGCTCTTCCAGAGCTGGG + Intergenic
913994695 1:143642751-143642773 AAGCCAGGTGTACCAGGTCCAGG - Intergenic
914361507 1:146939440-146939462 AAGCCAGGTGTGCCAGGTCCAGG + Intronic
914407369 1:147389543-147389565 GTTCCAGGTGTTCCAAGCCTTGG - Intergenic
914491099 1:148151267-148151289 AAGCCAGGTGTGCCAGGTCCAGG - Intronic
916206996 1:162324861-162324883 AAGCCTGGGATTCCAGGGCTGGG - Intronic
920453674 1:206080702-206080724 GGGCCACATGTCCCAGGGCTTGG + Intronic
920508385 1:206533079-206533101 GACACAGGAGTTCCATGGCTAGG - Intronic
920513880 1:206569878-206569900 GAGCCTGGTCTTGGAGGGCTTGG + Intronic
922149589 1:222986846-222986868 AAGCCAGGTGTTACAGAGGTGGG + Intronic
922211535 1:223490366-223490388 GAGCCAGGAGGCCAAGGGCTGGG - Intergenic
922251564 1:223853835-223853857 GAGACAGGCATTCAAGGGCTTGG - Intergenic
922555662 1:226530211-226530233 GGGTCAGGGGTCCCAGGGCTGGG + Intergenic
922695333 1:227728478-227728500 GAGCCAGGTGGGGCGGGGCTGGG - Intergenic
922803700 1:228375319-228375341 GGGCCAGGGGTCCCAGAGCTAGG - Intronic
922803957 1:228376286-228376308 GAGACAGCTGCTCCTGGGCTTGG + Intronic
924105463 1:240644867-240644889 GAGCCAGGAGTCACAGGTCTGGG + Intergenic
924201929 1:241669247-241669269 GAGTCAGGTGGTCCAGGGTCAGG - Intronic
924225896 1:241921364-241921386 TAGCCAGTTGTGCCTGGGCTTGG + Intergenic
924379432 1:243448215-243448237 GAAACAGGTCCTCCAGGGCTTGG + Intronic
1064018049 10:11787937-11787959 GAGCCAGGTGCACCTGGGCAGGG - Intergenic
1068060757 10:52064625-52064647 GAGCCCTGTCTTCCAGGGCAAGG - Intronic
1068663734 10:59650153-59650175 GAACCAGGAGTTCCAGTACTGGG - Intergenic
1069489019 10:68845562-68845584 TAGCCAGGTGTTGCCGGGCGCGG - Intronic
1070270193 10:74946373-74946395 GACCCAGGTGTTCCACTCCTAGG + Intronic
1070666806 10:78350744-78350766 TAGCAAGGCCTTCCAGGGCTTGG - Intergenic
1071564020 10:86662399-86662421 GCGCCAGGAGTCCCTGGGCTCGG + Exonic
1072842417 10:98789127-98789149 CAGCCCGGTGATACAGGGCTTGG + Intronic
1073900671 10:108216675-108216697 CAGCCAGGTGTTCAGGGGTTTGG - Intergenic
1075057978 10:119234050-119234072 TAGCCAGCTGCTCTAGGGCTGGG + Intronic
1075340595 10:121644416-121644438 GGGCCAGGTGACCCAGGGATGGG + Intergenic
1075674464 10:124286802-124286824 GATCCAGGTGTTCCAGTGATGGG + Intergenic
1076144164 10:128103799-128103821 CGGCCAGGTCTTCCAGGGGTTGG + Exonic
1076144598 10:128107435-128107457 CAGCCAGGTCTTCTAGGGGTTGG + Exonic
1076415035 10:130279950-130279972 AAGCCAGGGGTTCCAACGCTGGG + Intergenic
1076744006 10:132503772-132503794 GAGACAGGAGTCCCAGGCCTTGG - Intergenic
1076771637 10:132669319-132669341 GCGCCAGGTGTTGCCGGGCCAGG + Intronic
1076915699 10:133422275-133422297 GAAGCAGCTGTTCCAGGCCTCGG - Exonic
1077046657 11:549698-549720 AAGCCAGGCCCTCCAGGGCTTGG + Intronic
1077047736 11:553783-553805 GAGTCAGGGGTCACAGGGCTGGG + Intronic
1077181477 11:1219100-1219122 CAGGAAGGTGTTCCAGGCCTCGG - Intergenic
1078085965 11:8233198-8233220 GACCCTGGTGTTCCATGTCTTGG - Intronic
1078533727 11:12156698-12156720 GAGCCAGGTGTTCCTGCCCATGG + Intronic
1080562779 11:33479200-33479222 GAGCTGGGGGTTCCTGGGCTAGG + Intergenic
1082804230 11:57437304-57437326 GAGACAGCAGTTCCAGGCCTGGG - Intergenic
1083403790 11:62442939-62442961 GAGCCAGGTCTCCCAGGCTTAGG - Intronic
1083681358 11:64353294-64353316 GACCCAGGTGGTCCTGAGCTGGG + Intronic
1084710991 11:70843652-70843674 GATCAAGGTGTCGCAGGGCTGGG - Intronic
1084744018 11:71156110-71156132 GATCAAGGTGTGGCAGGGCTGGG - Intronic
1085388076 11:76168477-76168499 GAGCCATGGGAGCCAGGGCTGGG - Intergenic
1087374725 11:97326632-97326654 CAGGCAGGTCTTCCAGGCCTGGG - Intergenic
1089296974 11:117475390-117475412 GAGCCAGATGTTGCAGGGCCTGG - Intronic
1089981603 11:122777226-122777248 GAGCCAGGCTTCCCAGGGGTGGG - Intronic
1090211505 11:124923895-124923917 CAGCCAGGTGTAGCTGGGCTTGG + Exonic
1094002956 12:25716008-25716030 TTGCCAGGGCTTCCAGGGCTGGG + Intergenic
1094487722 12:30938319-30938341 GAGGCAGGTGTCCAAGGGCTGGG - Intronic
1096550732 12:52370071-52370093 GCCCCAGGTGGTCCAGGGCCAGG + Intergenic
1101749089 12:107568211-107568233 GAGCAAGCTGTTACAAGGCTTGG - Intronic
1101945675 12:109134538-109134560 GAGCCAGCTGTTTCAGGACTCGG + Intronic
1102546914 12:113664016-113664038 CAGCCAGGAGGTCCAGGGCGAGG - Intergenic
1103992709 12:124809932-124809954 CAGCCAGGTGGTGCTGGGCTGGG - Intronic
1104721529 12:131047297-131047319 GAGTCAGGTGATCCACGGCGAGG + Intronic
1105578899 13:21675523-21675545 GCGCCAGGTGTGCCAGAGCCGGG - Intronic
1106247499 13:27961917-27961939 GAGCCACGCATTCCAAGGCTGGG + Intergenic
1106286669 13:28323965-28323987 GAGCCAAATGAACCAGGGCTTGG - Intronic
1106385835 13:29284947-29284969 GAACCAGCTGTTTCAGGTCTAGG + Intronic
1112374793 13:98829352-98829374 GAGCCACGTCTTCCTGAGCTCGG + Exonic
1113491180 13:110693268-110693290 GAGCCATGTCCTCCAGGACTGGG - Intronic
1114266038 14:21073128-21073150 GGGCCAGGTGTTCCAGGTGGTGG + Exonic
1114526116 14:23367689-23367711 CAGCCAGGTCCCCCAGGGCTGGG - Intergenic
1116711585 14:48374537-48374559 AAGCCAGGTGTTTCATGGATAGG - Intergenic
1116762564 14:49032672-49032694 GTGACAGGTCTTCCAGTGCTAGG + Intergenic
1118708264 14:68499749-68499771 GCTCCAGGTGTTCCTTGGCTTGG - Intronic
1118781688 14:69012886-69012908 GTGCCAGCCGTGCCAGGGCTCGG + Intergenic
1119395959 14:74326646-74326668 GCGCCTTTTGTTCCAGGGCTTGG - Intronic
1119727190 14:76928667-76928689 GAGCCAGGTCTGGCATGGCTGGG + Intergenic
1119906403 14:78306860-78306882 GAGCAAGGTGTCAGAGGGCTGGG - Intronic
1119938696 14:78617416-78617438 CAGCCAGGCTTTCCATGGCTGGG + Intronic
1121048137 14:90802774-90802796 GAGCCGGGTGTAACAGGGCAGGG + Intronic
1122746654 14:103901072-103901094 GAGCCAGAGATTCCTGGGCTTGG + Intergenic
1122938928 14:104972642-104972664 CCGTCATGTGTTCCAGGGCTTGG - Intronic
1124360868 15:29035786-29035808 GAGCCAGAAGCTCTAGGGCTGGG + Intronic
1124625617 15:31306138-31306160 GGGGCAGGTGCCCCAGGGCTGGG - Intergenic
1124980260 15:34563292-34563314 GAACCATGTGTTTCAGGGCCTGG + Intronic
1125734119 15:41911789-41911811 TAGGCAGCTGCTCCAGGGCTAGG - Intronic
1127961992 15:63896779-63896801 GACCCAGGTGTTCCCCAGCTGGG - Intergenic
1128342900 15:66835080-66835102 GAGCCGGGTAGTCCAGGCCTGGG + Intergenic
1129605768 15:77024304-77024326 GAGCCTGGGGATCCAGGCCTGGG - Intronic
1130538624 15:84804486-84804508 GACCCAGGTTTTCCAGGGACTGG - Exonic
1132142501 15:99407277-99407299 AAGCCAGGTGCAGCAGGGCTGGG + Intergenic
1132209035 15:100007015-100007037 GAGTCAGGTGTCCCAGCCCTTGG - Intronic
1132299887 15:100768844-100768866 GAGCCAGAGGTGCCAGGGGTGGG + Intergenic
1132516442 16:368269-368291 GAGCCTGGTGTTCAGGGTCTGGG - Intronic
1132723001 16:1326169-1326191 GAGCCAGAGGTTGGAGGGCTGGG - Exonic
1132798618 16:1740523-1740545 GAGACAGGTGTTAGAGGGCGTGG - Intronic
1132829181 16:1919157-1919179 GTGCCAGGTGGACCAAGGCTGGG - Intergenic
1132982447 16:2745408-2745430 AAGCCCTGTGTGCCAGGGCTGGG - Intergenic
1133847293 16:9467121-9467143 GAGTCAGCTGTCCCAGGCCTGGG + Intergenic
1134460386 16:14424917-14424939 GAGTCAGGAGCTCCAGGGCCAGG - Intergenic
1136480736 16:30540004-30540026 CAGGCAGCTGTTCCAGGGCCTGG + Intronic
1137350866 16:47712862-47712884 GGGCCAGGTGTCCCAGGGAGTGG - Intergenic
1137668009 16:50262915-50262937 GAGCACTGTGTGCCAGGGCTGGG + Intronic
1138377529 16:56576165-56576187 GAGCCAGGGCTTCCAGAGGTGGG - Intergenic
1139561619 16:67746189-67746211 GAGCCAGGTGTGGCTGGGCATGG + Intronic
1140209533 16:72959683-72959705 GAGCCAGCTGACCCAGGGCGGGG - Exonic
1140658263 16:77162704-77162726 GAGCCAGGTCTTCCAGGACATGG - Intergenic
1141311592 16:82918577-82918599 GAGGCAGAAGTTCCAGGGATCGG - Intronic
1141990286 16:87605364-87605386 GAGCCAGGTGTGCCAGGCTCTGG + Intronic
1142900521 17:3008589-3008611 CAGCCAGGTCTTCCAATGCTCGG - Intronic
1143749714 17:9020034-9020056 AAGCCAGCTCTTCCAGGGATGGG - Intergenic
1145058341 17:19717240-19717262 GAGCCAGGGGTGGCAGTGCTTGG + Intronic
1145959478 17:28879123-28879145 GAGCCAGGTGTTCCAGGGCTGGG + Intergenic
1146059285 17:29596096-29596118 GAGCCAGGTTTCCCTGGTCTTGG + Intronic
1146442357 17:32908148-32908170 GGGCCATGTGATGCAGGGCTTGG + Intergenic
1146637863 17:34519432-34519454 GAACCTGGTGGTCCAGGACTTGG + Intergenic
1146671656 17:34742030-34742052 GAGCCAGGTCCTACAGGGCCAGG + Intergenic
1147879097 17:43642494-43642516 GACCCAGAGGTCCCAGGGCTAGG + Intronic
1147899775 17:43776472-43776494 GAGCCACATGTGCCAGGCCTTGG - Intronic
1148053355 17:44779862-44779884 GAGCCAGGAGTTGAAGGGTTTGG - Exonic
1148675285 17:49441372-49441394 GAGCGAGCTGTTCCTGGGCTGGG - Intronic
1150304278 17:64071209-64071231 GAGCCGGGTGTTCCTGAGCAGGG + Intronic
1152202612 17:78955966-78955988 GAGCCAGGATTTCTGGGGCTGGG + Intergenic
1152292556 17:79448520-79448542 GCCCCAGGTGTTCCTTGGCTTGG - Intronic
1152688488 17:81706861-81706883 GAGCCAGGTGACAAAGGGCTGGG - Intronic
1152934077 17:83125913-83125935 AAGCCAGGGGTTCGAGGGCGAGG - Intergenic
1153149241 18:2071305-2071327 GAGACAGGTGTTCCTGGGGTGGG - Intergenic
1153780352 18:8490095-8490117 AAGCCAGGTTCTGCAGGGCTTGG + Intergenic
1155360092 18:24991234-24991256 CAGCCAGGGTTTTCAGGGCTTGG - Intergenic
1157500179 18:48185084-48185106 GGGCCAGGTGCTGGAGGGCTTGG - Intronic
1159646745 18:70927325-70927347 AAGCCAGGTTCTGCAGGGCTGGG - Intergenic
1160151233 18:76395852-76395874 GAGCCAAGTGTTTCAGGGACAGG + Intronic
1161698399 19:5782770-5782792 GAGTCTGATGTTCCAGGGCTGGG + Intergenic
1163037902 19:14582004-14582026 AACCCAGGTGTTCATGGGCTGGG + Intergenic
1163128777 19:15259069-15259091 TAGCCGGGTGCTGCAGGGCTAGG - Intronic
1163334381 19:16661335-16661357 GAGCCAGGTGAGCCGGGGCGGGG + Exonic
1163343791 19:16727143-16727165 GACCCAGGTGTTCAAGAGGTTGG + Intronic
1163643249 19:18473802-18473824 GGGCCAGGTGGTGCAGGGGTGGG - Intronic
1164404797 19:27935259-27935281 TAGCCAGCTTTCCCAGGGCTGGG - Intergenic
1164405071 19:27937078-27937100 TAGCCAGCTTTCCCAGGGCTGGG + Intergenic
1164521986 19:28986377-28986399 GAGCCAGCTGGTTCAGGGATGGG + Intergenic
1164812241 19:31166467-31166489 GAGCCAGTTGCTCCAAGGCCTGG - Intergenic
1164854704 19:31511974-31511996 GTGCCTGGTGGTCCAGGGCATGG - Intergenic
1166051425 19:40263016-40263038 GAGACAGGTGTGTCAGAGCTAGG + Intronic
1166079272 19:40433831-40433853 GAGCCAGGAATTCAAAGGCTGGG + Intergenic
1166678613 19:44754358-44754380 GAGCTAGGTCTTCTTGGGCTGGG + Intronic
1167644370 19:50697715-50697737 GGGCCAGGAGCTCTAGGGCTGGG - Intronic
925142079 2:1557640-1557662 GGGCCAGGTGTGGCAGGGATGGG - Intergenic
925181781 2:1822162-1822184 GAGCCATGTGTGCTTGGGCTGGG + Intronic
926176086 2:10593669-10593691 GGGCCAGGCTTTCCAGAGCTGGG - Intronic
927046648 2:19285865-19285887 GAACCAGGTCTCCCAGGGCAAGG + Intergenic
927946606 2:27138504-27138526 GAGCCTGGTGCTGGAGGGCTGGG - Exonic
928091617 2:28378072-28378094 CACACAGGTGTGCCAGGGCTGGG + Intergenic
928428341 2:31197814-31197836 GCTCCAGGTGTTCCTTGGCTTGG - Intronic
929012246 2:37456604-37456626 CAGCCAGGACTTACAGGGCTGGG + Intergenic
929582707 2:43093164-43093186 GAGACAGGGGTTCCCTGGCTTGG + Intergenic
930007172 2:46907275-46907297 GAGGCAGAAGTCCCAGGGCTGGG - Intronic
931293219 2:60895738-60895760 GAGCCAGCTGTTCCACTTCTAGG + Intronic
931532671 2:63233852-63233874 GAGCAAGAGGCTCCAGGGCTGGG - Intronic
932654225 2:73594687-73594709 GAGCCAGGTATTCCAATGCAAGG - Intronic
933854051 2:86396314-86396336 GTGCCACCTGATCCAGGGCTTGG - Intergenic
936117250 2:109712017-109712039 CAGCCAGCTGGTCCAGAGCTCGG + Intergenic
936965991 2:118128066-118128088 GAGCCAGGTCCTGAAGGGCTGGG - Intergenic
938117051 2:128609175-128609197 GAGGCGGCTGTTCCAGGGCATGG + Intergenic
938639751 2:133266430-133266452 GAGCCAGGTGCCGAAGGGCTGGG + Intronic
940268705 2:151867877-151867899 GAAGCAGGTGTTCCTTGGCTGGG - Intronic
941080520 2:161055441-161055463 GAGCCAGGAGGTGCAGAGCTTGG + Intergenic
941885526 2:170523590-170523612 AAGACAGAAGTTCCAGGGCTCGG + Intronic
942503819 2:176620409-176620431 GAGGAAGGTGTTCCATGGATAGG - Intergenic
945382276 2:209155145-209155167 GTGCCAGGAGTTACAGGACTTGG + Intergenic
946099464 2:217307051-217307073 GAGCCAGGTGTTTCATGACTAGG - Intronic
946371274 2:219282962-219282984 AAGCCAGGGGTTCCAGGAATCGG - Intronic
947634383 2:231672789-231672811 GGGCCATCTGTCCCAGGGCTGGG + Intergenic
947928319 2:233940859-233940881 GAGGCAGGTGTTCTATGGCGTGG + Intronic
948288756 2:236808545-236808567 GAGGCAGCTGAACCAGGGCTGGG - Intergenic
948375788 2:237519575-237519597 AGGCAAGCTGTTCCAGGGCTGGG - Intronic
1169012221 20:2260166-2260188 GAGCCAGATATTCCAGAGCAGGG + Intergenic
1169838403 20:9906446-9906468 GAGTCCGATGTTCCAGGGCAGGG + Intergenic
1170823037 20:19770595-19770617 GAGCCATGAGTTGCAGAGCTTGG - Intergenic
1170881446 20:20299889-20299911 GACCCAGCGGTTCTAGGGCTAGG - Intronic
1172161567 20:32872415-32872437 GAGCCTGTTGCCCCAGGGCTGGG - Intronic
1172871092 20:38136024-38136046 AAGCCAGGTCTTCCTGGCCTCGG + Intronic
1172872602 20:38144974-38144996 GAGCCTGGGGATCCAGGTCTTGG + Intronic
1172890443 20:38260467-38260489 GAGCGAGGTGGTCCAGGCCTTGG + Intronic
1173199853 20:40946337-40946359 GCGCCTGGCTTTCCAGGGCTTGG - Intergenic
1175229083 20:57462004-57462026 GTGCCAGGGTTCCCAGGGCTGGG + Intergenic
1175411052 20:58769291-58769313 GACCCAGGTCTTCAAGGGTTTGG - Intergenic
1175929976 20:62489298-62489320 GAGCCAGGCCTGCCAGGGCACGG - Intergenic
1176101975 20:63368498-63368520 GAGTCAGGAGATCCAGGCCTAGG + Intronic
1176115030 20:63428477-63428499 GAGGGAGGTGTCCCAGGACTCGG - Intronic
1176117546 20:63439649-63439671 GAGCCTGCCGTTCCAGGTCTGGG + Exonic
1176150799 20:63589774-63589796 GAGCCAGGTGGGCGGGGGCTAGG - Exonic
1176153041 20:63602854-63602876 GAGGCAGGGTCTCCAGGGCTGGG - Intronic
1178752677 21:35319446-35319468 GAGCCAGGTATTCAAAGGATCGG + Intronic
1180057631 21:45367108-45367130 GAGCCAGGAGGACCAGGCCTGGG - Intergenic
1181952570 22:26565044-26565066 GTGACAGGTCTTCCTGGGCTGGG - Intronic
1182585103 22:31340453-31340475 CAGCCAGGTGTGCCTGGACTTGG - Intronic
1182585329 22:31341515-31341537 GGCCCAGGTTTTCAAGGGCTGGG + Intronic
1183039090 22:35162698-35162720 GAGCCAGGGGTTGCAGGTCAGGG + Intergenic
1183322403 22:37173041-37173063 GAGCCAGGTTTTGCAGGACCTGG - Intronic
1183385262 22:37510465-37510487 GAGCCACGGGTTACAGGGGTGGG + Intronic
1183754735 22:39749830-39749852 GAGCGAAGGGTTCCAGGGCTGGG + Intronic
1183900630 22:41003238-41003260 GCCACAGGTTTTCCAGGGCTGGG + Intergenic
1184047330 22:41979589-41979611 GAGTCAGCTGCTGCAGGGCTGGG + Intronic
1184367868 22:44063937-44063959 GGGCCAGGTGTTCCGTGGATGGG + Intronic
1184681023 22:46072101-46072123 GAGCCAGGACTTGCAGGGCCGGG - Intronic
1184797668 22:46741307-46741329 GAGCCAGGTGGCCCATGGGTGGG - Intergenic
1185118728 22:48952936-48952958 GTGCAAGGGGGTCCAGGGCTGGG - Intergenic
949217143 3:1583555-1583577 GTTCCAGGTGTTCCAGGCCACGG - Intergenic
949411089 3:3765351-3765373 GGGCCAGGTTTTCCCGGGTTTGG + Intronic
949916241 3:8966758-8966780 GACCTAGCTGTCCCAGGGCTGGG - Intergenic
950481367 3:13246330-13246352 GAGTCAGGGGTTCCAGGGGCTGG + Intergenic
950555906 3:13695916-13695938 TAGTAAGGTGTTTCAGGGCTAGG + Intergenic
951900733 3:27655327-27655349 AAGCAAGGTCTTCCAGGGCCGGG - Intergenic
953032843 3:39189343-39189365 GTGGCAGGTCCTCCAGGGCTGGG + Exonic
953143376 3:40249910-40249932 GAGCCAGGTGGCCCCGGGCCAGG + Intronic
953698845 3:45180652-45180674 TGGCCAGGAGTTCCAGGCCTGGG - Intergenic
954150696 3:48655763-48655785 CAGCCACGAGTTCCAGGGCCAGG + Exonic
954295105 3:49670130-49670152 GAGGCAGGTATTCCATGGGTGGG - Exonic
954372594 3:50176592-50176614 CAGCCAGGTCTCCCAGGGCAGGG - Intronic
955122388 3:56073546-56073568 TAGCCTGGTGTCCCAGGGATTGG - Intronic
955331407 3:58050470-58050492 AAAACAGGGGTTCCAGGGCTGGG + Intronic
955851943 3:63230032-63230054 GAGCAAGGAGGTACAGGGCTGGG - Intronic
956396867 3:68835118-68835140 GGGCCAGGTGTTCCAGGTGGTGG - Intronic
959073079 3:101721544-101721566 TAGCCAGATGTTCCTGGGCAAGG - Intergenic
959526538 3:107383736-107383758 AAGACAGGTGCTCCAGGGATGGG + Intergenic
960149017 3:114232300-114232322 GGGCCTGGAGGTCCAGGGCTGGG + Intergenic
961510118 3:127395745-127395767 GAGCCAGGTGCTCAGGGGATGGG - Intergenic
961986571 3:131140889-131140911 GAGTCAGATGGTCCAGTGCTAGG - Intronic
966816951 3:183897104-183897126 GAGCTGAGTGTTCTAGGGCTGGG - Intergenic
966925044 3:184639262-184639284 GAGCAAGTTGCACCAGGGCTGGG + Intronic
967367545 3:188704837-188704859 GAGCTAGGGGCTCCAGGCCTTGG - Intronic
968091463 3:195900822-195900844 GAGAGAGCTCTTCCAGGGCTGGG + Intronic
968962923 4:3754485-3754507 GAGCCAGGAGGTCAGGGGCTGGG + Intergenic
969468641 4:7372752-7372774 GACTCAGGGGGTCCAGGGCTTGG - Intronic
970137394 4:12940694-12940716 GAGCCAGAAGTTCCAAGTCTTGG + Intergenic
970535791 4:17028581-17028603 GAGCCAAGCCTCCCAGGGCTGGG - Intergenic
972063612 4:34911448-34911470 GAGCCAGGTGATCCAGGCTATGG + Intergenic
972253945 4:37333492-37333514 GAGCCACGTGTTACTGGGCTTGG + Intronic
972292787 4:37705398-37705420 GCCCCAGGTGTTCCTTGGCTTGG + Intergenic
973656033 4:53048722-53048744 GAGCCAGATGACCCAGGGCCTGG - Intronic
973656216 4:53050767-53050789 GAGCCAGATGACCCAGGGCCTGG - Intronic
976257007 4:83109828-83109850 GACCCAGGGGTCCCAGAGCTGGG - Intronic
980297191 4:130936480-130936502 GATCCAGGTATTCCACTGCTGGG - Intergenic
980974562 4:139598491-139598513 GATCCAGGCGTTCCTTGGCTTGG - Intronic
981279959 4:142946041-142946063 GCTCCAGGTGTTCAAGGCCTTGG - Intergenic
984851276 4:184155054-184155076 GAGCCAGGCTTCCCGGGGCTGGG + Intronic
985382788 4:189413105-189413127 GAGCCAGGTGTTCTAGCTTTAGG + Intergenic
985577057 5:678371-678393 GTGCCAGGGGCTCCAGGCCTAGG + Intronic
985591977 5:770424-770446 GTGCCAGGGGCTCCAGGCCTAGG + Intergenic
986421732 5:7591697-7591719 GAGCCAGATGTTCCAGCTCTGGG + Intronic
986988410 5:13524663-13524685 GAGCCAAGAGTTTCAGGTCTGGG - Intergenic
988906869 5:35799266-35799288 GGCCTATGTGTTCCAGGGCTTGG + Intronic
989623609 5:43409133-43409155 TAGCCAGGTGTGCCTGGGCATGG + Intronic
990544047 5:56804437-56804459 GAGTCAGGAGTTCCAGGCCAGGG - Intergenic
995750901 5:115452271-115452293 GAGCCAGGTGTTAAAGGTCTAGG - Intergenic
997183323 5:131856358-131856380 GAACCAGCTGTTCCAGTGCAAGG + Intronic
997385238 5:133467353-133467375 AAGCCAGGTTTCCCACGGCTGGG + Intronic
997634123 5:135392001-135392023 GAGGCATGTGAGCCAGGGCTGGG - Intronic
997743961 5:136282739-136282761 AACCCAGATGTTCCAGGTCTTGG + Intronic
997778048 5:136629247-136629269 GAGCCAGGCACTGCAGGGCTAGG - Intergenic
997980959 5:138467112-138467134 AAGCCAGGCCTTCCCGGGCTCGG + Exonic
998174613 5:139894173-139894195 GAGCCAGGTCCTCCCTGGCTGGG - Intronic
1001375279 5:171250814-171250836 AATCCAGGTGTTCCAGTGTTGGG - Intronic
1002173097 5:177386130-177386152 AAGCCAGGTGGGCCTGGGCTGGG + Exonic
1002185795 5:177454340-177454362 GAGCCAGTTGTTCCGGGCTTTGG + Intronic
1003628318 6:7764067-7764089 GGGAGAGTTGTTCCAGGGCTTGG + Intronic
1004370647 6:15049370-15049392 GAAGCATGTGTTCCTGGGCTTGG + Intergenic
1006509153 6:34512412-34512434 GAGAAAGATGATCCAGGGCTGGG + Intronic
1007237643 6:40402325-40402347 GAGCCAGGTCTGCCAGGCCACGG + Intronic
1007495735 6:42259444-42259466 GAGCCCGGTGCGCCAGGGCTCGG - Exonic
1008051432 6:46903622-46903644 GAGGCATGTGTGGCAGGGCTCGG - Intronic
1008231540 6:48989887-48989909 TAGCCAGGTGTACCCGTGCTTGG + Intergenic
1008313073 6:50002381-50002403 CAGGCAGGTTTTTCAGGGCTAGG + Intergenic
1011248170 6:85341703-85341725 GAGAGAGGGGCTCCAGGGCTAGG - Intergenic
1011715951 6:90105106-90105128 GAGCCATGTGGATCAGGGCTGGG + Intronic
1014521986 6:122455469-122455491 GAGCCTGATGTTCAAGGGCAGGG - Intronic
1016864159 6:148748571-148748593 GAGCCAGGGGTGCCAGGGACAGG + Intronic
1016906097 6:149152238-149152260 GAGCCAACTGTTGCAGGGATGGG - Intergenic
1017043701 6:150327755-150327777 GAGCCAGGGCCTCCAGGGCAGGG - Intergenic
1017053738 6:150419272-150419294 GAGCCGGGAGTTCCATGGCGAGG + Intergenic
1017631120 6:156397235-156397257 GAGCCAGGTGTGCGAGGCCGAGG + Intergenic
1017862646 6:158413285-158413307 GCGCCACGTGCTCCAGAGCTGGG + Intronic
1017881073 6:158562962-158562984 GAGCCAGGTGGCCCAGGGTTTGG - Intronic
1018807255 6:167270966-167270988 GATACAGGTGTTGCAGGGATGGG + Intergenic
1019312574 7:369853-369875 GAGTCAGGTGGGCCCGGGCTGGG - Intergenic
1019751193 7:2731054-2731076 GAGCCAGGTATTCCAGGGCACGG + Exonic
1022310979 7:29195226-29195248 GACGCGGGTGTTCCGGGGCTTGG + Exonic
1022820077 7:33950980-33951002 GACCCAGATCTTGCAGGGCTTGG - Intronic
1022948998 7:35317566-35317588 GTGCCAGGTGTTCTATGACTTGG + Intergenic
1023819650 7:43973397-43973419 GAGCCAGTTGTTATAGGGGTAGG - Intergenic
1023892175 7:44400722-44400744 GCTCCAGGTGTTCCTGGGCTTGG + Intronic
1023908703 7:44539364-44539386 TGGCCAGTTCTTCCAGGGCTGGG - Exonic
1023987291 7:45104215-45104237 GACCCAGGTGTCCCAGCGCCTGG - Exonic
1026179952 7:68030118-68030140 GAGGCAGGAGTTCCTTGGCTGGG + Intergenic
1026807838 7:73438836-73438858 AAGCCAGGAGGCCCAGGGCTGGG + Intergenic
1026897070 7:74015517-74015539 GAGCCAGCTGTTCCTGGGGTGGG - Intergenic
1029123698 7:98283882-98283904 GGGCCAGATATCCCAGGGCTGGG + Intronic
1029744699 7:102510366-102510388 GAGCCAGTTGTTATAGGGGTAGG - Intronic
1029762690 7:102609528-102609550 GAGCCAGTTGTTATAGGGGTAGG - Intronic
1030086179 7:105817845-105817867 GAGCCAGGAGTTCCAGGTTACGG + Intronic
1031935015 7:127727221-127727243 GAGCCAGGCGGGCCAGGTCTGGG - Intronic
1032027629 7:128456087-128456109 CAGCCTCGCGTTCCAGGGCTGGG + Intronic
1032498578 7:132381819-132381841 AAGCCAGGTGCCACAGGGCTTGG + Intronic
1034026047 7:147705720-147705742 TATCCAGGTGTTCCAGTGTTAGG + Intronic
1034589752 7:152129133-152129155 GCGGCAAGTGTTCCAGGGCCTGG + Intergenic
1034945673 7:155260281-155260303 GACCCAGGTTCTCCTGGGCTGGG - Intergenic
1035056535 7:156039939-156039961 CAGCCGGGTGTCCCAGGCCTCGG + Intergenic
1035188634 7:157145564-157145586 TTGCCAGGTGTTACAGGGATGGG - Intronic
1036668837 8:10766297-10766319 GACACTGGTGTTCCAGAGCTTGG + Intronic
1037836185 8:22216055-22216077 GAACCAGATGTTCAAGGGGTGGG - Intergenic
1038031315 8:23643939-23643961 TTGCCAGGTGTTGGAGGGCTTGG + Intergenic
1039314703 8:36358374-36358396 AAGGCAGGTGTTTCAAGGCTAGG - Intergenic
1039791879 8:40882728-40882750 GTACCAGGTGTTTCAGAGCTGGG + Intronic
1039958702 8:42227569-42227591 GGGCTGGGTGTTTCAGGGCTAGG + Intergenic
1041501117 8:58539739-58539761 TAGCCAGGTGGTCCATGCCTTGG - Intergenic
1045223237 8:100218944-100218966 GACCCAGGTGATCTAGGACTGGG + Intronic
1047462593 8:125081645-125081667 GATACAGGTATTCCTGGGCTAGG - Exonic
1048581483 8:135732725-135732747 CAGCCCAGTGTCCCAGGGCTGGG + Intergenic
1048844485 8:138594055-138594077 GAGCCAGGTCGTCCTGGGCAGGG - Exonic
1049095671 8:140546865-140546887 CATCCAGGTATTCCAGGGCAGGG - Intronic
1049242108 8:141543343-141543365 GTGCCTGGTGTTCCTTGGCTGGG - Intergenic
1049265903 8:141667792-141667814 GAGCCACGTGTGCCAGGGCCTGG + Intergenic
1051230135 9:14947518-14947540 GAGACTGGTGTTCCTGGTCTAGG - Intergenic
1051742453 9:20264991-20265013 GACCCAGATGTACCAGGGCTGGG - Intergenic
1052851604 9:33381605-33381627 GAGCCAGGGGAACCAGGGCTGGG - Intergenic
1056210810 9:84363481-84363503 AAGCAAGGTGCTCTAGGGCTGGG + Intergenic
1057532082 9:95857872-95857894 GAGCCCTGGGTGCCAGGGCTGGG - Intergenic
1060247750 9:121960528-121960550 CAGCCAGGTGAGCCAGGCCTGGG - Intronic
1060639996 9:125230386-125230408 GAGCCAGATAATTCAGGGCTTGG - Intronic
1060820519 9:126659000-126659022 GAGGCGGGTGTTCTGGGGCTGGG + Intronic
1060945635 9:127568346-127568368 CCGCCACGTGTACCAGGGCTGGG + Intronic
1061707870 9:132466837-132466859 CAGCCAGGTGTCCTGGGGCTGGG + Intronic
1061732916 9:132630550-132630572 AAGCCAGGAGTTTCAGGGTTGGG - Intronic
1061938893 9:133873621-133873643 AAGCCCTGTGTCCCAGGGCTGGG + Intronic
1062285188 9:135769697-135769719 CAGCGAGGAGTTCCAGGGCGGGG - Intronic
1062591408 9:137276419-137276441 GCTGCAGGTTTTCCAGGGCTCGG + Intergenic
1062647501 9:137556369-137556391 GAGCCAGGGGCTGCAAGGCTGGG + Intronic
1186548145 X:10472866-10472888 GAAGCCTGTGTTCCAGGGCTGGG - Intronic
1194347166 X:92780417-92780439 GAGCCAGGTGTTCCAGTCATAGG + Intergenic
1194991021 X:100547051-100547073 TATCCAGGTGTTCCAGTGTTGGG - Intergenic
1195321439 X:103724782-103724804 GAGGCTGGAGGTCCAGGGCTGGG - Intronic
1195361184 X:104085124-104085146 TAGGCAGGTCTTCCAGGCCTGGG - Intergenic
1197076966 X:122364316-122364338 CAGGCAGGTCTTCCAGGCCTGGG - Intergenic
1199602183 X:149548016-149548038 GGACCAGGTCTTCCTGGGCTTGG + Intronic
1199648204 X:149931460-149931482 GGACCAGGTCTTCCTGGGCTTGG - Intronic
1199711649 X:150473865-150473887 GAGCCAGCTGATCCAGCTCTGGG - Intronic
1200655494 Y:5897053-5897075 GAGCCAGGTGTTCCAGTCATAGG + Intergenic
1201147683 Y:11073802-11073824 GATCAAGGTGTGGCAGGGCTGGG - Intergenic