ID: 1145959479

View in Genome Browser
Species Human (GRCh38)
Location 17:28879124-28879146
Sequence AGCCAGGTGTTCCAGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 359}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145959469_1145959479 0 Left 1145959469 17:28879101-28879123 CCTCCACCTTCTGCCTGTGATGG No data
Right 1145959479 17:28879124-28879146 AGCCAGGTGTTCCAGGGCTGGGG 0: 1
1: 0
2: 1
3: 37
4: 359
1145959472_1145959479 -6 Left 1145959472 17:28879107-28879129 CCTTCTGCCTGTGATGGAGCCAG No data
Right 1145959479 17:28879124-28879146 AGCCAGGTGTTCCAGGGCTGGGG 0: 1
1: 0
2: 1
3: 37
4: 359
1145959471_1145959479 -3 Left 1145959471 17:28879104-28879126 CCACCTTCTGCCTGTGATGGAGC No data
Right 1145959479 17:28879124-28879146 AGCCAGGTGTTCCAGGGCTGGGG 0: 1
1: 0
2: 1
3: 37
4: 359
1145959465_1145959479 12 Left 1145959465 17:28879089-28879111 CCCTGCTAGTCCCCTCCACCTTC No data
Right 1145959479 17:28879124-28879146 AGCCAGGTGTTCCAGGGCTGGGG 0: 1
1: 0
2: 1
3: 37
4: 359
1145959468_1145959479 1 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959479 17:28879124-28879146 AGCCAGGTGTTCCAGGGCTGGGG 0: 1
1: 0
2: 1
3: 37
4: 359
1145959466_1145959479 11 Left 1145959466 17:28879090-28879112 CCTGCTAGTCCCCTCCACCTTCT No data
Right 1145959479 17:28879124-28879146 AGCCAGGTGTTCCAGGGCTGGGG 0: 1
1: 0
2: 1
3: 37
4: 359
1145959467_1145959479 2 Left 1145959467 17:28879099-28879121 CCCCTCCACCTTCTGCCTGTGAT No data
Right 1145959479 17:28879124-28879146 AGCCAGGTGTTCCAGGGCTGGGG 0: 1
1: 0
2: 1
3: 37
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145959479 Original CRISPR AGCCAGGTGTTCCAGGGCTG GGG Intergenic
900164547 1:1239529-1239551 AGCCAGGGGAGGCAGGGCTGGGG - Intergenic
900252174 1:1676658-1676680 AACCAGCTCTTCCAGTGCTGGGG + Exonic
900262584 1:1739516-1739538 AACCAGCTCTTCCAGTGCTGGGG + Exonic
900394177 1:2446386-2446408 AGCCAGGTCTCCCGGGGCTGGGG + Intronic
900410744 1:2511415-2511437 AGCCCGGTGCTCCAGGTCAGGGG + Intronic
900435487 1:2628898-2628920 AGCCAGGTGAGCCCGGGCGGCGG + Intronic
900507116 1:3035222-3035244 ACCCAGATTTTCCAGGGCAGTGG + Intergenic
900526271 1:3130291-3130313 AGCTGGGGGCTCCAGGGCTGTGG + Intronic
901130297 1:6958374-6958396 GGCCAGGGGGTCCGGGGCTGCGG - Intronic
901185768 1:7372121-7372143 AGCCAGGTCTTCCTGGGTTGAGG + Intronic
901632463 1:10654626-10654648 GGCCAGGTGCTCCTGGGCCGAGG + Intronic
901693705 1:10990941-10990963 TGCCAGATGTTCCAGGCATGGGG + Intergenic
902653493 1:17852180-17852202 GGCCTGGTGTCCCTGGGCTGGGG - Intergenic
902769622 1:18637955-18637977 CGGCAGGTGTCCCAGGGCTCTGG - Intronic
902876929 1:19345959-19345981 AGCCAGCTCTTCCTGGGCTTGGG - Intronic
903121083 1:21217558-21217580 AGGCAGGTGTCCTAGGGCTGGGG - Intronic
903133485 1:21294014-21294036 AGGCAGGTGACTCAGGGCTGGGG - Intronic
903218077 1:21854164-21854186 AGCCAGGTGTGGCTGGGCCGGGG - Intronic
904187896 1:28720286-28720308 AGAAAGGTGTTCCAGGACTTGGG - Intergenic
904328338 1:29741964-29741986 ATCCAGGTCCTCCAGGGCTGGGG - Intergenic
905484592 1:38286330-38286352 AGCCAGGAGTGCCAAGCCTGTGG - Intergenic
906153651 1:43601858-43601880 AACTGGGTGTGCCAGGGCTGAGG - Intronic
909531111 1:76682670-76682692 AGCCAGATGGTGCATGGCTGTGG + Intergenic
912740059 1:112186272-112186294 AGGCAGCTCTTCCAGAGCTGGGG + Intergenic
913137886 1:115910420-115910442 AGCCTGGTTTTTCAAGGCTGTGG + Intergenic
915706716 1:157850926-157850948 ATGCAGGACTTCCAGGGCTGCGG - Intronic
915814293 1:158950383-158950405 AGCCACATTGTCCAGGGCTGCGG + Intronic
919517437 1:198544351-198544373 AGACAGGTGTTCCAGAGATAAGG - Intergenic
919841551 1:201612995-201613017 AACCAGGATTTCCAGGGCGGAGG + Intergenic
920376916 1:205513743-205513765 AGCTAGGGCCTCCAGGGCTGTGG - Intronic
922127172 1:222739091-222739113 AGCCAGGTGTACAGGGGATGAGG + Intronic
922211534 1:223490365-223490387 AGCCAGGAGGCCAAGGGCTGGGG - Intergenic
922481835 1:225944742-225944764 GACCTGCTGTTCCAGGGCTGAGG + Intergenic
922576594 1:226665007-226665029 AGCCAGGTGATATAGGGCAGAGG + Intronic
923979892 1:239310046-239310068 GGCCAAGTGGTCCAGGCCTGTGG - Intergenic
1062821693 10:539263-539285 ATCCTGGGGTTCCAGGCCTGTGG + Intronic
1062831064 10:606202-606224 AGCCAGGTGCTGCTGGGCCGTGG - Intronic
1063346634 10:5318142-5318164 AGCCAGGTGTTCAAGGCCCTTGG + Intergenic
1064851805 10:19716433-19716455 AGGCATGTCTTCCATGGCTGGGG - Intronic
1067096310 10:43303087-43303109 AGCCACATTGTCCAGGGCTGTGG + Intergenic
1067901281 10:50244253-50244275 AGTCAGGAGTCCCAGGGTTGGGG - Intronic
1069598645 10:69688921-69688943 ATCCAGATGTTCCAGGTCAGTGG + Intronic
1069677689 10:70260294-70260316 AGCCAGGTGAGCCAGAGCTAAGG - Intronic
1069880863 10:71592242-71592264 AGCCAGGAGATCCAATGCTGAGG - Intronic
1070304218 10:75228834-75228856 AGGCAGGTGTTCCTGGCCTCTGG + Intronic
1070566137 10:77605151-77605173 AGCCATGTGCCCCTGGGCTGCGG - Intronic
1070918070 10:80167584-80167606 GCCCAGGTCCTCCAGGGCTGGGG + Intronic
1071573265 10:86709515-86709537 GGCCAGGTGGTCAGGGGCTGAGG + Intronic
1071603559 10:86970470-86970492 GGCCAGCTGGTCCATGGCTGGGG - Exonic
1074884838 10:117685359-117685381 TGCCTGGTGTGCCTGGGCTGGGG - Intergenic
1076144165 10:128103800-128103822 GGCCAGGTCTTCCAGGGGTTGGG + Exonic
1076144599 10:128107436-128107458 AGCCAGGTCTTCTAGGGGTTGGG + Exonic
1076518368 10:131062787-131062809 AGTCAGGGCTTCCACGGCTGTGG - Intergenic
1076734541 10:132452815-132452837 AGCCGGGACTGCCAGGGCTGAGG - Intergenic
1077142379 11:1030293-1030315 AACCAGGTGTACCAGGAGTGCGG - Exonic
1077181476 11:1219099-1219121 AGGAAGGTGTTCCAGGCCTCGGG - Intergenic
1077553919 11:3217110-3217132 CTCCAGATGATCCAGGGCTGAGG + Intergenic
1078170453 11:8925446-8925468 AGCCAGGTATACCAGGGGAGTGG - Exonic
1082035518 11:47642428-47642450 AGTCAGGTGCTCCTGGGCTCCGG - Exonic
1082848795 11:57746852-57746874 AGTTAGGTGTTCCTGGGCAGAGG + Intronic
1082888470 11:58113048-58113070 AGACAGCTCTTCCAGAGCTGAGG - Intronic
1083179353 11:60974262-60974284 AGCCAGGTCTGCCAGGGCAAAGG - Intronic
1083308438 11:61772557-61772579 AGCCAGCAGTCCCAGGCCTGGGG + Intronic
1083806704 11:65078772-65078794 AGCCAGAAGTTAAAGGGCTGAGG - Exonic
1084581621 11:70027714-70027736 GGCCACGTGTGCCAGGGCAGGGG + Intergenic
1084710990 11:70843651-70843673 ATCAAGGTGTCGCAGGGCTGGGG - Intronic
1084725551 11:70939538-70939560 AGCAAGGTGCTCCATGTCTGGGG + Intronic
1084939335 11:72604021-72604043 GGCCAGGTGGTCCAGGGATGTGG - Intronic
1084958280 11:72703018-72703040 ACCCAGGCGCTCCTGGGCTGTGG - Exonic
1085388075 11:76168476-76168498 AGCCATGGGAGCCAGGGCTGGGG - Intergenic
1087059321 11:93962669-93962691 TGCTAGGTGTCCCAGGGCAGGGG + Intergenic
1087751611 11:102013215-102013237 ACCCAGATGTTTCAGGGCTCTGG - Intergenic
1088977725 11:114830620-114830642 AGCCAGTCGTTCCATGGCAGGGG + Intergenic
1089140585 11:116280734-116280756 ACCCAGGTTTTCCTGGGGTGGGG - Intergenic
1089216829 11:116839246-116839268 AGCCACAGGTTCCAGGGATGAGG - Intergenic
1089296973 11:117475389-117475411 AGCCAGATGTTGCAGGGCCTGGG - Intronic
1089981602 11:122777225-122777247 AGCCAGGCTTCCCAGGGGTGGGG - Intronic
1090930542 11:131294544-131294566 AGCCAGGTGTTCCGTGTCTCAGG + Intergenic
1092071856 12:5637728-5637750 AGTGAGGTGTGCCAGGGGTGGGG - Intronic
1092073974 12:5657613-5657635 ACCCAGGTGCTCCTGGGCTCAGG + Intronic
1096477041 12:51914597-51914619 GGCCAGCTGTGCCAGGCCTGGGG + Intronic
1098315029 12:69183939-69183961 AGCAAAGTGGTCCAAGGCTGAGG + Intergenic
1101491823 12:105216613-105216635 CTCCAGGTGTTCCTTGGCTGTGG - Intronic
1101682428 12:106982197-106982219 AGCCAGGAGTTCCTGGGGTTTGG - Intronic
1101827598 12:108232613-108232635 AGCCAGGTGATCAAGGGCACAGG - Intronic
1102652225 12:114450004-114450026 AGCCATGTGTTACAGACCTGAGG - Intergenic
1104035205 12:125092871-125092893 AGCCAGGCTGTCCAGGGCAGAGG + Intronic
1104674032 12:130700597-130700619 CTCCAGGTGTTCCTTGGCTGTGG - Intronic
1104943477 12:132405426-132405448 ACCCAGGAGAGCCAGGGCTGGGG - Intergenic
1105211181 13:18258056-18258078 GGTCAGGTGGTGCAGGGCTGAGG + Intergenic
1105578898 13:21675522-21675544 CGCCAGGTGTGCCAGAGCCGGGG - Intronic
1105786837 13:23758264-23758286 AGCCAGGCATTGCAGAGCTGAGG - Intronic
1106170061 13:27280952-27280974 ATCCCCGTGTCCCAGGGCTGTGG + Intergenic
1106814356 13:33390392-33390414 AGTCAGGTGTTCCAGGGAGCTGG - Intergenic
1107303693 13:38994764-38994786 ATCCAGGTGTTCCAGGACAGTGG + Intergenic
1113035124 13:106039745-106039767 AGGCTGGTATTCCAGGGCAGAGG - Intergenic
1113505870 13:110815464-110815486 AGCCAGGTGCTCTAAGGCTTTGG + Intergenic
1113876540 13:113598164-113598186 GGCACGGTTTTCCAGGGCTGGGG - Intronic
1114526115 14:23367688-23367710 AGCCAGGTCCCCCAGGGCTGGGG - Intergenic
1119354841 14:73997720-73997742 AGCAAGGTGTGTCAGGGCTGTGG - Intronic
1119679255 14:76579658-76579680 ATCAAGGTGTGGCAGGGCTGTGG + Intergenic
1119938697 14:78617417-78617439 AGCCAGGCTTTCCATGGCTGGGG + Intronic
1120051935 14:79877056-79877078 AACCAAATGTTCAAGGGCTGAGG - Intergenic
1120103511 14:80470063-80470085 AGCCACATCGTCCAGGGCTGTGG - Intergenic
1121793659 14:96718145-96718167 ATACAGAGGTTCCAGGGCTGGGG + Intergenic
1122152432 14:99732182-99732204 CACCGGGTGTTCCTGGGCTGAGG - Intergenic
1122605975 14:102947982-102948004 TGGCAGGTGTTTCAGGGCTTAGG + Intronic
1123052663 14:105553595-105553617 ACCCAGGCTTTCCAGGGCAGAGG + Intergenic
1124138853 15:27059652-27059674 AGACATGTGTTCCAAGACTGTGG + Intronic
1125953931 15:43776609-43776631 AGGCAGGTGATCCCGGGCTCCGG - Intronic
1126106533 15:45150572-45150594 AGCCAGGTCTTCCTGGGCTCTGG + Intronic
1128348812 15:66875436-66875458 AGCCATGAGTTACAGCGCTGTGG - Intergenic
1128637670 15:69313691-69313713 AGCCAGGTGTTCCCGAGAGGAGG + Intronic
1129605767 15:77024303-77024325 AGCCTGGGGATCCAGGCCTGGGG - Intronic
1129952950 15:79608024-79608046 AGCCTGCTGTTCCTGTGCTGGGG + Intergenic
1130909604 15:88262091-88262113 AGCGAGGGGCTCCGGGGCTGAGG - Intergenic
1130984751 15:88837499-88837521 AGCCAGGGGCTGCATGGCTGTGG - Intronic
1133847294 16:9467122-9467144 AGTCAGCTGTCCCAGGCCTGGGG + Intergenic
1134655980 16:15949134-15949156 AGCCAGGTGACCCTGGGCAGAGG + Intergenic
1136133163 16:28237414-28237436 AGCCAGGGGGTCAATGGCTGAGG + Intergenic
1136480737 16:30540005-30540027 AGGCAGCTGTTCCAGGGCCTGGG + Intronic
1136504420 16:30693839-30693861 ATCCAAGTCTTCAAGGGCTGAGG - Intergenic
1136748780 16:32614849-32614871 ACCCTGCTGTTCCAGGGCTGTGG - Intergenic
1137793629 16:51196356-51196378 AGCCAGCATTTCCGGGGCTGAGG + Intergenic
1140209532 16:72959682-72959704 AGCCAGCTGACCCAGGGCGGGGG - Exonic
1140658262 16:77162703-77162725 AGCCAGGTCTTCCAGGACATGGG - Intergenic
1140945256 16:79762415-79762437 AGCCTGGCCTTGCAGGGCTGTGG - Intergenic
1141098188 16:81177829-81177851 CTCCAGGGGTCCCAGGGCTGTGG + Intergenic
1142008660 16:87702408-87702430 AGCCGGGGGTTCCCAGGCTGGGG - Intronic
1142246666 16:88973338-88973360 TCCCAGGTGTTCCTGGGCTGTGG - Intronic
1203050913 16_KI270728v1_random:874063-874085 ACCCTGCTGTTCCAGGGCTGTGG - Intergenic
1142699420 17:1650040-1650062 AGCCAGGCGTCCAAGAGCTGAGG + Exonic
1145269996 17:21399760-21399782 ATTCAGGACTTCCAGGGCTGTGG - Intronic
1145919639 17:28600600-28600622 AGCCAGGGGTGGCAGGGTTGGGG + Intronic
1145959479 17:28879124-28879146 AGCCAGGTGTTCCAGGGCTGGGG + Intergenic
1146002210 17:29138174-29138196 GGCCAGGCATTCCAGGCCTGAGG - Intronic
1147537308 17:41328953-41328975 AGAGAGGGGTACCAGGGCTGTGG + Intergenic
1149931049 17:60756092-60756114 AGCCAGTTTTTCCATGGATGGGG + Intronic
1150285447 17:63951407-63951429 AGCAAGGTGAGCCGGGGCTGGGG - Exonic
1150294103 17:63998701-63998723 AGGAAGGTGACCCAGGGCTGGGG - Exonic
1151529621 17:74696012-74696034 AGCCAGGGGGACAAGGGCTGAGG - Intronic
1151885405 17:76920629-76920651 ATCCTTGTTTTCCAGGGCTGGGG + Intronic
1152018706 17:77769183-77769205 AGCCAGGGGCAGCAGGGCTGGGG + Intergenic
1152421236 17:80194236-80194258 AGTGAGGCATTCCAGGGCTGTGG - Intronic
1152605536 17:81287810-81287832 AGACCGGTGACCCAGGGCTGGGG - Intronic
1152688487 17:81706860-81706882 AGCCAGGTGACAAAGGGCTGGGG - Intronic
1152880437 17:82811758-82811780 AGCCAGGAGTTGCTGGGGTGTGG + Intronic
1152934076 17:83125912-83125934 AGCCAGGGGTTCGAGGGCGAGGG - Intergenic
1153216058 18:2821966-2821988 AGCCAGCTGTTTCAGGACAGTGG + Intergenic
1153523515 18:5974325-5974347 GGCCAAGTCTTCCAGTGCTGTGG - Intronic
1153780353 18:8490096-8490118 AGCCAGGTTCTGCAGGGCTTGGG + Intergenic
1157862357 18:51152554-51152576 AGCGAGGTCTTTCAGGGCTTAGG - Intergenic
1157898665 18:51492473-51492495 AGCCAGGTGCCCCATTGCTGTGG - Intergenic
1158146745 18:54322861-54322883 CTCCAAGTGTTCCTGGGCTGTGG + Intergenic
1159280915 18:66284280-66284302 ACCCAGGTGATCCTGGGTTGGGG - Intergenic
1160569111 18:79804403-79804425 AGCCAGGAGTCCCAGGTGTGTGG - Intergenic
1161455412 19:4367307-4367329 AGCCATGTGTTCTCAGGCTGAGG - Intronic
1161844729 19:6706373-6706395 AGCCAGGAGGCCCAGGCCTGAGG - Intronic
1161865315 19:6828721-6828743 AGCCGGGTGGGCCAGGGGTGTGG + Intronic
1161991235 19:7685569-7685591 TGCCTGGTGGACCAGGGCTGAGG + Exonic
1163128776 19:15259068-15259090 AGCCGGGTGCTGCAGGGCTAGGG - Intronic
1163334382 19:16661336-16661358 AGCCAGGTGAGCCGGGGCGGGGG + Exonic
1163633547 19:18428595-18428617 GGCCAGGTGGTCCAGCGCAGAGG - Intronic
1164521987 19:28986378-28986400 AGCCAGCTGGTTCAGGGATGGGG + Intergenic
1164528575 19:29029763-29029785 CACCAGGTCTTCCAGGGCTGTGG + Intergenic
1166079273 19:40433832-40433854 AGCCAGGAATTCAAAGGCTGGGG + Intergenic
1167208410 19:48117834-48117856 GGCCAAGTGTTGGAGGGCTGGGG + Intronic
925210217 2:2038952-2038974 AACCCAGTGTGCCAGGGCTGTGG - Intronic
926142182 2:10374217-10374239 AGCCCGTTGTCCCAGGGCTCTGG - Intronic
926176085 2:10593668-10593690 GGCCAGGCTTTCCAGAGCTGGGG - Intronic
926414569 2:12636465-12636487 AGCGAGGTGTGCCAGGGTGGAGG - Intergenic
929613590 2:43290556-43290578 AACAAGGTGTGCCAGGGCCGTGG - Intronic
929709060 2:44247976-44247998 GGCTAGGTGTTCCAGGTCAGAGG + Intergenic
930075672 2:47403582-47403604 AGGCACGGGTTTCAGGGCTGAGG - Intronic
930874349 2:56197355-56197377 TGCCAGACGTTCCAGGGTTGCGG + Intronic
931387873 2:61813290-61813312 AGCCAGCTGTGGCTGGGCTGAGG + Intergenic
931706169 2:64948050-64948072 AGCTAGGGGATCCAGGGCTGTGG - Intergenic
933285527 2:80380925-80380947 AGACATGTGTTCCAGGGTTTCGG + Intronic
933802978 2:85977704-85977726 CGCCATGTGTCCCATGGCTGAGG + Intergenic
934655495 2:96115107-96115129 GGCCAGGTGCTCCTGGGCAGGGG - Exonic
936117251 2:109712018-109712040 AGCCAGCTGGTCCAGAGCTCGGG + Intergenic
936151383 2:110024096-110024118 TGACAGCAGTTCCAGGGCTGGGG + Intergenic
936193292 2:110347273-110347295 TGACAGCAGTTCCAGGGCTGGGG - Intergenic
936687820 2:114849127-114849149 ATCCAGTTAATCCAGGGCTGAGG - Intronic
936965990 2:118128065-118128087 AGCCAGGTCCTGAAGGGCTGGGG - Intergenic
937624080 2:124024644-124024666 TGCAAGGTGTTCCGGGGCTCTGG - Intergenic
938419846 2:131136307-131136329 AGCCTGGAATTCCTGGGCTGAGG + Intronic
938639752 2:133266431-133266453 AGCCAGGTGCCGAAGGGCTGGGG + Intronic
938652932 2:133402288-133402310 GGCCTGGTCTTCCAGGGATGAGG + Intronic
940318948 2:152354080-152354102 ACCCAGGTGTTTCAGGGCATTGG + Intronic
941526040 2:166608445-166608467 AGAAAGAGGTTCCAGGGCTGAGG - Intergenic
942115653 2:172726626-172726648 AGCCAGATATTCTAGGCCTGTGG + Intergenic
946782648 2:223206462-223206484 TGCCAGGTGTTCCAGTCCTCAGG - Intergenic
947724545 2:232388682-232388704 CGGCCGGTGCTCCAGGGCTGTGG - Intergenic
948381045 2:237550229-237550251 TGCCAGGTGTTGCAGGGAGGCGG - Intronic
948545584 2:238726318-238726340 GGCAAGGTGTTCTAGGGCAGTGG + Intergenic
948808823 2:240464850-240464872 CTCCAGGTCATCCAGGGCTGCGG + Exonic
1171188642 20:23142262-23142284 AGCCAGATGCTCAAGGGCAGAGG + Intergenic
1171391050 20:24802024-24802046 AGGCAGGGGCTCCAGGGCTTCGG - Intergenic
1172810002 20:37640633-37640655 GGCCAGGTTTTGCAGGGCTCTGG + Intergenic
1172871093 20:38136025-38136047 AGCCAGGTCTTCCTGGCCTCGGG + Intronic
1173141907 20:40492009-40492031 TGCTAGGAATTCCAGGGCTGTGG - Intergenic
1174819355 20:53713592-53713614 CACCAGGTGGACCAGGGCTGTGG + Intergenic
1174956716 20:55106029-55106051 GGCCAGGTGTTACAGTCCTGGGG + Intergenic
1175584077 20:60123548-60123570 AGCCAGATGTTCCAGGGCTAAGG + Intergenic
1176117547 20:63439650-63439672 AGCCTGCCGTTCCAGGTCTGGGG + Exonic
1176153040 20:63602853-63602875 AGGCAGGGTCTCCAGGGCTGGGG - Intronic
1176199547 20:63854278-63854300 CTCCAGGTGTGCCTGGGCTGGGG - Intergenic
1176251368 20:64122047-64122069 ACCCAGGTGTTTCAAAGCTGGGG + Intergenic
1177628951 21:23701664-23701686 ATCCAGGGGTTCCAGGGCTAAGG + Intergenic
1178685553 21:34707949-34707971 AGCCAGGTTCTGCAGGTCTGCGG - Exonic
1179454036 21:41486264-41486286 AGCCATGTATTCCAGGCTTGTGG - Intronic
1179657694 21:42855370-42855392 AGCCAGGTGGGGCAGGGGTGGGG - Intronic
1180061159 21:45385712-45385734 AGGCAGGTGTTCCTGGTCGGGGG + Intergenic
1180765055 22:18341381-18341403 GGTCAGGTGGTGCAGGGCTGAGG - Intergenic
1180813974 22:18778303-18778325 GGTCAGGTGGTGCAGGGCTGAGG + Intergenic
1181154397 22:20909568-20909590 AGCCACGACTTCCTGGGCTGAGG - Intergenic
1181179547 22:21057172-21057194 ATCCAGCAGTTCCAGGGCAGAGG - Exonic
1181200159 22:21212638-21212660 GGTCAGGTGGTGCAGGGCTGAGG + Intronic
1181573662 22:23781045-23781067 AGCCTGGGGGCCCAGGGCTGGGG - Exonic
1181701578 22:24624321-24624343 GGTCAGGTGGTGCAGGGCTGAGG - Intronic
1183039091 22:35162699-35162721 AGCCAGGGGTTGCAGGTCAGGGG + Intergenic
1183394672 22:37564644-37564666 AGCCTGGGGCTCCAGGGCTCTGG + Intronic
1183706562 22:39478205-39478227 CCCAAGGTGTACCAGGGCTGGGG + Intronic
1183975065 22:41507231-41507253 AGCCAGGCATCCCAGGCCTGAGG + Intronic
1184081020 22:42220305-42220327 AGCCAGGGGTCCCATGCCTGTGG - Intronic
1184195125 22:42922525-42922547 AGCCAGGTGTGCTCGGGCCGTGG - Intronic
1184367869 22:44063938-44063960 GGCCAGGTGTTCCGTGGATGGGG + Intronic
1185118727 22:48952935-48952957 TGCAAGGGGGTCCAGGGCTGGGG - Intergenic
1185182458 22:49371359-49371381 GGCCTGGTGTTCCATGGCTTTGG - Intergenic
1203226677 22_KI270731v1_random:82286-82308 GGTCAGGTGGTGCAGGGCTGAGG - Intergenic
1203264073 22_KI270734v1_random:3990-4012 GGTCAGGTGGTGCAGGGCTGAGG + Intergenic
950127186 3:10517183-10517205 GGTTAGGAGTTCCAGGGCTGTGG - Intronic
950183498 3:10931152-10931174 AGCCAGCTAGTCAAGGGCTGAGG - Intronic
950949929 3:16987372-16987394 TGCCAGATGTTCCTGGGCTCTGG - Intronic
951202354 3:19889617-19889639 AGGGAAGTTTTCCAGGGCTGTGG - Intronic
952392323 3:32891092-32891114 ATCCAGGTGTTCAAGCCCTGCGG + Exonic
953032844 3:39189344-39189366 TGGCAGGTCCTCCAGGGCTGGGG + Exonic
953813329 3:46132876-46132898 GGCCAGGTGGTGGAGGGCTGAGG + Intergenic
954106732 3:48413639-48413661 AGCCAGATGTGGCTGGGCTGGGG - Intronic
954295104 3:49670129-49670151 AGGCAGGTATTCCATGGGTGGGG - Exonic
954328139 3:49874822-49874844 GGCCAGGTTCTCCAGGGTTGGGG + Intergenic
954697582 3:52435855-52435877 AGCCAGGCCTCCCCGGGCTGGGG + Exonic
955122387 3:56073545-56073567 AGCCTGGTGTCCCAGGGATTGGG - Intronic
955467791 3:59254494-59254516 GGCCAGGACTTCCAGGTCTGAGG + Intergenic
955774385 3:62417753-62417775 GGTCAGGAGTTCCAAGGCTGAGG + Intronic
955902285 3:63769825-63769847 ATGAAGGTGTTCCCGGGCTGCGG + Intergenic
957393027 3:79603393-79603415 AGCCAGAAGTTCAAGGGCTGTGG - Intronic
959108866 3:102097573-102097595 AGCCACATGTTTCAGGTCTGTGG - Intergenic
959701244 3:109301063-109301085 AGCCTTGACTTCCAGGGCTGAGG + Intronic
959903225 3:111683230-111683252 AGCCAGGTGTCCCAGTGCAGAGG + Intronic
960149018 3:114232301-114232323 GGCCTGGAGGTCCAGGGCTGGGG + Intergenic
960561115 3:119084832-119084854 GTCCTGGTGTTCCAGGGTTGTGG + Intronic
961410667 3:126717981-126718003 AGCCAAGTGTGCCAGGGTAGCGG + Intronic
961439148 3:126942071-126942093 CACCAGGTGGGCCAGGGCTGGGG - Intronic
962739345 3:138351451-138351473 TGCCAGGTGTCCCAGGTCTCAGG - Intronic
963601314 3:147381078-147381100 AGTCAAGTGTTCCAAGGCTGAGG + Intergenic
964880518 3:161418091-161418113 AGCCAGGTGCTGCAGTGATGAGG + Intergenic
966816950 3:183897103-183897125 AGCTGAGTGTTCTAGGGCTGGGG - Intergenic
966838387 3:184067681-184067703 AAACAGATGTTCCAGGGTTGAGG + Intergenic
967194927 3:187017809-187017831 CTCCAGGAATTCCAGGGCTGGGG - Intronic
967710990 3:192707866-192707888 AGCCAGATTTCCCAGGGATGAGG + Intronic
968489609 4:882997-883019 AGTCAGCTGTTCCTGGGCTTTGG + Intronic
968519897 4:1030492-1030514 AGGCCTGTGTTCCAGGGCTCTGG + Intergenic
968964373 4:3762100-3762122 AGCCAGCTCTTCCGGGGCTGCGG - Intergenic
968982685 4:3859010-3859032 AGGCAGGTGCACTAGGGCTGAGG + Intergenic
969702191 4:8773772-8773794 AGCCACGTGTCCCTGGGCTCCGG - Intergenic
970303101 4:14702343-14702365 AGACAGGGGTTCAAGGTCTGTGG - Intergenic
970535790 4:17028580-17028602 AGCCAAGCCTCCCAGGGCTGGGG - Intergenic
971448839 4:26780703-26780725 AGGGAGGTGTTACAAGGCTGGGG - Intergenic
971866619 4:32180307-32180329 AGCCATCTGTTACATGGCTGGGG + Intergenic
973548410 4:52005798-52005820 AGCCAGGTGCTGCTGGACTGAGG - Intronic
974338607 4:60584970-60584992 AGGTAGCAGTTCCAGGGCTGAGG + Intergenic
976324022 4:83750528-83750550 AGCCAGGTGTGTCAGGGTTGAGG + Intergenic
981023244 4:140050559-140050581 AGCCATGTGTTCCACTGCCGTGG + Intronic
982131112 4:152229414-152229436 CGACAGTTTTTCCAGGGCTGTGG - Intergenic
985005338 4:185529567-185529589 AGGCAGGTGCTGCAGGGCTGTGG - Intronic
988650046 5:33139027-33139049 AATCAGATGTTCCAAGGCTGAGG + Intergenic
989576453 5:42992652-42992674 AGCCTGGCGTTCCCGGGCGGCGG + Intergenic
992658869 5:78938177-78938199 AAGCAGAGGTTCCAGGGCTGGGG - Intronic
992701154 5:79343110-79343132 CCCCAGGTGCTGCAGGGCTGAGG - Intergenic
995750900 5:115452270-115452292 AGCCAGGTGTTAAAGGTCTAGGG - Intergenic
997361265 5:133296599-133296621 AGCCAGGTGTTGAAGGGGTGAGG - Intronic
997429435 5:133827260-133827282 AGCCAGGTGTGTCTGTGCTGGGG - Intergenic
997634122 5:135392000-135392022 AGGCATGTGAGCCAGGGCTGGGG - Intronic
999062850 5:148654269-148654291 GCCCAGGTGATCCGGGGCTGGGG - Intronic
999315673 5:150582468-150582490 AGCCAGATGTTCCTGGCCTTTGG + Intergenic
999978582 5:156936962-156936984 ATCCAGGTGGTACAGGACTGGGG - Intronic
1000157426 5:158565443-158565465 ACACAAGTGTTCCAGTGCTGTGG + Intergenic
1000398112 5:160797123-160797145 AGCCAGGGGTTCCTGGGCCCTGG - Intronic
1000765382 5:165283023-165283045 AGAATGGTGTTCCAGTGCTGAGG - Intergenic
1001614818 5:173034224-173034246 GGCCAGGTTTTGCAGGGCTGTGG - Intronic
1001657713 5:173365276-173365298 AGCCATGAGTTTCAGGGCTGTGG + Intergenic
1001823128 5:174725095-174725117 GGGCGGGTGTTCCAGGGCTGAGG + Intronic
1001924307 5:175625291-175625313 AGTCTGGTGGTCCAGGACTGAGG - Intergenic
1001961688 5:175883640-175883662 AGCCTGGTCTCCCAGGCCTGAGG + Exonic
1002173098 5:177386131-177386153 AGCCAGGTGGGCCTGGGCTGGGG + Exonic
1004036778 6:11931938-11931960 GGCCAGGTGCTCCAGGGCCTTGG + Intergenic
1005282087 6:24284849-24284871 AGCCAATTGTGCCAGGGATGAGG - Intronic
1006276056 6:33006517-33006539 GGCCAGTTCTTCCAGGGGTGAGG - Exonic
1006509154 6:34512413-34512435 AGAAAGATGATCCAGGGCTGGGG + Intronic
1007495734 6:42259443-42259465 AGCCCGGTGCGCCAGGGCTCGGG - Exonic
1007761620 6:44136597-44136619 AGCCAGGAGTTCAGGGCCTGGGG - Intronic
1008231541 6:48989888-48989910 AGCCAGGTGTACCCGTGCTTGGG + Intergenic
1008313074 6:50002382-50002404 AGGCAGGTTTTTCAGGGCTAGGG + Intergenic
1008943656 6:57073735-57073757 AGCCACATTGTCCAGGGCTGTGG - Intergenic
1014535791 6:122611155-122611177 TGCCAGGTGGTCGCGGGCTGAGG + Intronic
1017717351 6:157222229-157222251 ACCCAGGACTTCCAGGGATGTGG - Intergenic
1017747856 6:157462777-157462799 CGCCAGGCCCTCCAGGGCTGGGG - Intronic
1017862647 6:158413286-158413308 CGCCACGTGCTCCAGAGCTGGGG + Intronic
1017881072 6:158562961-158562983 AGCCAGGTGGCCCAGGGTTTGGG - Intronic
1019485937 7:1289198-1289220 TGCCAGATCTTCCGGGGCTGCGG - Intergenic
1019774857 7:2906422-2906444 GGCCAGGTCAGCCAGGGCTGGGG + Exonic
1019883736 7:3885542-3885564 AGCCAGGTGGTACAGGCCTGAGG - Intronic
1020290460 7:6718748-6718770 GGCCAGGAGCTTCAGGGCTGCGG + Intergenic
1021848269 7:24783703-24783725 AGGCAGGGGTTCTGGGGCTGAGG + Intergenic
1023825270 7:44004789-44004811 GGCCAGGAGCTTCAGGGCTGCGG - Intronic
1023860732 7:44216434-44216456 GGCCAGGTGCTACAGGCCTGTGG - Intergenic
1023908702 7:44539363-44539385 GGCCAGTTCTTCCAGGGCTGGGG - Exonic
1024223076 7:47303339-47303361 AGCCAGGCCTTCCTGGGCTTCGG - Exonic
1024724628 7:52178294-52178316 ATTCAGGGGTTCAAGGGCTGAGG + Intergenic
1025740609 7:64192782-64192804 TGGCAGATGTCCCAGGGCTGTGG + Intronic
1026088819 7:67283560-67283582 GGCCAGGAGATTCAGGGCTGCGG - Intergenic
1026287435 7:68975630-68975652 AGCCAGGTGTGCCAGAGATGAGG - Intergenic
1026807839 7:73438837-73438859 AGCCAGGAGGCCCAGGGCTGGGG + Intergenic
1026888639 7:73969388-73969410 AGCCATGGGCTCCAGGGCAGGGG - Intergenic
1027118411 7:75498878-75498900 GGCCAGGAGCTTCAGGGCTGCGG - Intergenic
1029123699 7:98283883-98283905 GGCCAGATATCCCAGGGCTGGGG + Intronic
1029719079 7:102351142-102351164 GGCCAGGAGCTTCAGGGCTGCGG + Intergenic
1029771483 7:102657200-102657222 GGCCAGGAGCTTCAGGGCTGCGG - Intronic
1030068596 7:105679371-105679393 AGACAGCAGCTCCAGGGCTGCGG - Intronic
1031979036 7:128112544-128112566 AGCCAGGGGTCCCGGGGCCGTGG - Intergenic
1032027630 7:128456088-128456110 AGCCTCGCGTTCCAGGGCTGGGG + Intronic
1032581210 7:133105167-133105189 AGCCAACTACTCCAGGGCTGGGG - Intergenic
1032760155 7:134933050-134933072 AGCCAGGCGCTCCAGGAATGCGG - Exonic
1033392446 7:140940719-140940741 AGCCAGCTGTTTCAGGGTGGTGG - Intergenic
1033546487 7:142405870-142405892 AGCCAGATTTCCCAGGGCTCTGG + Intergenic
1034257653 7:149733407-149733429 AGCCAGGCCTGCCAGCGCTGTGG - Exonic
1034280786 7:149852892-149852914 AGCCAGGCCTTACAGAGCTGGGG + Intronic
1035056536 7:156039940-156039962 AGCCGGGTGTCCCAGGCCTCGGG + Intergenic
1036420422 8:8590432-8590454 AGTCAAGGGGTCCAGGGCTGGGG + Intergenic
1037106859 8:15119388-15119410 AGCATGGTGGTCCAGGCCTGTGG + Intronic
1037836184 8:22216054-22216076 AACCAGATGTTCAAGGGGTGGGG - Intergenic
1039409874 8:37343812-37343834 AGTCAGGTGTTCCTGGTCAGTGG - Intergenic
1039791880 8:40882729-40882751 TACCAGGTGTTTCAGAGCTGGGG + Intronic
1041504930 8:58585965-58585987 AGCCATCTGTTCCTGTGCTGAGG + Exonic
1044368973 8:91386092-91386114 AGCCATGTTTGCCATGGCTGTGG + Intronic
1045017359 8:98010888-98010910 AGCTTGGCCTTCCAGGGCTGAGG + Intronic
1045363252 8:101452301-101452323 AGCCCGGTGAGCCAGGCCTGAGG + Intergenic
1045607891 8:103798768-103798790 ATCCAGGGGTTCCAGGGATCAGG - Intronic
1046129837 8:109954027-109954049 TGTTAGGTGTTCCAGGCCTGGGG + Intergenic
1047707518 8:127514601-127514623 AGGCAGATGTCCCAGGGCCGGGG - Intergenic
1048107798 8:131430352-131430374 AGCCTGGACCTCCAGGGCTGAGG - Intergenic
1048202826 8:132390967-132390989 AGACAGGCTTTCCAGAGCTGAGG - Intronic
1048281087 8:133106144-133106166 AGCGAGGGGCTCCAGGGCTGTGG + Intronic
1048292557 8:133191849-133191871 AGCCTGCTGTTCCAGGGTGGGGG + Intronic
1048844484 8:138594054-138594076 AGCCAGGTCGTCCTGGGCAGGGG - Exonic
1048845153 8:138598719-138598741 AGCCGGGATTTCCAGGACTGAGG - Exonic
1049039007 8:140098490-140098512 AGCCGGGTGTTCCTGCCCTGCGG - Intronic
1049237499 8:141519402-141519424 AGGGAGGTGGTCCAGGGCAGAGG - Intergenic
1049242107 8:141543342-141543364 TGCCTGGTGTTCCTTGGCTGGGG - Intergenic
1049265904 8:141667793-141667815 AGCCACGTGTGCCAGGGCCTGGG + Intergenic
1049554324 8:143274616-143274638 CGCCACGTGCTCCCGGGCTGTGG - Intronic
1051339387 9:16097163-16097185 CACCTGGGGTTCCAGGGCTGGGG - Intergenic
1053641068 9:40080619-40080641 AGCCAGGAAATCCAGGGATGTGG - Intergenic
1053765069 9:41384849-41384871 AGCCAGGAAATCCAGGGATGTGG + Intergenic
1054543684 9:66296011-66296033 AGCCAGGAAATCCAGGGATGTGG + Intergenic
1055821278 9:80267472-80267494 AGCCAGGTGGTCCTGGCCTCTGG + Intergenic
1056806900 9:89736038-89736060 AAACAGGTGTCACAGGGCTGAGG + Intergenic
1056808062 9:89743990-89744012 AGCCAGGAGGCCCAGGGCAGGGG - Intergenic
1056965708 9:91161510-91161532 AGCCAGGTGTTAGAGGGCTATGG - Intergenic
1058523594 9:105835917-105835939 AGCAAGCTGTTCCGGAGCTGCGG - Intergenic
1058725049 9:107795010-107795032 AGCCAGGGGGTCGGGGGCTGGGG - Intergenic
1059813136 9:117879298-117879320 ATGCAGGTGTGCTAGGGCTGGGG + Intergenic
1060820520 9:126659001-126659023 AGGCGGGTGTTCTGGGGCTGGGG + Intronic
1060945636 9:127568347-127568369 CGCCACGTGTACCAGGGCTGGGG + Intronic
1060962505 9:127690952-127690974 AGCCAGGGCGTGCAGGGCTGGGG - Exonic
1060984204 9:127810243-127810265 TGCCAGGTGCTGCAGGGCCGTGG + Intronic
1061871005 9:133520500-133520522 AGCGAGGTGTTTAGGGGCTGGGG + Intronic
1062212993 9:135374519-135374541 TGCCAGGCGTGCCAGGGCTGAGG + Intergenic
1062355145 9:136158358-136158380 TGCCAGGTTTTCCAGGGATGTGG + Intergenic
1062503463 9:136861175-136861197 CACCAGGTGCCCCAGGGCTGTGG + Intronic
1062717888 9:138020282-138020304 ACCCAGCTGTTCCAGGGAGGAGG - Intronic
1186608065 X:11111734-11111756 AGCCAGGAGGTACAGGCCTGAGG - Intronic
1187567899 X:20470684-20470706 AGAGGGGTGATCCAGGGCTGGGG + Intergenic
1189245291 X:39558647-39558669 CCCCAGGTGTTCCTCGGCTGTGG - Intergenic
1190048230 X:47129543-47129565 AGCCAGGTGTGACAGTTCTGAGG - Intergenic
1191634397 X:63360343-63360365 AGCCACATCATCCAGGGCTGTGG + Intergenic
1194626748 X:96234270-96234292 AGCCAGCTGCTCCAGGACAGTGG - Intergenic
1195161509 X:102176240-102176262 AGCCACATCGTCCAGGGCTGTGG + Intergenic
1195321438 X:103724781-103724803 AGGCTGGAGGTCCAGGGCTGGGG - Intronic
1196008697 X:110863408-110863430 AGCCAAGTGAGCCAGTGCTGGGG + Intergenic
1196699711 X:118654749-118654771 AGCCAGGTTTTCCTGAGCTCTGG - Exonic
1196742036 X:119033569-119033591 AGCTGGGAGTTCCTGGGCTGGGG - Intergenic
1198088678 X:133305902-133305924 ATGCAGGTTTTCCAGGGATGTGG - Exonic
1198452661 X:136783417-136783439 AGCAAGGAATTCCAGGGCAGTGG + Intergenic
1201401786 Y:13611388-13611410 AGCCACATTGTCCAGGGCTGTGG - Intergenic
1201503059 Y:14666808-14666830 AACCAGGTGTTTCAGGTTTGAGG + Intronic