ID: 1145959481

View in Genome Browser
Species Human (GRCh38)
Location 17:28879129-28879151
Sequence GGTGTTCCAGGGCTGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 437}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145959474_1145959481 -8 Left 1145959474 17:28879114-28879136 CCTGTGATGGAGCCAGGTGTTCC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG 0: 1
1: 1
2: 3
3: 38
4: 437
1145959471_1145959481 2 Left 1145959471 17:28879104-28879126 CCACCTTCTGCCTGTGATGGAGC No data
Right 1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG 0: 1
1: 1
2: 3
3: 38
4: 437
1145959472_1145959481 -1 Left 1145959472 17:28879107-28879129 CCTTCTGCCTGTGATGGAGCCAG No data
Right 1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG 0: 1
1: 1
2: 3
3: 38
4: 437
1145959468_1145959481 6 Left 1145959468 17:28879100-28879122 CCCTCCACCTTCTGCCTGTGATG No data
Right 1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG 0: 1
1: 1
2: 3
3: 38
4: 437
1145959469_1145959481 5 Left 1145959469 17:28879101-28879123 CCTCCACCTTCTGCCTGTGATGG No data
Right 1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG 0: 1
1: 1
2: 3
3: 38
4: 437
1145959467_1145959481 7 Left 1145959467 17:28879099-28879121 CCCCTCCACCTTCTGCCTGTGAT No data
Right 1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG 0: 1
1: 1
2: 3
3: 38
4: 437
1145959466_1145959481 16 Left 1145959466 17:28879090-28879112 CCTGCTAGTCCCCTCCACCTTCT No data
Right 1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG 0: 1
1: 1
2: 3
3: 38
4: 437
1145959465_1145959481 17 Left 1145959465 17:28879089-28879111 CCCTGCTAGTCCCCTCCACCTTC No data
Right 1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG 0: 1
1: 1
2: 3
3: 38
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145959481 Original CRISPR GGTGTTCCAGGGCTGGGGTT TGG Intergenic
900394181 1:2446391-2446413 GGTCTCCCGGGGCTGGGGGTGGG + Intronic
900410747 1:2511420-2511442 GGTGCTCCAGGTCAGGGGTCAGG + Intronic
900411295 1:2513851-2513873 GTGGTGCCAGGGCTGGAGTTGGG + Intronic
900430182 1:2597663-2597685 GCTGCTCCAGGGCTGGGGTGAGG - Intronic
901000907 1:6148350-6148372 CCTGTTCCAAGGCTGGGGATAGG - Intronic
901143420 1:7050231-7050253 GGTGGTGAAGGGCTGGGGGTAGG + Intronic
901638131 1:10679865-10679887 GGAGTCCCAGGGCTGGGACTTGG - Intronic
902237674 1:15068244-15068266 GGACTTCCAGGGCTGGGTTCTGG + Intronic
902873991 1:19330237-19330259 GGTTTTCCACAGCTAGGGTTGGG - Intergenic
902978606 1:20107495-20107517 GCAGTTCCTGGGCTGGTGTTTGG + Intergenic
903317800 1:22522292-22522314 AGAGTAACAGGGCTGGGGTTGGG - Intronic
903529451 1:24018978-24019000 GCTGTGCCAGGGCTGGGCCTGGG + Intergenic
903674813 1:25056844-25056866 GGGGAACCAGGGCTGGGGTTTGG - Intergenic
903943599 1:26948214-26948236 GGTGCTCTAGGGCTGAGGCTTGG + Intergenic
904046501 1:27612408-27612430 AGTGGTCCAGGACTGGGGTCTGG - Exonic
904125638 1:28236469-28236491 GGAGATCCAGGGCTGGACTTGGG - Intronic
904328336 1:29741959-29741981 GGTCCTCCAGGGCTGGGGCTAGG - Intergenic
906145357 1:43557303-43557325 GGTCTTTCAGGCCTGGGGTGAGG + Intronic
907029208 1:51153924-51153946 CTTGTTCCAGGGCTGGTGCTTGG - Intergenic
907048293 1:51313362-51313384 GGCGGCCCAGGGGTGGGGTTTGG - Intronic
907520312 1:55019542-55019564 GTTGTTGCTGGGCTGGGTTTTGG + Intergenic
907901708 1:58747508-58747530 TGTATTCCAGGGCTGGGCTTTGG - Intergenic
908058733 1:60323222-60323244 GGGGTTGCAGGGCTGGGGTACGG - Intergenic
908728789 1:67204778-67204800 TTTTTTCCAGGGTTGGGGTTGGG + Intronic
910399852 1:86827548-86827570 GGTATTGCTGGGCTGGGGTCAGG + Intergenic
911240800 1:95463684-95463706 GTTGTTGCAGGGCTGAGGTATGG + Intergenic
911792967 1:102041454-102041476 GGTGTTCCAGCGGTGGGCTGGGG + Intergenic
912572427 1:110634278-110634300 GGTGTTGCAGAGCTGGGGGGTGG + Intergenic
912978476 1:114350368-114350390 AGTGGTCCAGGGCTGGTGTGTGG + Intergenic
914195682 1:145446882-145446904 CGTGTTCTGGGGCTGGGGCTGGG - Intergenic
914780183 1:150778719-150778741 GGTGATCTTGGGCTAGGGTTAGG - Intergenic
915098348 1:153480190-153480212 GGAGTGGCAGGGCTGGGGCTGGG - Intergenic
919090463 1:192972878-192972900 GGTTTTCAGGGGCTGGGGTTGGG - Intergenic
919532565 1:198742222-198742244 GGTTTGCCAGTGCTGGTGTTGGG + Exonic
919788528 1:201275485-201275507 GGCTATACAGGGCTGGGGTTGGG + Intergenic
920072318 1:203311275-203311297 GGGGAGCCAGGGATGGGGTTAGG + Intergenic
920076578 1:203341679-203341701 GGCTTTCCAGGGGTGAGGTTAGG + Exonic
920194308 1:204216814-204216836 TGGGTTCCATGGCTGGGGGTGGG - Intergenic
921054697 1:211535021-211535043 GGTGGTCCTGGGCTGGGCTGGGG - Intergenic
922567265 1:226608856-226608878 GGTCTGCCGGGGCTGGGGCTGGG - Exonic
922773322 1:228201710-228201732 GGGGTTCAAGGGCTCGGGTCGGG - Intergenic
923523352 1:234753149-234753171 GGTTTTCCAGAGCTCGGTTTGGG - Intergenic
1062967759 10:1623151-1623173 GGTTGCCCAGGGCTGGGGGTGGG + Intronic
1064119092 10:12603834-12603856 TGTGTTCCAGGGCTGGAGATGGG - Intronic
1064715359 10:18171370-18171392 GGTATTCCTGGGCTGGGGGCAGG + Intronic
1065131990 10:22631397-22631419 GGTGGGCCTGGGCTGGGGATGGG - Intronic
1065268517 10:24002325-24002347 GGTTGTCCAGGGCTGGGCCTGGG + Intronic
1067142186 10:43667368-43667390 GGTTTTCCGAGGCAGGGGTTGGG - Intergenic
1067469327 10:46524649-46524671 GGAGTTTCAGTGCTGGGGCTTGG + Intergenic
1067566824 10:47345635-47345657 GGTGCTGCAGGGCTGGGCTCTGG + Intergenic
1068083326 10:52346718-52346740 GGTCTTCCAGGGGCGGGCTTTGG - Intergenic
1068259259 10:54556870-54556892 GGAGTGGCAGGGTTGGGGTTGGG + Intronic
1068388657 10:56363238-56363260 GCTTGTCCAGGGCTGGGGATTGG + Intergenic
1069567625 10:69474272-69474294 GGAGTTCCAGGGAAGGGGTATGG - Intronic
1069716469 10:70524252-70524274 GATGGTCCAGGACTGGGGATCGG - Intronic
1070056167 10:72936577-72936599 GGTTGTCTAGGGCTGGGGTGGGG + Intronic
1070314616 10:75298126-75298148 GGTAGTCTGGGGCTGGGGTTGGG - Intergenic
1070784798 10:79156604-79156626 GGGCTTCCAGGGCTGGGCTTCGG + Intronic
1071168442 10:82834264-82834286 AGTGTTCCAGGGCAGGGTTAAGG - Intronic
1071400538 10:85265045-85265067 GGTATTCCAGGGCTGTGGATAGG - Intergenic
1072279171 10:93850627-93850649 GCAGTTCCAGGCCTGAGGTTGGG - Intergenic
1072636861 10:97183965-97183987 TGTGTTACAGGGCTGGGGAGAGG - Intronic
1072686736 10:97542137-97542159 GCTGTTCCAGGGCGGGGGTCAGG + Intronic
1073095154 10:100974992-100975014 GGTGGGCCAGGGGTGGTGTTGGG + Intronic
1073102775 10:101015601-101015623 CGTGTGCCAGGGCTGCGGATGGG + Intronic
1073463469 10:103679872-103679894 GGTGCTCCAGGGCTGAGCTGAGG + Intronic
1074537726 10:114340720-114340742 GCTGTTCCAGGGCTAGGGACAGG + Exonic
1075512380 10:123083066-123083088 GGTGCTCCTGGTCTGGGGTCTGG - Intergenic
1075629688 10:123993697-123993719 GCTGGGCTAGGGCTGGGGTTGGG - Intergenic
1075994955 10:126869758-126869780 GTAATTACAGGGCTGGGGTTTGG + Intergenic
1076013187 10:127006746-127006768 TGTGTTCCAGGGCTGGGCACTGG + Intronic
1076059194 10:127400367-127400389 GGTGACCCAGGTCTGGGGCTTGG + Intronic
1076415037 10:130279956-130279978 GGGGTTCCAACGCTGGGCTTTGG + Intergenic
1076574928 10:131458313-131458335 GGTTTTCCGGGGCTGGGTTGTGG - Intergenic
1076681037 10:132171329-132171351 GGTGGTCCAGGGCTGGGAGTGGG - Intronic
1076786755 10:132753647-132753669 GCTGTCCCAGGGCCGGGCTTGGG + Intronic
1076905114 10:133357605-133357627 GGGGTCCCGGGGCAGGGGTTGGG - Intronic
1076913127 10:133402245-133402267 GGTGAGCCGGGGCTGGGGCTGGG + Exonic
1077012347 11:384917-384939 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012361 11:384955-384977 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012375 11:384993-385015 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012389 11:385031-385053 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012403 11:385069-385091 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012417 11:385107-385129 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012431 11:385145-385167 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012445 11:385183-385205 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012459 11:385221-385243 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012473 11:385259-385281 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012487 11:385297-385319 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012501 11:385335-385357 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012515 11:385373-385395 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012529 11:385411-385433 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012543 11:385449-385471 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012557 11:385487-385509 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012571 11:385525-385547 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012585 11:385563-385585 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012599 11:385601-385623 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012613 11:385639-385661 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012627 11:385677-385699 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077473863 11:2777336-2777358 GGTGATCCTGGGGTGGGGTTTGG + Intronic
1078735572 11:14017035-14017057 TATGTTCCAGGGCTGGTGTCAGG + Intronic
1078755613 11:14206008-14206030 GGTTTTAGAGGGCTGGGGTTAGG - Intronic
1078914117 11:15761781-15761803 TGTGTTGCAGGGCAGGGGTGGGG - Intergenic
1079236352 11:18693407-18693429 GGAATGCCTGGGCTGGGGTTGGG + Intronic
1081867330 11:46366954-46366976 GGCGCTCCAGGCCTGGGGTCCGG - Exonic
1081967290 11:47177617-47177639 GGGGTTCCTGGGGTGGGCTTGGG - Exonic
1081992779 11:47346644-47346666 GCTGCTCCAGGGGTGGGGGTGGG + Exonic
1082945838 11:58758186-58758208 GGTCTTCCAGTGCTGGAGTAAGG - Intergenic
1083309758 11:61778164-61778186 GAGGTTCCTGGGCTGGGGTGGGG - Intronic
1083698708 11:64459642-64459664 AGTTTCCCAGGGCTGGGGTCGGG - Intergenic
1083714667 11:64568511-64568533 GGCTGCCCAGGGCTGGGGTTGGG - Intronic
1084503747 11:69552709-69552731 GGTGTTTCAGGCCTAGGATTTGG + Intergenic
1084503780 11:69552829-69552851 GGTGTTTCAGGCCTAGGATTTGG + Intergenic
1084503812 11:69552949-69552971 GGTGTTTCAGGCCTAGGATTTGG + Intergenic
1084526056 11:69698653-69698675 GTTGTCCCAGGGCTGGAGTGGGG + Exonic
1084574507 11:69980249-69980271 GTGGTGCCAGCGCTGGGGTTAGG + Intergenic
1087658411 11:100955422-100955444 GGAGATACAGGGCTGGGGTAGGG + Intronic
1089351742 11:117825211-117825233 GGTGCTCCAGGGATGTGGTGGGG - Intronic
1089536093 11:119161540-119161562 GGAGTTCCAGGGCTGGGCCCTGG + Exonic
1089673195 11:120071475-120071497 GGTGGGCCAGGGATGGGGGTTGG - Intergenic
1091638099 12:2213425-2213447 GGTCTTCCAGGGCTGGGGTGAGG + Intronic
1091729384 12:2868805-2868827 GTTCTTCAAGGGCTTGGGTTGGG - Intronic
1092071855 12:5637723-5637745 GGTGTGCCAGGGGTGGGGCTAGG - Intronic
1092778397 12:11963869-11963891 GGTGCTCCTGAGCAGGGGTTGGG + Intergenic
1097037225 12:56131833-56131855 AGTGTTCCAGCGCTGGGTTGGGG + Intronic
1098241096 12:68467936-68467958 GCTCTTCCAGGGCTGGAGCTGGG + Intergenic
1098253978 12:68597913-68597935 GGTGGTCAGGGGCTGGGGTGAGG - Intergenic
1101545847 12:105712036-105712058 GGTTTGGCATGGCTGGGGTTGGG + Intergenic
1101570238 12:105946876-105946898 GGTGGTTAAGAGCTGGGGTTTGG + Intergenic
1101649076 12:106658590-106658612 GCTCCTCCAGGGTTGGGGTTGGG + Intronic
1101942618 12:109111186-109111208 GCTGCTCCAGGCCGGGGGTTGGG - Intergenic
1102505111 12:113379645-113379667 GGAGTTCTAGGGCAGGGGTGAGG + Intronic
1105822843 13:24095394-24095416 GGTTACCCAGGGCTGGGGTAGGG + Intronic
1105975345 13:25468291-25468313 GCTGGTCCAGAGCTGGGGTTGGG + Intronic
1106077760 13:26475779-26475801 GGAGCTGCAGGGCTGGGCTTAGG + Intergenic
1106584595 13:31046020-31046042 AGGGTTCCAGGGGTGGGGTGGGG + Intergenic
1107090972 13:36479075-36479097 GAATTTCCAGGGCTGGGGATGGG - Intergenic
1107401995 13:40078061-40078083 TTTGTTCCTGGGCGGGGGTTGGG + Intergenic
1107514683 13:41117663-41117685 GGTTTTCAGGGGCTGGGGATAGG - Intergenic
1112377022 13:98852416-98852438 GCTGTACCTTGGCTGGGGTTGGG + Intronic
1113784073 13:112993291-112993313 GGTGTTCCTGGGCAGAGGCTTGG + Intronic
1114260423 14:21032595-21032617 TTTGTTCCAGAGCTGGGGTAAGG + Intronic
1114526113 14:23367683-23367705 GGTCCCCCAGGGCTGGGGTCTGG - Intergenic
1115332310 14:32211658-32211680 GTTGTTCAAGGGCTGGGACTGGG - Intergenic
1116945094 14:50829750-50829772 GGGTTGTCAGGGCTGGGGTTAGG + Intronic
1118713798 14:68544960-68544982 GGAGTTCCAGGGATGGGATGTGG + Intronic
1119864191 14:77959424-77959446 GTGATTCCAGGGCTGGGGTAGGG + Intergenic
1121103488 14:91265228-91265250 GCTCTTCCAGGGCTGAGTTTGGG + Intergenic
1121391489 14:93579725-93579747 TGAATTCCAGGGCTGGGGCTAGG - Intronic
1122172166 14:99885905-99885927 CGTGTTCTAGGGCTTGGGTGAGG - Intronic
1122228096 14:100291380-100291402 GGTGTTCCAGGCCTGGTGAGGGG + Exonic
1122880528 14:104688817-104688839 GGACTTCCAGAGCTGGGGTCTGG + Intergenic
1123055106 14:105565893-105565915 GAAGATGCAGGGCTGGGGTTGGG + Intergenic
1123079554 14:105685737-105685759 GAAGATGCAGGGCTGGGGTTGGG + Intergenic
1125310308 15:38372024-38372046 GGTGTGCTGGGGCTGGGGTAGGG - Intergenic
1125322271 15:38501105-38501127 GGTGCTCCAGGGCTGAATTTGGG - Intronic
1125728512 15:41880322-41880344 GGTGGCCCAAGGCTGGGGTGAGG + Intronic
1127354733 15:58187459-58187481 TGTGTGTCAGGGCTGGGGGTGGG + Intronic
1128457015 15:67836756-67836778 GGAGTCCCAGGTCTGGGGTAAGG + Intergenic
1128707190 15:69845191-69845213 GGTGTTCCAGAGCAGTGGTAGGG - Intergenic
1129391663 15:75223904-75223926 GGTCTTCCAGGGCAGGTGTGGGG - Intergenic
1129412794 15:75359217-75359239 GGTGAGGCGGGGCTGGGGTTGGG - Intronic
1129467561 15:75732388-75732410 GCTGATCCAGGGCTGGGGCCAGG + Intergenic
1129600182 15:76994233-76994255 GGCGTCTCAGGGCTGGGGCTGGG + Intronic
1129688104 15:77697749-77697771 TCTGATCCAGGGCTGCGGTTTGG + Intronic
1129840560 15:78740784-78740806 GGTGGGGCAGGCCTGGGGTTGGG + Intergenic
1129996615 15:80012112-80012134 GGTTTTCTGGGGCTGGGGTATGG + Intergenic
1130374472 15:83316189-83316211 GGTTTTCAAGAGCTGGGGGTGGG - Intergenic
1132694374 16:1195354-1195376 GCTCTTGCGGGGCTGGGGTTGGG + Intronic
1133094430 16:3431864-3431886 GGAGATCCAGTGGTGGGGTTTGG - Intronic
1134005709 16:10817987-10818009 TGTGTGCCAGGTCTGGGGCTGGG - Intronic
1134023284 16:10936684-10936706 GGTGTTCCAAGGTCGGGGATGGG + Intronic
1135045864 16:19154867-19154889 GGTTTCCCAGGGCTGGGAATGGG - Intronic
1135591235 16:23706379-23706401 GGTGTTCCAGCGCAGGGCTGGGG + Exonic
1135815721 16:25631142-25631164 GGTTGTCAAGGGCTGGGGGTTGG + Intergenic
1136251676 16:29009490-29009512 GGTGTGCGGGGGCTGGGGCTGGG + Intergenic
1136367208 16:29814322-29814344 GCTGTTCCGGGACTGGGGTTAGG - Exonic
1136398439 16:30005276-30005298 GGGGTTCTGGGGCTGGGGTCGGG + Exonic
1136412661 16:30086159-30086181 GGGGCTCCAGGGCTGGGGGAAGG + Exonic
1137372085 16:47916804-47916826 GATTTTCCAGGGCTGTGGGTTGG + Intergenic
1137888520 16:52132691-52132713 GGGTACCCAGGGCTGGGGTTTGG + Intergenic
1140813037 16:78596545-78596567 GGTGTTCCAAGACTGGGGACAGG + Intronic
1141153605 16:81581776-81581798 GGGGTGGCAGAGCTGGGGTTGGG + Intronic
1141198991 16:81882851-81882873 GGTCCTCCAGGTCTGGGTTTGGG + Intronic
1141214565 16:82011361-82011383 AGTGGGCCTGGGCTGGGGTTGGG - Intronic
1141512212 16:84519728-84519750 GGGGTTCCAGCCCTGGTGTTGGG - Intronic
1141797736 16:86286400-86286422 GGTGGTCCAGGGCTGGTGCGGGG + Intergenic
1142125843 16:88409890-88409912 GGCGTTCCAGGGCTCTGGGTGGG + Intergenic
1142429530 16:90018962-90018984 GGGGTTCCGGGGCTGGAGTTTGG - Intronic
1142472045 17:170099-170121 GGTGGTCCAGGCCTGGGGACTGG - Intronic
1142482189 17:225876-225898 GATGTCCCAGGACTGGGGTTAGG + Intronic
1142598239 17:1039929-1039951 TGAGTGCCAGGGCAGGGGTTGGG + Intronic
1142969752 17:3603352-3603374 TGTGTTCCAGGGCAGGGACTGGG + Intergenic
1143119652 17:4598941-4598963 GGTGGGCCAGGGCCGGGGCTGGG - Intronic
1143409106 17:6697783-6697805 GGTGGTCCTGGGGTGGGGTCTGG + Intronic
1143444841 17:7001611-7001633 GGGGTTGGAGAGCTGGGGTTGGG - Exonic
1143863143 17:9905514-9905536 GCTGTTAGAGGGCTGGGGCTGGG - Exonic
1144782535 17:17815233-17815255 GCTGACCCAGGGCTGGGGTTGGG + Exonic
1145239510 17:21231954-21231976 ACTGTGCCAGGGCTGGGCTTTGG + Intergenic
1145959481 17:28879129-28879151 GGTGTTCCAGGGCTGGGGTTTGG + Intergenic
1146652778 17:34616704-34616726 GGAGCTACAGGGCTGGGGATGGG + Intronic
1148047163 17:44751183-44751205 AGTGTTCCAGCCTTGGGGTTTGG - Exonic
1149172355 17:53825450-53825472 GTTGTTCCGTGGGTGGGGTTGGG + Intergenic
1149495771 17:57116335-57116357 GTTGTGCCAGGGCTTGGGTGAGG + Intronic
1149849920 17:60028243-60028265 GGAGGGGCAGGGCTGGGGTTTGG + Intergenic
1149860248 17:60118281-60118303 GGAGGGGCAGGGCTGGGGTTTGG - Intergenic
1150082947 17:62257470-62257492 GGTTGCCAAGGGCTGGGGTTGGG - Intergenic
1150135125 17:62691175-62691197 GCTGGTCCTGGGCTGGGGCTGGG + Intronic
1150263779 17:63818460-63818482 GGTGTCTCAGGGCTGGGTTGGGG + Exonic
1151497212 17:74466190-74466212 GGAGGTCCAGGCCTGGGCTTCGG - Intergenic
1152204348 17:78966526-78966548 CGAGCTCCAGGGCAGGGGTTCGG + Intergenic
1152293730 17:79454873-79454895 AGTATTCAAGGCCTGGGGTTTGG + Intronic
1152305315 17:79516954-79516976 GGGGTTGCTGGGCTGGGGATGGG + Intergenic
1153336128 18:3926850-3926872 TTTCTTCCAGGGCTGGGGCTGGG + Intronic
1157727559 18:49976667-49976689 TGTCCTGCAGGGCTGGGGTTAGG - Intronic
1158191016 18:54828619-54828641 GGAGTTCCAGGGCTTGGGAAGGG + Exonic
1159334415 18:67044354-67044376 GGTGTCACAGGCCTGGGTTTGGG - Intergenic
1160037008 18:75310637-75310659 GGACTTCCAGGGGTGGGGTTTGG - Intergenic
1160632780 18:80258402-80258424 GGTGTTAGAGGGTTAGGGTTAGG + Intergenic
1160756344 19:758810-758832 GCTGTCAAAGGGCTGGGGTTGGG + Intronic
1160880569 19:1318110-1318132 TGGGTGCCAGGGCTGGGGTGGGG - Intergenic
1161276897 19:3423508-3423530 GGTGATCCATGGGTGGGGCTGGG + Intronic
1161724156 19:5918791-5918813 GGTGTGCCAGGGCTGGCCTCAGG - Intronic
1161784796 19:6317548-6317570 GATATTCAAGGGCTGGTGTTTGG - Intronic
1162301588 19:9847986-9848008 GGAGTGCCAGGTCAGGGGTTGGG - Intronic
1162935431 19:13979388-13979410 GCTGGTCCCGGGCTGGGGCTGGG - Intronic
1163114198 19:15179342-15179364 GGTATGCCAGGGCCAGGGTTGGG - Exonic
1163643246 19:18473796-18473818 GGTGGTGCAGGGGTGGGTTTGGG - Intronic
1163718763 19:18887917-18887939 GGGGTGCCAGGGCTGGGGGAGGG - Intronic
1163826975 19:19529320-19529342 GGTGGGCCACGGTTGGGGTTCGG - Intronic
1164476451 19:28579383-28579405 GGGATTCTGGGGCTGGGGTTGGG - Intergenic
1164665017 19:30023965-30023987 GGTGTCCCGGGGTTGGGGATAGG - Intergenic
1165548927 19:36566599-36566621 GGTGTGTGAGGGCTGGGGCTGGG + Intronic
1166464985 19:43024234-43024256 CCTGTTCCAGGGCTGGGTTGTGG - Intronic
1166678174 19:44751889-44751911 AGTGTTCTAGGGGTGGGCTTGGG - Intronic
1166893771 19:46010401-46010423 GGTCTGCCAGGGCTGGTGCTAGG + Intronic
1167571201 19:50290181-50290203 GGTGCTGAGGGGCTGGGGTTGGG - Intronic
1167590853 19:50403482-50403504 GGTGGACCAGGCCTGGGGGTGGG - Exonic
1168235005 19:55057217-55057239 GGTTTTCTAGGGCAGGGGGTGGG + Intronic
1168278012 19:55287680-55287702 AGTGCTCCAGAGTTGGGGTTTGG - Intronic
1168713334 19:58513834-58513856 GGTGGTGCCGGGCTGGGGCTGGG - Exonic
925427563 2:3763085-3763107 GGTGGTCCAGGGGAGGGGTGTGG - Intronic
926348832 2:11976630-11976652 GGTTTTCCTGGGTTGGGGGTGGG + Intergenic
928187877 2:29130545-29130567 GGTTTTCCTGAGCTGGGGGTGGG + Intronic
929731360 2:44496731-44496753 GGTGTTCCAGTTTTGGGCTTGGG + Intronic
929937644 2:46305721-46305743 AGAGTTCCATGGCTGGGGATGGG - Intronic
930725140 2:54674968-54674990 GGTGTTGCGGGGGTGGGGTGGGG - Intergenic
932151352 2:69375144-69375166 GGTTTTCCATGGCTGTGCTTTGG + Intronic
934874448 2:97903155-97903177 GTTGTTCCAGGGCTGTGGCAAGG + Intronic
935684318 2:105670068-105670090 TGTGTTCCAGGGCAGAGGATAGG + Intergenic
936146950 2:109986655-109986677 GGTGGTGCTGGGCTGGGGCTGGG - Intergenic
936151385 2:110024101-110024123 GCAGTTCCAGGGCTGGGGTTGGG + Intergenic
936193290 2:110347268-110347290 GCAGTTCCAGGGCTGGGGTTGGG - Intergenic
936197742 2:110384828-110384850 GGTGGTGCTGGGCTGGGGCTGGG + Intergenic
936244393 2:110813963-110813985 GGTATTCCAGCACTGGGGTCCGG + Intronic
936489175 2:112955787-112955809 GGTGATCCTGAGATGGGGTTTGG - Intergenic
936501569 2:113070757-113070779 GGTTTTTCAGGCCTGGGGTGGGG - Intronic
937030263 2:118733026-118733048 GGTCCACCAGGGCAGGGGTTGGG - Intergenic
937049317 2:118875610-118875632 GGTGGGACAGGGCTGGGGTGTGG - Intergenic
937235350 2:120428617-120428639 TGTGTAGCAGGGCTGGGGTCTGG + Intergenic
937236981 2:120437021-120437043 GGAGTCCCAGGGCTGGGGGAAGG + Intergenic
937361419 2:121232506-121232528 GGTGTCACTGGGCTGGGGATGGG - Intronic
938772312 2:134511013-134511035 TGTGTTCCAGGGCAAGGATTTGG + Intronic
938777046 2:134551058-134551080 TGGGGTCCAGGGCTGGGGGTGGG + Intronic
943017594 2:182532506-182532528 GGTTTCCAGGGGCTGGGGTTAGG + Intergenic
947718333 2:232352744-232352766 GGTGCTCCAGGGCTGTGGGCTGG - Intergenic
947724542 2:232388677-232388699 GGTGCTCCAGGGCTGTGGGCTGG - Intergenic
947729771 2:232421293-232421315 GGTGCTCCAGGGCTGTGGGCTGG - Intergenic
948266545 2:236639001-236639023 GGGGTTGCAGGGGTGGGGGTGGG + Intergenic
948375786 2:237519569-237519591 GCTGTTCCAGGGCTGGGAGAGGG - Intronic
948850813 2:240704455-240704477 TGAGTTAGAGGGCTGGGGTTGGG - Intergenic
948955687 2:241288793-241288815 GGTGTTCCTGGGAAGGGGATGGG + Intronic
949081602 2:242104975-242104997 TTGGTTCCAGGGCTGGGGTAGGG + Intergenic
1168737938 20:160106-160128 GGTGTTCTAGGGCTGGTATAGGG + Intergenic
1168954064 20:1821967-1821989 GCTGTGCCAGGGAGGGGGTTGGG - Intergenic
1169031738 20:2414870-2414892 GGTTGCCTAGGGCTGGGGTTGGG + Intronic
1169208445 20:3752875-3752897 GCTCTTCCATGGCTGGGGTGGGG - Exonic
1170307488 20:14955703-14955725 GCAGTTGCAGGGCTGGGGGTGGG - Intronic
1170783762 20:19449805-19449827 GCCCTTCAAGGGCTGGGGTTTGG - Intronic
1171312271 20:24154144-24154166 TGTGCTCCATGTCTGGGGTTAGG - Intergenic
1171468056 20:25346302-25346324 GGTCATCCAGGGATGGGGTAGGG + Intronic
1172006586 20:31822593-31822615 GGTGCGGCAGGGCTGGGGGTGGG + Intronic
1172119487 20:32589416-32589438 GAAGTTCCAGGCCTGGGGTGGGG + Intronic
1172995378 20:39066547-39066569 GGTGTTCCTGGGATTGGGGTTGG + Intergenic
1173280660 20:41624199-41624221 GGTTTCCCAGGCCTGGGGGTGGG - Intergenic
1174452747 20:50629859-50629881 GGTCTTCCACGGGCGGGGTTGGG - Intronic
1175206553 20:57316089-57316111 GGTGTCACGGGGCTGGGGTGGGG + Intergenic
1175206563 20:57316114-57316136 GGTGTCACAGGGCTGGGGTGGGG + Intergenic
1175437940 20:58967857-58967879 GGTGGTGCAGGGCTGGAGCTGGG - Intergenic
1175691467 20:61068620-61068642 GGTCTCCCAGGGCTGGAGTCAGG + Intergenic
1175842401 20:62037571-62037593 GGACTTCCAGGGCTGGTGGTCGG - Intronic
1175858824 20:62138335-62138357 TGTGTTCCAGGGCTGGCCCTGGG - Intronic
1178164910 21:29962307-29962329 GGGTTTCCAGGCTTGGGGTTGGG + Intergenic
1178698606 21:34815442-34815464 AACGCTCCAGGGCTGGGGTTGGG + Intronic
1179185120 21:39079707-39079729 GCTCTTGCAGGGGTGGGGTTGGG - Intergenic
1180236073 21:46459635-46459657 GGTGTCCCGGGGCTGAGGGTCGG - Intronic
1180715768 22:17871271-17871293 GGTGTTCAAGGCCTGGTCTTTGG - Intronic
1181018782 22:20087347-20087369 GGTGTTCCAGGGCAGTGGAGGGG + Intronic
1181975581 22:26726990-26727012 GATTTTCCAGGGGTGGGGTGAGG + Intergenic
1183521462 22:38298287-38298309 AGAGTCCCAGGGGTGGGGTTGGG - Intronic
1183596820 22:38817901-38817923 GGTGCTGCAGGGGTGGGGTGGGG + Intergenic
1183628942 22:39021623-39021645 GGAAGTCCAGGGCTGGGGCTGGG - Intronic
1184231652 22:43161391-43161413 GGGGTTGCAGGGGTGGGTTTGGG + Intronic
1184367871 22:44063943-44063965 GGTGTTCCGTGGATGGGGTGCGG + Intronic
1184649715 22:45914002-45914024 GGTGTTCCAGGGGTAAGGCTGGG - Intergenic
1185014944 22:48337307-48337329 GGTGGTCTTGGGCTGGAGTTTGG - Intergenic
1185014962 22:48337378-48337400 GGTGGTCTTGGGCTGGAGTTTGG - Intergenic
1185101935 22:48845253-48845275 GGTGGTCTAGGGCTGAGGCTGGG - Intronic
1185330677 22:50250853-50250875 GGCGATCCAGGGCTGCGGTCAGG + Exonic
950410275 3:12831591-12831613 GGTGCTCCAGGGCCTGGGCTAGG - Intronic
950442238 3:13016888-13016910 CGTGATCCAGGGCTGGGGAGGGG - Intronic
950714442 3:14837700-14837722 GGTGTTCCACAGTTGGGTTTTGG + Intronic
953493410 3:43367708-43367730 GGAGCTTCAGGGCTGGGGTAGGG - Intronic
953791190 3:45949578-45949600 GGTGAACCAGGGCTTGGGTCAGG - Intronic
953819671 3:46194857-46194879 GATGTTCCTTGGCTGGGATTTGG - Intronic
954149245 3:48649033-48649055 GGAGTTCAAGGGCTAGGGTGTGG + Intronic
954295103 3:49670124-49670146 GGTATTCCATGGGTGGGGTGAGG - Exonic
954731378 3:52665489-52665511 GTTGTTCGTGGGCTGGGGGTTGG - Intronic
955140107 3:56260443-56260465 GCTGTTCCAGGGCTGGGGCGCGG - Intronic
956210349 3:66795779-66795801 GCTAAACCAGGGCTGGGGTTGGG - Intergenic
956890338 3:73607103-73607125 GGTTTTGCAGGGGTGGGGATTGG - Intronic
959228141 3:103613008-103613030 GGTGTTGCAGTGCTTGTGTTCGG - Intergenic
961087568 3:124082152-124082174 TGGCTTCCCGGGCTGGGGTTTGG + Intronic
961163441 3:124748697-124748719 TGTTTTTCAGCGCTGGGGTTGGG + Intergenic
961802238 3:129460223-129460245 GGTTTTCAGGGGCTGGGGGTAGG - Intronic
962154862 3:132935342-132935364 GTTTTTCCAAGGATGGGGTTGGG - Intergenic
962279269 3:134037954-134037976 GGAGTTCCAGGGCTGGCACTGGG - Intronic
963313446 3:143733395-143733417 TGTGTCCCTGGGCTGGGGGTTGG + Intronic
963668580 3:148222463-148222485 GGAGGAACAGGGCTGGGGTTGGG + Intergenic
965524590 3:169702376-169702398 GCTTTCCCAGGGCTGGGGATTGG - Intergenic
965725122 3:171707662-171707684 GATGTTCCCTGGTTGGGGTTGGG - Intronic
968475594 4:805311-805333 GGTTTTTCAGGGTTTGGGTTCGG - Intronic
969053053 4:4386408-4386430 GCTCTCCCAGGGCTGGGGTGTGG - Exonic
969077429 4:4591170-4591192 TGTCTTTCAGGGCTGGGGCTGGG + Intergenic
969135371 4:5024917-5024939 TGTGTCCCAAGCCTGGGGTTGGG - Intergenic
969290563 4:6236509-6236531 GGTTGTCTAGGGCTGGGTTTCGG + Intergenic
969496623 4:7529944-7529966 GGAGTTAGAGGGCTGGGGGTTGG + Intronic
969665933 4:8557696-8557718 GGTGTCCCAGAGCTGGGGAAGGG - Intergenic
969695044 4:8729545-8729567 GGTGCACCAGGGCTGGGCTGGGG + Intergenic
969862855 4:10051424-10051446 GCTGTTCCAGTGCTGGGATTGGG - Intronic
969902899 4:10366190-10366212 GGTCTTCCAGGCCTGAGATTTGG + Intergenic
972731429 4:41798835-41798857 GGTGTTGCAGGGGTGTGGTAGGG - Intergenic
973663569 4:53134157-53134179 GGTTACCCAGGGCTGGGGTGAGG + Intronic
974012776 4:56622945-56622967 GGGGCTGGAGGGCTGGGGTTAGG + Intergenic
974456171 4:62131310-62131332 GGTGTTCCTGTGCTGGAGTATGG - Intergenic
975728947 4:77319265-77319287 GGTGTTACAGGGGTGGGGCATGG + Intronic
976107847 4:81639177-81639199 GGTTTCCTAGGGCTGGGGTCGGG + Intronic
979947424 4:126850592-126850614 GGAGTAGCAGGGCTGGGGGTAGG + Intergenic
980522510 4:133951677-133951699 GGAGAGCCAGGACTGGGGTTGGG + Intergenic
981039181 4:140206860-140206882 GGTGGGCCAGAGCTGGGGTAAGG + Intergenic
981064103 4:140463187-140463209 GACGTCCCTGGGCTGGGGTTGGG - Intronic
981509239 4:145537352-145537374 TGTGTTCTAGGGCTGGGGAATGG + Intronic
982458475 4:155638012-155638034 GCTATTCCAGGGCTGGGGCAGGG - Intergenic
986043521 5:4016185-4016207 AGTGTTCCAGGGAGGGAGTTAGG - Intergenic
986179058 5:5376450-5376472 GCTGGTCCAGCGCTGGGGCTGGG - Intergenic
986221530 5:5772811-5772833 GAGGATCCAGGGCTGGGGTGCGG + Intergenic
987331674 5:16862848-16862870 GGTCTTGCAGTGCTGGTGTTGGG - Intronic
988573378 5:32394533-32394555 GGTTGTCCAGGGCTGGGGCTGGG + Intronic
990358833 5:54997629-54997651 GATGGTACAGGGCTGGAGTTAGG - Intronic
991692004 5:69234647-69234669 GGTGTTCCATGTTCGGGGTTTGG - Intergenic
993026592 5:82654010-82654032 GGTGTTCCAGCGGTGGGGGGAGG + Intergenic
994357627 5:98811838-98811860 GGTGTTGCAGGTCTGGGGCTTGG - Intergenic
995539302 5:113169030-113169052 GGTGCTCTGGGGCTGGGGATTGG - Intronic
996076036 5:119195559-119195581 GGTTTTCAAGGGCTGGTGGTGGG + Intronic
997358885 5:133281790-133281812 GCTTTTCCAGGGCATGGGTTGGG + Intronic
997413689 5:133708810-133708832 GGTCTTCCTGAGATGGGGTTGGG + Intergenic
999579304 5:153017949-153017971 GGTTTTCCTGGGGTGGGGGTGGG - Intergenic
999681379 5:154063327-154063349 GGTGTTCCTAGGTTGGGGTTAGG + Intronic
999715439 5:154356412-154356434 GGTGTGGCAGGGCTGGGGGAGGG + Intronic
1000446733 5:161331464-161331486 GATGTGCCAGGGATGAGGTTAGG + Intronic
1000765381 5:165283018-165283040 GGTGTTCCAGTGCTGAGGTGAGG - Intergenic
1002169530 5:177367370-177367392 GGTGAGCCGGGGCTGGGGTGGGG - Intronic
1002638884 5:180621241-180621263 GGGCTTCCAGGGCTGGGGGCAGG + Exonic
1002909664 6:1480158-1480180 TGTGTTCTAGGGCTAGGGTTGGG + Intergenic
1003112021 6:3258851-3258873 GGCGATCCCGGGCTTGGGTTGGG - Intronic
1003238548 6:4320636-4320658 GGTGCTGAAAGGCTGGGGTTGGG - Intergenic
1004029626 6:11853661-11853683 GTTGTTCCAGGGTGGGGGGTGGG - Intergenic
1004208466 6:13614658-13614680 GCTGTTCCAGGTCGTGGGTTAGG + Intronic
1004879487 6:19993260-19993282 GGTGTACCAGGAATGGTGTTAGG - Intergenic
1005681719 6:28215509-28215531 GGTGTTTCTGAGGTGGGGTTAGG + Intergenic
1006188125 6:32191897-32191919 GGGGTCCCAGGGCTGGGGAGAGG + Exonic
1006339892 6:33441012-33441034 GGAGTGGCAGGGCTGGGGGTCGG + Intronic
1006398459 6:33802051-33802073 GGTGGTCCTGGGGTGGGGGTGGG + Intronic
1006509156 6:34512418-34512440 GATGATCCAGGGCTGGGGGCCGG + Intronic
1007080815 6:39102491-39102513 GGGGATGCAGGGGTGGGGTTGGG - Intergenic
1007312141 6:40955098-40955120 GTTCTTCCAGGGCTGGGCTGGGG - Intergenic
1012571435 6:100734658-100734680 GGTGGTACAGGACTGGGGATAGG - Intronic
1012669463 6:102023772-102023794 GTTACTCCAGGGCTGGGGTTGGG + Intronic
1013288702 6:108701446-108701468 CATGTTCCATGGCTGGTGTTTGG + Intergenic
1013755997 6:113462501-113462523 GGTGTTAAAGGGGTGGGGTTAGG - Intergenic
1016335514 6:143000959-143000981 ATTGTTCCAGGGCTGGGTCTCGG + Intergenic
1016756134 6:147689234-147689256 GGTATTCAAGGCCAGGGGTTTGG + Intronic
1016827782 6:148404593-148404615 GGTGGTGCTGGGCTGGGGGTGGG - Intronic
1018176430 6:161182501-161182523 TGGGTTGCAGGGCTGGGGTGAGG - Intronic
1018302629 6:162419578-162419600 GGAGTTCCAGGGCTAGGACTGGG - Intronic
1019604429 7:1901466-1901488 GTGGTCCCAGGGCTGGGGTCGGG - Intronic
1020135439 7:5585594-5585616 GGTGTCCCAGGGCTTGGGGCAGG - Intergenic
1022807208 7:33834332-33834354 AGTGATCCAGGGGTGAGGTTAGG + Intergenic
1023897268 7:44444373-44444395 GGTGTCCCAGGCCTGGGGACAGG + Intronic
1026013633 7:66655210-66655232 GAGGCTGCAGGGCTGGGGTTAGG + Intronic
1026534530 7:71228990-71229012 GATCATCCAGGGCTGGGGCTTGG + Intronic
1026807841 7:73438842-73438864 GGAGGCCCAGGGCTGGGGTTAGG + Intergenic
1026875337 7:73876193-73876215 GGGCTTCCAAGGCTGGGGCTGGG + Intergenic
1027513855 7:79116582-79116604 GGTATTCCAGGGATGTGGTTTGG + Intronic
1029118643 7:98251929-98251951 GGCGTTCCAGGGCAGGGGACGGG + Intronic
1029712734 7:102308466-102308488 GGGGTGCCAGGGCATGGGTTGGG + Intronic
1030143324 7:106327587-106327609 GGTGTTCCAGGCCCTGGATTTGG + Intergenic
1030881261 7:114882695-114882717 GGTGTTGCAGTGGTGGGGGTGGG + Intergenic
1033417059 7:141171521-141171543 GGTGTTTCTGGGCTGTGGGTTGG + Intronic
1034480882 7:151319847-151319869 GCTGGTCCAGGGATGGGCTTTGG - Intergenic
1034859096 7:154581091-154581113 GGTTGGCCAGGGCAGGGGTTAGG + Intronic
1035002075 7:155620625-155620647 GATATTCCAGGCCTGGGGCTGGG - Intronic
1035055136 7:156030191-156030213 AGAGTTCCAGGGCAGGGGTTGGG + Intergenic
1035470866 7:159107747-159107769 GCTGCTGCAGGGCAGGGGTTAGG + Intronic
1035683104 8:1503291-1503313 GGGGTTCCAGGGCTGGGGAGGGG - Intronic
1036441999 8:8789757-8789779 GGTGTTCCAGGTGTGGGTTCAGG - Intronic
1036765652 8:11547873-11547895 GGGGTCACAGGGCTGGGGGTGGG + Intronic
1037787228 8:21910304-21910326 GAGGTCCCAGGGCTTGGGTTAGG - Intronic
1038860219 8:31379658-31379680 ACTGCTCCAGGGCTGGGGGTAGG + Intergenic
1039181483 8:34871731-34871753 GGTCTTTCAGGGTTGGTGTTTGG - Intergenic
1041504082 8:58575030-58575052 GGTTGTCAGGGGCTGGGGTTGGG - Intronic
1041511765 8:58660704-58660726 TGTTTGCTAGGGCTGGGGTTTGG - Intergenic
1042021677 8:64376597-64376619 GGTGGTCCAGGGCTCTGGTTGGG + Intergenic
1044124133 8:88437115-88437137 GGTATTCCAGTGCAGGGGTTGGG - Intergenic
1044421609 8:92002471-92002493 TGTGTTTCAGGGATGGGTTTTGG - Intronic
1045137326 8:99234531-99234553 GGGGCCGCAGGGCTGGGGTTCGG + Intronic
1046573067 8:115991276-115991298 TGTTTTGCAGGGCTGGTGTTGGG - Intergenic
1047506453 8:125484464-125484486 GGTGTCCCAGGGATGGGGGAGGG + Intergenic
1049228800 8:141471291-141471313 GGTGTGGCAGGGCTGGGACTGGG + Intergenic
1049339515 8:142104603-142104625 TGGGCTCCAGGCCTGGGGTTTGG - Intergenic
1049442112 8:142614321-142614343 GGTGGTCCGGCGCTGGGGTCCGG + Exonic
1049473847 8:142787925-142787947 GGTGGTCCTGGGCTGGGCTGAGG + Intergenic
1049656527 8:143801237-143801259 GCAGTTCCAGGGCTGGGCATGGG + Intronic
1049766502 8:144357726-144357748 GGTGTGCCAGAGCGCGGGTTGGG + Exonic
1052996515 9:34554124-34554146 GATCTTCCAGGGCTGAGATTAGG - Intronic
1054856326 9:69903415-69903437 GGTGTAGCAGGGATGTGGTTTGG - Intronic
1055514877 9:77023985-77024007 GGGGTTCCACGGCAGGGGCTGGG - Intergenic
1057382006 9:94576882-94576904 GCTGTTCCAGGGCTGGGGTTGGG + Intronic
1059331695 9:113539631-113539653 GGTGGTGCAGGGGTGGGGTGGGG - Intronic
1060945638 9:127568352-127568374 CGTGTACCAGGGCTGGGGCCCGG + Intronic
1061332783 9:129907115-129907137 GGTGTTACAAGGCTGGCTTTTGG - Intronic
1062056671 9:134472562-134472584 GGTGTTGCAGGCCTTGGGCTTGG + Intergenic
1062318073 9:135978011-135978033 GGTGTCCCAGGGCTGCTGGTGGG - Intergenic
1062360658 9:136186480-136186502 GGTGGTCGGGGCCTGGGGTTAGG - Intergenic
1062379601 9:136280847-136280869 GGTGGTCCAGGGTTAGGGGTTGG + Intergenic
1062448682 9:136606526-136606548 GGTGATCCAGGGCAGGGGTGAGG - Intergenic
1062467132 9:136686451-136686473 GGTTTTGCCAGGCTGGGGTTGGG - Intronic
1062535244 9:137018475-137018497 GGTGGGACAGGGCTGGGGTGGGG + Intronic
1062698984 9:137889468-137889490 CGTGTTCTGGGGCTGGGGCTGGG + Intronic
1062729649 9:138101862-138101884 GGTGTCCCAGGGTTGGAGGTAGG + Intronic
1185644857 X:1609385-1609407 GAAGACCCAGGGCTGGGGTTTGG - Intergenic
1185853635 X:3512056-3512078 ACTTTTCCATGGCTGGGGTTGGG + Intergenic
1186548143 X:10472860-10472882 TGTGTTCCAGGGCTGGGCAGTGG - Intronic
1186906262 X:14114351-14114373 TTTATTCCAGGGCTGGGGTGGGG - Intergenic
1187077705 X:15952161-15952183 GGTATTCCAGGGCTGCTGCTGGG - Intergenic
1187470812 X:19568101-19568123 GGTAGTACAGGGCTGGGGTGGGG + Intronic
1189092791 X:38104919-38104941 GGTGTTTCTTGGCTAGGGTTTGG - Intronic
1189232864 X:39465912-39465934 CGTGCTCCAGGGCAGGGCTTTGG + Intergenic
1189276262 X:39788137-39788159 GGTGTCTCAGGGATGTGGTTTGG + Intergenic
1189579783 X:42393999-42394021 GCTGATCCAGGGCTGAGGTCTGG + Intergenic
1190335361 X:49258480-49258502 GGCTTGCCAGGCCTGGGGTTGGG + Exonic
1190732260 X:53233972-53233994 GGTGCTCCAGCGCTGGGGAGTGG - Exonic
1190743623 X:53307002-53307024 TGTGTTCTAGGTCTGGGGGTTGG - Intronic
1192558691 X:72110580-72110602 AGTGTCCCGGGGCTGGGGTTGGG - Intergenic
1194434722 X:93856056-93856078 GGCTTCCCATGGCTGGGGTTTGG + Intergenic
1195579138 X:106481948-106481970 GGTCTTCCAGGGCTGTCCTTGGG + Intergenic
1196012429 X:110903472-110903494 GGTAATCTAGGGATGGGGTTTGG + Intergenic
1196798831 X:119524055-119524077 GGAGTTTCAGGGCTGGGCATGGG - Intergenic
1197005464 X:121491161-121491183 GGTTTCCCAGGGCCGGGTTTGGG - Intergenic
1197251208 X:124218007-124218029 TGTCTTCCGGGGCTGGGGGTAGG + Intronic
1197611377 X:128642882-128642904 GGTCTTCCAGGTTTGGGGATAGG - Intergenic
1197771365 X:130091693-130091715 GAAGGTCCTGGGCTGGGGTTAGG + Intronic
1197892421 X:131280111-131280133 AGTGTTGCTGGGCTGGGGTGGGG + Intronic
1198552428 X:137758789-137758811 GGTTTTGCAGGGATGGGATTGGG + Intergenic
1198593710 X:138212997-138213019 GGTATTCCAAGGGTGGGGATAGG - Intergenic
1199454631 X:148014455-148014477 TGTGTTCCAGGCCTTGTGTTAGG + Intronic
1199952073 X:152715003-152715025 GGTGTTTGAGGGATGGGGGTGGG - Intronic
1199957610 X:152753445-152753467 GGTGTTTGAGGGATGGGGGTGGG + Intronic
1200809810 Y:7472459-7472481 ACTTTTCCATGGCTGGGGTTGGG - Intergenic
1200977454 Y:9228130-9228152 AGTGTTACAGGGTTAGGGTTTGG - Intergenic