ID: 1145960526

View in Genome Browser
Species Human (GRCh38)
Location 17:28884263-28884285
Sequence CCGTCTCTACGTCCTCGCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145960519_1145960526 4 Left 1145960519 17:28884236-28884258 CCGTCACAGTTAAAGCTACCCCC 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1145960526 17:28884263-28884285 CCGTCTCTACGTCCTCGCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1145960518_1145960526 5 Left 1145960518 17:28884235-28884257 CCCGTCACAGTTAAAGCTACCCC 0: 1
1: 0
2: 0
3: 8
4: 60
Right 1145960526 17:28884263-28884285 CCGTCTCTACGTCCTCGCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1145960517_1145960526 16 Left 1145960517 17:28884224-28884246 CCTGGGCGACACCCGTCACAGTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1145960526 17:28884263-28884285 CCGTCTCTACGTCCTCGCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145960526 Original CRISPR CCGTCTCTACGTCCTCGCAG CGG Exonic
900466027 1:2825890-2825912 CCTTCTCTGTGTCCTCACAGGGG + Intergenic
900942369 1:5808246-5808268 CTGTCTCTCAGTCCTGGCAGGGG - Intergenic
908356324 1:63327646-63327668 CCGTATCTAGTTCCTCGGAGGGG + Intergenic
924737780 1:246774225-246774247 CTGTCTTTACGACCTCACAGTGG - Intergenic
1063124491 10:3126844-3126866 TCGCCTCTGCGTCCTTGCAGGGG + Intronic
1063456361 10:6185458-6185480 CCGTCTCCTCGCCCCCGCAGTGG - Intronic
1074423234 10:113327903-113327925 TCCTCTCTACCTCCTAGCAGGGG + Intergenic
1076135082 10:128040127-128040149 CCGTGGCTCCATCCTCGCAGAGG + Intronic
1098697854 12:73581739-73581761 CCGTCTCTATGCCCCCACAGGGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1107566986 13:41614883-41614905 CCGTCTCTGAGTCTTCTCAGGGG + Intronic
1132789206 16:1675663-1675685 TCCTCTCCACGTCCTCCCAGTGG - Exonic
1134218012 16:12331273-12331295 CCTTCTCTACGTGCTCCAAGTGG + Intronic
1145960526 17:28884263-28884285 CCGTCTCTACGTCCTCGCAGCGG + Exonic
1148564443 17:48625046-48625068 CCTCCTCGGCGTCCTCGCAGGGG - Intronic
1149386559 17:56148400-56148422 CTGTCTCTATGTCCTAGCTGTGG - Intronic
1152623746 17:81379142-81379164 CCCTCTCTGCGGCCCCGCAGGGG + Intergenic
1154139047 18:11807193-11807215 CCAGCTCTACATCCTCGCAAAGG + Intronic
1167289370 19:48615934-48615956 CCTTCCCTAGGTCCTCGCAAGGG - Exonic
1171403011 20:24891764-24891786 CCATCTCCACCTCCCCGCAGAGG - Intergenic
1173580106 20:44141112-44141134 CTGTCTCAACATCCTTGCAGAGG - Intronic
1185310911 22:50153705-50153727 CCCTCTCCAAGGCCTCGCAGAGG + Intronic
950021690 3:9792380-9792402 CCCCCTCTACCTCCTCGCTGCGG + Exonic
950179783 3:10903159-10903181 CCATCTCTATGTCCTCGAATTGG - Intronic
957547924 3:81663789-81663811 CCGTCTGTGAGTTCTCGCAGAGG + Intronic
968759844 4:2437038-2437060 CCGTCTCTACGGCCTGGCCCTGG - Intronic
1001783375 5:174390447-174390469 CTGTATCTACCTCCTGGCAGAGG - Intergenic
1016389245 6:143558700-143558722 CGATCTCTACCTCCTCGCATTGG - Intronic
1034168481 7:149044265-149044287 CCATGTCTAGGTCCTCTCAGTGG - Intergenic
1037865643 8:22440732-22440754 CCGGCCCTGCGGCCTCGCAGCGG - Intergenic
1040850895 8:51899313-51899335 CCATCTCCACGTTCTCGCACCGG + Intergenic
1045482110 8:102600889-102600911 CTGTCTCTCCGTCCTAGAAGGGG + Intergenic
1055030449 9:71768271-71768293 CCGGGTCTGCGTCCCCGCAGTGG + Intronic