ID: 1145960899

View in Genome Browser
Species Human (GRCh38)
Location 17:28886042-28886064
Sequence GCCTGACGCCTGGGGGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145960889_1145960899 -7 Left 1145960889 17:28886026-28886048 CCAGACAAGCACCGATGCCTGAC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1145960899 17:28886042-28886064 GCCTGACGCCTGGGGGCGGGGGG 0: 1
1: 0
2: 1
3: 41
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145960899 Original CRISPR GCCTGACGCCTGGGGGCGGG GGG Intronic
900164499 1:1239376-1239398 GCCTGGCCCCTGGGGGCGCCTGG - Intergenic
900533772 1:3167403-3167425 GCCTGGTGGCTGGGGGCTGGAGG + Intronic
900548125 1:3239919-3239941 GCCTGGAGGCTGGGGGTGGGCGG + Intronic
900579243 1:3400343-3400365 GGCTGACCCCTGGGGTCTGGTGG - Intronic
900601660 1:3505389-3505411 GCATGGGGTCTGGGGGCGGGGGG - Intronic
900626411 1:3610732-3610754 GCCTGTCTCCTGGGGTCTGGGGG - Intronic
900640110 1:3684480-3684502 GTCTGAGGCATGGGGGTGGGCGG + Intronic
900680837 1:3915341-3915363 ACCTGAAGCCTGGGAGCAGGGGG - Intergenic
901022196 1:6261088-6261110 GCCGGGCGGCCGGGGGCGGGGGG + Intergenic
901250114 1:7771508-7771530 TCCCGAGGCCTGGGGGTGGGCGG + Intronic
901433919 1:9234808-9234830 GCCTGAGGCCTGGGGCGGGGTGG + Exonic
901571542 1:10164964-10164986 GCCTGAAGGCTGGGGGTAGGAGG - Intronic
901916727 1:12505883-12505905 GGCAGAAGCCTGGGGGCAGGAGG - Intronic
903340849 1:22653315-22653337 GCTTGGCGCCTGGGGGAGGCTGG + Intronic
903696441 1:25210805-25210827 CCCTGAGGTCTGGGGGTGGGAGG + Intergenic
903935167 1:26890356-26890378 GCTAGACGCCGAGGGGCGGGCGG + Intergenic
904242992 1:29162612-29162634 GCCTGACGCCATGCGGAGGGAGG + Intronic
904301354 1:29556761-29556783 GCCTGAAGCCTGGGGACTGTGGG + Intergenic
904339975 1:29828296-29828318 GCCTGAAGCCTGGGGACTGTGGG + Intergenic
905172040 1:36115202-36115224 GCCTGAGGCCTGGGGGTGGCTGG - Intronic
905335260 1:37240541-37240563 GGCTGGCTCCTGGGGGCGTGGGG - Intergenic
905662730 1:39739706-39739728 GCCTGACACTTGGGGGCAAGTGG + Intronic
906615131 1:47228772-47228794 GCCTGAGGCCTAGGGTGGGGAGG - Intronic
907732973 1:57085772-57085794 GTATGACACTTGGGGGCGGGGGG + Intronic
912309928 1:108609897-108609919 GCCTGTCGGGAGGGGGCGGGAGG + Intronic
913163354 1:116165110-116165132 GCCTGAGGCCCAGGGGCTGGAGG - Intergenic
913366691 1:118047518-118047540 GCCTGAAGCCTGGGGCCATGGGG - Intronic
914703074 1:150150786-150150808 GGCTGCGGCCGGGGGGCGGGGGG - Intronic
915574743 1:156768041-156768063 GGCTCACGCCTGGAGGTGGGGGG - Exonic
915903644 1:159863066-159863088 GCCTGAAGCCTGGGGGAAGGTGG - Intronic
915954144 1:160208877-160208899 TCCTAACGACTGGGGGTGGGGGG + Intronic
917084418 1:171291707-171291729 GCCTGAGGACTGGGGGTGGTAGG + Intergenic
917262570 1:173186356-173186378 CCCTGAGGGGTGGGGGCGGGAGG + Exonic
922195883 1:223360243-223360265 CCTTGAAGCCTGGGGGTGGGGGG + Intronic
922891043 1:229062210-229062232 GCCTGACTCCCAGGGGCAGGGGG + Intergenic
923786228 1:237071652-237071674 ACCTGAAGCCTGGGGGCCAGGGG - Intronic
924436510 1:244048435-244048457 GTCTGAGGGCTGGGGGCGGGCGG + Intergenic
1062932288 10:1361197-1361219 CCCTGCAGCCTGGGGGAGGGGGG - Intronic
1068475383 10:57517411-57517433 GCCTGTCGTCGGGGGGTGGGAGG - Intergenic
1069683458 10:70301247-70301269 GCCTGGGGGCTGGGGGCGGGTGG - Exonic
1071565595 10:86669895-86669917 GCCTTGGGCCTGGGGGCTGGAGG + Intronic
1071613071 10:87049113-87049135 GCTTGAACCCAGGGGGCGGGGGG + Intergenic
1073034369 10:100553019-100553041 TCTTGAGGCCTGGGGGCGTGTGG + Exonic
1075519903 10:123136978-123137000 GCCCGGCGCCTGGGGACGGCAGG - Intronic
1075520809 10:123142607-123142629 GTCGGAGGCTTGGGGGCGGGAGG + Intergenic
1076631568 10:131855143-131855165 GTCACACGCCTGGGGGCAGGTGG + Intergenic
1076721757 10:132396266-132396288 GCCGGGCGCCTGGGGGAAGGGGG + Intergenic
1076794727 10:132793047-132793069 ACCTGTAGCCTGGAGGCGGGGGG - Intergenic
1076829906 10:132988983-132989005 GCCTGAGGCCCGGTGGGGGGGGG + Intergenic
1076834914 10:133016220-133016242 GGCTGAGGCCTGAGGGTGGGTGG - Intergenic
1077080343 11:722161-722183 ACCTGGTGCCTGGGGCCGGGCGG + Exonic
1077096448 11:801112-801134 GACTGAGGCCTGGGGATGGGAGG + Exonic
1077401419 11:2359860-2359882 GCCCGGTGCCTGGGGGCGGGTGG + Intergenic
1077544853 11:3164935-3164957 GCCTGGCGGGTTGGGGCGGGTGG - Intronic
1077553767 11:3216083-3216105 GCCTGAGCCCTGGTGGCAGGGGG - Intergenic
1079238506 11:18706307-18706329 GGGGGAGGCCTGGGGGCGGGTGG - Intronic
1083012470 11:59416219-59416241 TCCTGCTGCTTGGGGGCGGGAGG + Intergenic
1083188783 11:61034808-61034830 GCGTGATGCCTGGGTGGGGGTGG - Intergenic
1083798464 11:65032345-65032367 GCCTGCCCCCAGGGGGCGTGAGG - Intronic
1083932372 11:65853011-65853033 CCCTGGTGCCTGGGGGAGGGAGG - Intronic
1084128962 11:67119010-67119032 GCCTGACGCGAGGGGGCGCAGGG + Intergenic
1084165466 11:67373100-67373122 GCCCGAGGCCGGGCGGCGGGAGG - Intronic
1084178540 11:67435542-67435564 GCCTGATGCCTGTGGTTGGGGGG + Exonic
1084289464 11:68152537-68152559 CACTGAGGCCTGGGGGCGGCAGG - Intergenic
1084584134 11:70046339-70046361 ACTTCACGCCTGGGGGTGGGAGG + Intergenic
1084636831 11:70398544-70398566 GCCTGGTGCCTGGGAGCGGCTGG + Exonic
1084978113 11:72814346-72814368 CCGTGACGCCAGGGGGCGGGCGG - Exonic
1086541557 11:87918058-87918080 TCCTGAGGCTGGGGGGCGGGGGG - Intergenic
1089289786 11:117430668-117430690 GGCTGGGGCCAGGGGGCGGGGGG + Intronic
1089455305 11:118622296-118622318 GCCAGACCCCTGGGGGCTGTAGG + Intronic
1089505290 11:118958295-118958317 GCCTGGGGCCTGGGAGCAGGTGG - Exonic
1089671634 11:120061342-120061364 GTCTGTCATCTGGGGGCGGGGGG - Intergenic
1089708134 11:120295456-120295478 GGCAGATGCCTGGGGGCAGGAGG + Intronic
1090818141 11:130315929-130315951 CCCAGGTGCCTGGGGGCGGGCGG + Intergenic
1091445363 12:541855-541877 GCCAGAGGCCGGGGGGTGGGGGG - Intronic
1091712718 12:2753168-2753190 GGCTGGCGCCTGGGAGCGCGAGG + Intergenic
1091782989 12:3225553-3225575 GCCTGATGCCTGTGGGATGGGGG + Intronic
1092644521 12:10555024-10555046 GCCTGATTCCTGGGAGCAGGAGG + Intergenic
1093473915 12:19534149-19534171 GCCTGAAGCGTGGGGACGGGGGG + Intronic
1095960073 12:47828878-47828900 GCCTGGGGCCGGGGGGTGGGGGG + Intronic
1096680381 12:53252000-53252022 TCCTGACGCCTGGGGTGGGTCGG - Exonic
1096773965 12:53953078-53953100 GGCCGGCTCCTGGGGGCGGGAGG + Intergenic
1101493897 12:105235915-105235937 GCCTCACCCCTGCGGGCGAGGGG + Intronic
1102025652 12:109713042-109713064 GCCTGTCTCCTGTGGGCGTGGGG + Intergenic
1102877603 12:116459938-116459960 GCTTGAAGCCTTGGGGAGGGGGG - Intergenic
1102953622 12:117045878-117045900 GCCTTAGGGCTGGGGGCTGGTGG + Intronic
1104463913 12:128975255-128975277 GCATCATGACTGGGGGCGGGGGG + Intronic
1104831395 12:131754395-131754417 GCTGGACGTCGGGGGGCGGGGGG - Exonic
1105571874 13:21610801-21610823 GCCTGAGGCCTGCGGGCTGGTGG + Intergenic
1106109068 13:26760884-26760906 CCCTGACCCGTGGGGGCGCGCGG - Intergenic
1108024988 13:46168421-46168443 GCCTCGCTCCTGGGGGCTGGGGG + Intronic
1112476584 13:99736771-99736793 GCCTGAAGCCTGGTGGGGAGGGG - Intronic
1112494545 13:99894728-99894750 GCCTGAGGCGGGGGGGGGGGGGG + Exonic
1113568891 13:111339382-111339404 TCCTGACCCCTGGGGGTGCGTGG - Intronic
1114266200 14:21074098-21074120 GTCTGGCCCCTGGGGGTGGGCGG + Exonic
1115563736 14:34606706-34606728 GGCTGACGCCTGTGGCTGGGAGG - Intronic
1116087105 14:40254261-40254283 GCCTGAGGCTTGGGGAGGGGTGG + Intergenic
1118006531 14:61568707-61568729 GCGTGACGCCGGGGTGCAGGTGG + Intronic
1118319292 14:64743704-64743726 TGCTGACTCCTGGGGGAGGGAGG + Exonic
1119034290 14:71216511-71216533 TCATGACGCAAGGGGGCGGGTGG - Intergenic
1121645742 14:95516401-95516423 GCGTGACAGCTGCGGGCGGGCGG - Intronic
1122349271 14:101078131-101078153 GGCTCAGGCCTGGGGGGGGGGGG + Intergenic
1122356724 14:101127092-101127114 GCCTGAGGGCTGGGGGTGTGTGG - Intergenic
1122550881 14:102549164-102549186 GCCTGGGGCCTGGGGGAGGTGGG + Intergenic
1122722483 14:103730124-103730146 GGCTGAGGCCAGGGGGCGTGGGG + Intronic
1123033982 14:105464315-105464337 GCCTGGCGGGTGGGGGCGGCCGG + Intronic
1123034638 14:105466920-105466942 GCCAGATGCCTGGGCTCGGGGGG - Intronic
1124453687 15:29821934-29821956 GCCAGATGCCGGTGGGCGGGCGG + Intronic
1124628923 15:31326457-31326479 GCATGACGTCCGGGGGCGGCGGG - Intergenic
1128356835 15:66934047-66934069 GCCTGACCTCTGGGGAGGGGAGG - Intergenic
1129466936 15:75729442-75729464 GCCCAGGGCCTGGGGGCGGGTGG - Intergenic
1129838527 15:78729086-78729108 GCCTGGCTCCTGGAGACGGGGGG + Intergenic
1130637882 15:85642544-85642566 CCCTAACGCCATGGGGCGGGGGG - Intronic
1131455574 15:92580140-92580162 TCCTGACGCCTTGCAGCGGGAGG - Intergenic
1132328810 15:100996097-100996119 GCCTGATGGCTGGGGGCTGGTGG + Intronic
1132499112 16:276844-276866 GCCTGAAGCCTGGCGGCCGCCGG - Intronic
1132573274 16:653320-653342 GCCTGGCACAAGGGGGCGGGGGG - Exonic
1132672968 16:1109277-1109299 GCCTGAAGGCCGGGGGCTGGGGG + Intergenic
1132851934 16:2028735-2028757 ACCTGCGGCCTGGGGGAGGGTGG - Intronic
1132897485 16:2235972-2235994 GCCTGAGGCCTGTGGGTGGGTGG + Exonic
1133040925 16:3059398-3059420 GGCTGCCGCCAGGGGGCGGTCGG + Exonic
1133170601 16:3980554-3980576 GCCCGAAGGCTGGGGGCGGGGGG - Intronic
1133643783 16:7743903-7743925 GCCTGACGGGTGGGGGCAAGGGG - Intergenic
1133924794 16:10183445-10183467 ACCAGACGCCCGGGAGCGGGCGG - Intergenic
1134441451 16:14301909-14301931 GCCTCGACCCTGGGGGCGGGGGG - Intergenic
1136317240 16:29461552-29461574 GACTGCCGCCTGGGAGAGGGTGG - Intronic
1136431815 16:30200895-30200917 GACTGCCGCCTGGGAGAGGGTGG - Intronic
1136614956 16:31393089-31393111 TCCTGAGGCCTGGGGGAGGGTGG + Intergenic
1137614491 16:49838686-49838708 GCCAGACTCCGAGGGGCGGGCGG + Intronic
1139374040 16:66485725-66485747 GCATGACTCCTGGGGGCCTGGGG + Intronic
1139497014 16:67327050-67327072 ACCTGAGGCTGGGGGGCGGGGGG + Intronic
1139853797 16:69965483-69965505 GCCCGAGGCCGGGGGGCGGTGGG + Intergenic
1139882775 16:70188396-70188418 GCCCGAGGCCGGGGGGCGGTGGG + Intergenic
1139948883 16:70659770-70659792 GGATGGCGCCTGGGGGTGGGAGG + Intronic
1140260000 16:73370068-73370090 GCCGGAAGACTGGGGGTGGGAGG - Intergenic
1140369735 16:74407123-74407145 GCCCGAGGCCGGGGGGCGGTGGG - Intergenic
1141600843 16:85125324-85125346 GCCTGAGGCTGGGGGGCAGGGGG + Intergenic
1142071150 16:88091798-88091820 GCCTGGCGCCTGGAGGCGTAGGG - Intronic
1142338839 16:89507968-89507990 GCCGGAGGCCTCGGGTCGGGAGG - Intronic
1142350298 16:89576442-89576464 GCCGGCCGACGGGGGGCGGGAGG + Intronic
1142351948 16:89584590-89584612 GTCAGATCCCTGGGGGCGGGAGG + Intronic
1142585064 17:967108-967130 GCCTCAGGCCTGGGGGCTGTGGG - Intronic
1142961780 17:3556234-3556256 GGCTGACCCCTGGGGGCAGCTGG + Intronic
1142963047 17:3563344-3563366 GCCTGGAGCCTGGAGGAGGGAGG - Intergenic
1143515788 17:7418621-7418643 GCCTGAGGCCTGGGGGAGGCAGG - Exonic
1143639222 17:8186121-8186143 GCAGGACGCCGGGGGCCGGGAGG + Intergenic
1145007042 17:19343975-19343997 GCCTGACTCCTGGTGGGGGTGGG - Intronic
1145014530 17:19387642-19387664 GCCTGGCTTCTGGGGACGGGAGG + Intergenic
1145960899 17:28886042-28886064 GCCTGACGCCTGGGGGCGGGGGG + Intronic
1147464878 17:40603304-40603326 GCCAGAAGCCTGGGGCCAGGTGG - Intergenic
1147806587 17:43135874-43135896 GCCGGGCGCCTGGGGATGGGAGG - Intergenic
1147921220 17:43918161-43918183 GCCGGGCGCCTGGGGATGGGAGG - Intergenic
1148028018 17:44601651-44601673 GCCTGAAGTCAGGGGGCGCGGGG + Intergenic
1148029202 17:44608323-44608345 GGCTGAGGGCTGGGGGCTGGGGG + Intergenic
1148168676 17:45501783-45501805 GCCCGGCGCCTGGGGATGGGAGG - Intergenic
1148280135 17:46341158-46341180 GCCCGGCGCCTGGGGATGGGAGG + Intronic
1148302363 17:46559095-46559117 GCCCGGCGCCTGGGGATGGGAGG + Intronic
1148366292 17:47057993-47058015 GCCTGTAGCCGGGGGGGGGGAGG + Intergenic
1148640430 17:49183608-49183630 GCCTGAGGGCTGGGGGCTGGGGG - Intergenic
1148763456 17:50021774-50021796 GGCTGAGGCCTGGGGCAGGGCGG - Intergenic
1149215938 17:54354398-54354420 GCATGAACCCAGGGGGCGGGAGG + Intergenic
1149313997 17:55421872-55421894 ACCGGGCGGCTGGGGGCGGGAGG + Exonic
1149547952 17:57518326-57518348 GCCATACGCCTGGGGAGGGGAGG - Intronic
1150008909 17:61487067-61487089 ACCTGCCGCCTGGGTGGGGGTGG - Intergenic
1150269950 17:63857432-63857454 GGCTGAGGGCTGGGGGCAGGGGG + Intergenic
1150399870 17:64848233-64848255 GCCCGGCGCCTGGGGATGGGAGG - Intergenic
1151329439 17:73398266-73398288 GCCTCAGGGCTGGGGGTGGGTGG - Intronic
1151417131 17:73973861-73973883 TCCAGAGGCCTGGGGGGGGGCGG - Intergenic
1151557215 17:74852603-74852625 GCCCGGCTCCTGGGGGCGGGCGG + Exonic
1151757517 17:76083147-76083169 ACCTCAGGCCTGTGGGCGGGCGG + Exonic
1151764008 17:76122748-76122770 GGCTGCTGGCTGGGGGCGGGAGG + Intergenic
1152643587 17:81458991-81459013 GCCAGCCGCCTGGGGAGGGGTGG + Intronic
1152720809 17:81923107-81923129 GCCTGTGGGCTGGGGTCGGGGGG - Intronic
1152867961 17:82735529-82735551 GCGTGACCCCGGGCGGCGGGAGG - Intergenic
1154070669 18:11149171-11149193 GCGGGCCGCCTGGGGGCTGGAGG - Intergenic
1158480858 18:57820708-57820730 GTCTGTGGCCTGGGGGCTGGGGG - Intergenic
1159471856 18:68867463-68867485 GCCTGCATCCTGGGGGCTGGGGG + Intronic
1160502202 18:79407231-79407253 GCATGGAGCCTGGGGGCGGGGGG + Intronic
1161003813 19:1924603-1924625 GCCTGACTCCGGGGGACAGGTGG + Exonic
1161159993 19:2756632-2756654 GCCGGCTCCCTGGGGGCGGGAGG - Intronic
1161234413 19:3190733-3190755 GCCTGACGCAGGGGGGCCGGGGG - Intronic
1162065152 19:8121045-8121067 GCCTGAGACCTGGGGGTGGCCGG - Intronic
1162088473 19:8262354-8262376 GGCTGTGGCCTGGGGGCTGGGGG + Exonic
1162777681 19:12989870-12989892 GCCCGGGGCCTGGGGGCTGGTGG + Intergenic
1162778971 19:12996686-12996708 TCCCGTCGCCTGGAGGCGGGAGG + Intronic
1162789511 19:13055615-13055637 GCCTCAGGGCTGGGGGAGGGGGG + Intronic
1163484412 19:17577472-17577494 GTCCGAGGCCTGGGGGTGGGGGG + Intronic
1164162134 19:22634206-22634228 GCCTGAGGGCGGGGGGGGGGGGG + Intergenic
1164642124 19:29833690-29833712 GCTTGGTGCGTGGGGGCGGGGGG - Intergenic
1165157278 19:33796261-33796283 GCCGGCCGGCGGGGGGCGGGGGG + Intronic
1165439501 19:35816558-35816580 CCCTGACACCTGAGGGCAGGTGG - Intergenic
1165860373 19:38906090-38906112 GCCTGTGACCTGGGGGCGAGAGG - Intronic
1166246560 19:41531625-41531647 ACCTCTCTCCTGGGGGCGGGAGG - Intergenic
1166529664 19:43534850-43534872 GAATGACGCCTGGGGGGAGGGGG + Intronic
1166741281 19:45116339-45116361 GCCTGAGGCCTGGGGTCTGGAGG + Intronic
1167383426 19:49150971-49150993 GAGTGACGCCTGGGGCGGGGAGG - Exonic
1168290603 19:55355212-55355234 GCCTTAGACCTGGGGGCGGGGGG - Intronic
924988065 2:288742-288764 GCCTGACGTCGGCGGGCGCGGGG - Intronic
926045180 2:9704746-9704768 GCCTGTAGCCTGGGGCCTGGGGG + Intergenic
926130824 2:10302511-10302533 TCCTGCGGCGTGGGGGCGGGGGG + Intergenic
926239537 2:11074499-11074521 GTCTGAGGCCTTGGGGAGGGAGG - Intergenic
927544518 2:23940705-23940727 GCCTGCCGGCTGGGGCCGAGGGG + Intronic
927846378 2:26474470-26474492 GGCTGAGGCCTGGGGACTGGAGG - Intronic
927881431 2:26692634-26692656 GCCTGCGGGCGGGGGGCGGGGGG + Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
931639548 2:64369837-64369859 GCCTGGGGCCTGTGGGAGGGTGG + Intergenic
932776128 2:74529491-74529513 CCCGGAAGCCTGGGGGCGAGAGG + Exonic
934733940 2:96678209-96678231 GCTTGAACCCGGGGGGCGGGCGG - Intergenic
937242118 2:120468672-120468694 GCCTGTCGCTTGGGGTTGGGTGG - Intergenic
937650338 2:124312445-124312467 ACTTGAAGCCGGGGGGCGGGTGG - Intronic
938108370 2:128548554-128548576 GCCTGAGGGGTGGAGGCGGGAGG - Intergenic
939808973 2:146808262-146808284 GCGTGAGGCCGGGGGGTGGGGGG + Intergenic
942147914 2:173044258-173044280 TCATGGCGCCGGGGGGCGGGAGG + Intronic
945254122 2:207789860-207789882 GCCTGACCCCTGGGGTTGGGGGG + Intergenic
946171869 2:217900436-217900458 GCCTGGCCCGTGGGGGCAGGGGG - Intronic
946225471 2:218261959-218261981 GCCTCAGGCCTGGGGGTGTGGGG + Intronic
946370589 2:219279319-219279341 GCCTGTCCCCTGGGGGGGTGGGG - Exonic
946410495 2:219513031-219513053 GCCTGACGCAGGGGGCGGGGTGG + Intergenic
946690001 2:222302546-222302568 GAATCACGCCTGGGGCCGGGCGG - Intronic
947794408 2:232885097-232885119 GTCTGACGCCTGGTGGCAGGCGG + Intronic
947992307 2:234497161-234497183 GCCTGACCCCCGGCGGCGGGCGG - Intergenic
948602818 2:239116932-239116954 GCCAGAGGACTGGGGTCGGGGGG - Intronic
948829667 2:240592192-240592214 GCCTGAGGCCTGGCAGTGGGGGG - Intronic
948963310 2:241356600-241356622 GCCTGCCGCGTGGGGGCAGGCGG + Intronic
1168765828 20:381200-381222 CCCGGAGGCCGGGGGGCGGGAGG + Intronic
1169198721 20:3697374-3697396 CCCTGGCTCCTGGGGGCCGGGGG - Intronic
1170894108 20:20398697-20398719 ACCTGACGTCTGGGGGCGATAGG + Intronic
1171381689 20:24738382-24738404 GCCTCACTCCTGGGGTCGGGAGG - Intergenic
1172010688 20:31844270-31844292 GCCTGATGGCTGGGGGCTGAGGG - Intergenic
1172103048 20:32497241-32497263 ACCTGACTCCATGGGGCGGGTGG - Intronic
1172118722 20:32585497-32585519 GCCCGGCCCCTGGGGGCGCGGGG + Intronic
1173079514 20:39852267-39852289 GCCTGACACCTTGGGGAGGATGG + Intergenic
1173228398 20:41175419-41175441 GCCTGACTCCTGGGTGGGTGGGG + Exonic
1173471035 20:43323893-43323915 GTATGAAGCCTGGGGGCCGGGGG - Intergenic
1173743557 20:45419409-45419431 GCCTGGCAGCCGGGGGCGGGGGG + Intronic
1173824059 20:46035969-46035991 GGCAGAGGCCTGGGGGTGGGAGG + Intronic
1174035155 20:47664201-47664223 TCCTGAAGCCTGGGGCTGGGGGG - Intronic
1175742644 20:61430897-61430919 CCCTGAAGCCTGGGGGCTGCAGG - Intronic
1175783057 20:61695928-61695950 GCCTGAGGCCTGGCAGCGGGTGG - Intronic
1175889992 20:62311777-62311799 GCCAGACTCTGGGGGGCGGGAGG + Exonic
1176163073 20:63658369-63658391 GGCTGACAGCTGGGGACGGGTGG + Exonic
1179893689 21:44350243-44350265 GGGTGACGCCGGGGCGCGGGCGG + Intronic
1180042713 21:45288269-45288291 GGCTGACGGCTGGTGGCGCGGGG + Intergenic
1181434327 22:22901360-22901382 GCTTGATGCCTTGGGGTGGGAGG - Intergenic
1181435264 22:22906726-22906748 GCTTGATGCCTTGGGGTGGGAGG - Intergenic
1182560211 22:31153640-31153662 GCCTGAGGCCCAGGGGTGGGTGG + Intergenic
1182766249 22:32760197-32760219 GGCTGTTGGCTGGGGGCGGGTGG - Intronic
1182843403 22:33410411-33410433 GACTGAATCATGGGGGCGGGGGG + Intronic
1183425015 22:37734694-37734716 GCCTGGGCCCTGGGGGCTGGTGG + Exonic
1183794924 22:40108933-40108955 GCCTGTTGGCTGGGGGTGGGTGG - Intronic
1183946192 22:41327141-41327163 GCAGGAGGCCTGGGGGAGGGAGG + Intronic
1183993207 22:41612832-41612854 GGCTCACGCCTGGAGGTGGGAGG - Intronic
1184711306 22:46250840-46250862 GGCTGGTGCCTGGGGGCGAGGGG - Intergenic
1185129741 22:49032233-49032255 GCCTGGGGCCTGCAGGCGGGTGG + Intergenic
1185130425 22:49035659-49035681 GCCTGGCTCCTGGGTACGGGTGG + Intergenic
1185269550 22:49922787-49922809 GTGTGAGGCATGGGGGCGGGAGG + Intronic
1185402472 22:50626055-50626077 GGGTCACGCCTGGGGGCAGGAGG + Exonic
950032673 3:9862795-9862817 GCCTGACCCCTGCGGGCTGCCGG - Intergenic
952414276 3:33076251-33076273 GTGTGAGGCCTGGGGGAGGGAGG + Intronic
954717327 3:52533299-52533321 CCCCGACGCCCGGGGGCGGGCGG - Intronic
954797036 3:53166822-53166844 GCCTGGAGCCTGGGGCCAGGTGG - Intronic
954860891 3:53689466-53689488 GCCTGGGGGCTGGGGGCTGGGGG + Intronic
956664783 3:71631995-71632017 CCCTGTCCCCTGGGGGCTGGGGG - Intergenic
958170459 3:89933282-89933304 GCCTGACACATGGGGGTGTGTGG + Intergenic
959539458 3:107523393-107523415 GGCTGGGGCCGGGGGGCGGGGGG + Intronic
959946106 3:112126749-112126771 GCCTGAGGCCTGGAGGCTGAAGG - Intronic
960188759 3:114677316-114677338 GTCTGAAGCCTGGGGACTGGCGG - Intronic
961654403 3:128433293-128433315 ACCTGGCGCCGGGGGGAGGGAGG - Intergenic
961785395 3:129344137-129344159 GCCTGACCCCTGCGGGCGGCCGG - Intergenic
962848901 3:139293326-139293348 GCCTGAAGCCTGGGGGTAGAGGG + Intronic
963664417 3:148164692-148164714 GCCTTCCTGCTGGGGGCGGGGGG + Intergenic
965237009 3:166137021-166137043 GCCAGGGGCCTGGGGACGGGTGG + Intergenic
966491476 3:180532059-180532081 GCCTGAAGGCTGGGGGCTGGGGG + Intergenic
968597375 4:1492404-1492426 ACCTGACGCCTGAGGGTGGGAGG + Intergenic
968802292 4:2751104-2751126 GCCAGAAGCCCGGGGGCTGGAGG - Intronic
969307903 4:6336208-6336230 GCCTGGGGACTGGGGGCGTGTGG - Intronic
969309834 4:6346825-6346847 GACTGAAGCCTGGGTGCCGGCGG - Intronic
969477074 4:7427845-7427867 GCCTGGTGCGGGGGGGCGGGGGG - Intronic
973338848 4:48984375-48984397 GCCTGTCGCAGGGGGGCTGGGGG + Intergenic
976146142 4:82044241-82044263 GCTGGACGCCGCGGGGCGGGCGG - Intronic
976194933 4:82523218-82523240 GCCAGAGGGATGGGGGCGGGGGG + Intronic
978393535 4:108253029-108253051 GCCCTAGTCCTGGGGGCGGGGGG + Intergenic
978490061 4:109302770-109302792 GCCGGACGCCGGGCGCCGGGAGG - Intergenic
979521875 4:121676664-121676686 ACAGGAAGCCTGGGGGCGGGGGG + Intronic
980103814 4:128567722-128567744 GCCTGACTCCAGGGAGCAGGGGG - Intergenic
981727365 4:147861938-147861960 GCCTGAAGCCTGGGAGCCGCTGG - Intronic
985521916 5:377747-377769 GCCTGGAGCCTGCGGGAGGGAGG + Intronic
988610028 5:32714358-32714380 GGCTGAGGCCTGGGGCTGGGCGG + Intronic
988784253 5:34551430-34551452 GCTTGAACCCTGGAGGCGGGAGG - Intergenic
989178756 5:38556313-38556335 CCGTGAGTCCTGGGGGCGGGTGG - Intronic
989228870 5:39064632-39064654 GCCTGAGACCTGGGAGCGGGAGG + Intronic
990278932 5:54229354-54229376 GCCTGCCCCCTGGTGGCTGGTGG + Intronic
990488213 5:56279584-56279606 GCCTGACGCCAGAGGCCGAGGGG + Intergenic
991408172 5:66321786-66321808 TCCTGACACCTGGAGGAGGGAGG + Intergenic
992069542 5:73136378-73136400 GCCTGTCCCCTTGGGGAGGGAGG - Intergenic
992641480 5:78772052-78772074 GCCCGACGCCTGGTGCTGGGTGG - Intergenic
992671901 5:79069671-79069693 GCCTGAGGCCGCGGGGCCGGCGG + Intronic
997210617 5:132074703-132074725 GCCCTACTCCTGGGGGCTGGGGG + Intronic
997635377 5:135400185-135400207 GCCTGAGGACTGGGGGGTGGGGG - Intergenic
1001384555 5:171328095-171328117 GGCTGAGGACTGGGGGTGGGGGG + Intergenic
1002121153 5:177006088-177006110 GCCTCACGCCTCGGGGCGCCAGG - Intronic
1002190163 5:177473667-177473689 GCCGGCCGGCGGGGGGCGGGGGG + Intronic
1002428266 5:179188254-179188276 GTCAGAGGCCTGGGGGAGGGGGG + Intronic
1002897089 6:1385557-1385579 GCCTTCCGCCTGGGCCCGGGAGG - Intergenic
1004116584 6:12774472-12774494 GCTTGAACCCTGGAGGCGGGGGG - Intronic
1006830391 6:36964600-36964622 TCCTGAGTCCTGGGGGTGGGAGG + Exonic
1007062442 6:38954218-38954240 GCCTGACTACTGGAGGAGGGAGG + Intronic
1007633488 6:43285220-43285242 GCGGGACGCCCCGGGGCGGGGGG - Exonic
1016826445 6:148392777-148392799 GCCTGACGCCTTGGCCCAGGTGG + Intronic
1018950820 6:168377757-168377779 GGCTGACGCCTGAGCTCGGGCGG + Intergenic
1019016921 6:168886511-168886533 GCCTGCGGCCTGGGGACGGAGGG - Intergenic
1019316917 7:391124-391146 GCCTGAAGGGTAGGGGCGGGCGG + Intergenic
1019610350 7:1933582-1933604 GCCAGAGGCCTGGGGGCGGCCGG - Intronic
1019631655 7:2052841-2052863 GCCTGGAGCATGGGGGAGGGAGG + Intronic
1023700898 7:42891073-42891095 GCCAGACGCCAGGGTGCTGGAGG + Intergenic
1023990590 7:45126140-45126162 GACTCACTCCTGGGGGTGGGTGG - Intergenic
1026979440 7:74517959-74517981 GCCTGCAGGCTGGGGGTGGGTGG - Intronic
1029423376 7:100483306-100483328 TCCTGGCACCTGGGGGCGGTGGG + Intergenic
1029432249 7:100539071-100539093 GCCTGAGGCCTGAAGGCGGTGGG + Intergenic
1029464776 7:100718413-100718435 AACGGACGCATGGGGGCGGGGGG + Intergenic
1030592303 7:111496699-111496721 GCCTGAGACCTGGGGGCTGCTGG - Intronic
1030756334 7:113291657-113291679 GCCTGAGGCCTGGGGGCCTGGGG + Intergenic
1031011191 7:116526250-116526272 CCCTGACCCCTGGCGGCGGGCGG + Intronic
1033406177 7:141073239-141073261 GCGTGACGCTCGGGGGCTGGCGG + Intergenic
1034267864 7:149789860-149789882 GCCAGAAGCCTGGGGGAGAGGGG + Intergenic
1034436074 7:151063247-151063269 GCCGGGGGCCTGGGGGCTGGGGG + Intronic
1034444713 7:151107928-151107950 GCCTGAAGGGTGGGGGCAGGAGG - Intronic
1034936056 7:155201716-155201738 GCCTGGTGCCTGGGAGTGGGAGG + Intergenic
1035361409 7:158316097-158316119 GCCAGCCGCCGGGGGGCAGGTGG + Intronic
1035609051 8:948313-948335 GCGTGTCGCCTGCGGGCGTGAGG + Intergenic
1036552346 8:9826619-9826641 CCGTGACGCCTGGAGGCAGGAGG - Intergenic
1036646897 8:10616640-10616662 CCCTGAGGCCTGGGGGAGGAAGG + Intronic
1036646933 8:10616811-10616833 GCCTCACGCCTGGTGGAGGGAGG - Intronic
1036661947 8:10714613-10714635 GCCAGACGCCTGGGTGCAGATGG + Intergenic
1037099970 8:15032743-15032765 GCCTGACGTCTGGGGCTGTGGGG - Intronic
1037337050 8:17801561-17801583 GGCTGGCGCCGGGGGGCGTGGGG - Intergenic
1037450751 8:19013861-19013883 GGCCGACGCCTCGGGGAGGGGGG + Intronic
1037827014 8:22165562-22165584 GCCCGTCGCCGGGGGGCCGGGGG - Intronic
1040471539 8:47738576-47738598 TCCTGTCGCCGGAGGGCGGGGGG + Exonic
1041030957 8:53734762-53734784 GACTGACGCCCGGTAGCGGGTGG - Intronic
1041208695 8:55524366-55524388 TCCTGTCGGCTGGGGGCGGCTGG + Exonic
1042398449 8:68317752-68317774 GTCTGTCGCCTGGGGGTTGGGGG + Intronic
1045098695 8:98825229-98825251 GCCTGACCTCCCGGGGCGGGAGG - Intronic
1045601677 8:103723903-103723925 GCCTGGAGCCTGGGGCCAGGAGG + Intronic
1046419323 8:113959183-113959205 TCCTGACACCTGGGGAAGGGAGG - Intergenic
1046654139 8:116874511-116874533 GCCGGACTCCTGGGGGCGGGAGG - Intronic
1048112902 8:131487360-131487382 GCCAGACGCCTTGGAGCAGGGGG - Intergenic
1049402508 8:142435873-142435895 CCCTGCTGCCTGGGGGCTGGTGG - Intergenic
1049501916 8:142971561-142971583 TCCTGAAGCCTAGGGGAGGGAGG - Intergenic
1049616404 8:143577523-143577545 CCCTGAAGAGTGGGGGCGGGAGG + Intronic
1049647205 8:143740783-143740805 TCCTGACACCTGGGGCGGGGTGG - Intergenic
1049721140 8:144116077-144116099 GCATGGGGCCTGGGGGCGGGCGG - Exonic
1053014724 9:34655288-34655310 GCCCCAGGCCTGGGGGCAGGGGG - Exonic
1053593473 9:39534988-39535010 GCCTGGGGCCTGGGGGGCGGGGG - Intergenic
1053851207 9:42289696-42289718 GCCTGGGGCCTGGGGGGCGGGGG - Intergenic
1054572833 9:66830289-66830311 GCCTGGGGCCTGGGGGGCGGGGG + Intergenic
1056406838 9:86282775-86282797 GCGTGACGTCGGGGAGCGGGCGG + Intergenic
1057147119 9:92765471-92765493 TGCAGACGTCTGGGGGCGGGAGG + Intergenic
1057291669 9:93810795-93810817 GCCTGTCTCCTGGGAGCTGGGGG + Intergenic
1057643946 9:96855063-96855085 CCCTCACGCCTGGGGGCGCCAGG - Intronic
1059414756 9:114155861-114155883 GCCTGGCGCGGCGGGGCGGGGGG + Exonic
1060281318 9:122217364-122217386 GCCAGGAGCCTGGGGGCTGGCGG - Intronic
1060479590 9:124010487-124010509 GCCTGAAACCTGGAGGCTGGGGG + Intronic
1061407301 9:130399543-130399565 GGCTGAGTCCTGGGGGCCGGGGG - Intronic
1061432219 9:130538274-130538296 GGCTGAGGGCTGGGGGCAGGTGG - Intergenic
1061862582 9:133475603-133475625 GCAGGAGGCCTGGGGGCGAGGGG + Exonic
1061908825 9:133712298-133712320 GACTGAGGCCTGGGGGCAGGAGG - Intronic
1062092682 9:134686792-134686814 GCCTGACCCCTAGGTGCTGGGGG + Intronic
1062435658 9:136545631-136545653 GCCCCACGGCTGGGAGCGGGCGG - Intronic
1203772196 EBV:55113-55135 GCCTGGCGCCTGGAGGCCGAAGG - Intergenic
1186413279 X:9362039-9362061 GGCTGAGGCGGGGGGGCGGGGGG + Intergenic
1187903224 X:24043726-24043748 GTCTGACGGCTGGGGGTGGGAGG + Intergenic
1187904466 X:24053275-24053297 GTCTGACGGCTGGGGGTGGGAGG + Intergenic
1189889156 X:45580998-45581020 GCCTGAAGCCTGGGGCTGTGTGG + Intergenic
1190717367 X:53115371-53115393 GCCTGAAACCTGGGGCCGGGGGG + Intergenic
1192438084 X:71154916-71154938 GGCTGGGCCCTGGGGGCGGGGGG - Intronic
1195100460 X:101550612-101550634 GCCTGTGGCCTGGGGGAAGGAGG + Exonic
1199559478 X:149147257-149147279 GCCTGAAGCCTGGGGCCCGGGGG + Intergenic
1200138621 X:153886499-153886521 CCCAGAGGCCTGGGGCCGGGCGG + Intronic
1200239933 X:154488134-154488156 GCTCGTCGCCTGGCGGCGGGGGG - Exonic
1201282562 Y:12354125-12354147 CCCTGGCACCTGGCGGCGGGCGG - Intergenic
1202332876 Y:23773151-23773173 GCCTGTCGTGTGGTGGCGGGAGG - Intergenic
1202537893 Y:25896912-25896934 GCCTGTCGTGTGGTGGCGGGAGG + Intergenic