ID: 1145961033

View in Genome Browser
Species Human (GRCh38)
Location 17:28886662-28886684
Sequence TCCCTAGGCAGTCTGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145961022_1145961033 10 Left 1145961022 17:28886629-28886651 CCTCGAAGCTCCCTGGCCCATCC 0: 1
1: 0
2: 1
3: 11
4: 215
Right 1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1145961027_1145961033 -1 Left 1145961027 17:28886640-28886662 CCTGGCCCATCCTGGCTGGGCCT 0: 1
1: 1
2: 5
3: 81
4: 467
Right 1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1145961028_1145961033 -6 Left 1145961028 17:28886645-28886667 CCCATCCTGGCTGGGCCTCCCTA 0: 1
1: 0
2: 3
3: 23
4: 238
Right 1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1145961026_1145961033 0 Left 1145961026 17:28886639-28886661 CCCTGGCCCATCCTGGCTGGGCC 0: 1
1: 0
2: 4
3: 49
4: 379
Right 1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 154
1145961029_1145961033 -7 Left 1145961029 17:28886646-28886668 CCATCCTGGCTGGGCCTCCCTAG 0: 1
1: 0
2: 5
3: 89
4: 1185
Right 1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145961033 Original CRISPR TCCCTAGGCAGTCTGTGTGC AGG Intronic
901070355 1:6513893-6513915 TCCAGAGGCAGTTTCTGTGCAGG + Intronic
903787610 1:25871807-25871829 TACCCAGGCATTCTGTGTGCTGG + Intergenic
906580323 1:46930434-46930456 TCCATGGGCTGTATGTGTGCAGG - Intronic
908776519 1:67646266-67646288 TCCCTAGGCTGTTTGCCTGCTGG + Intergenic
912077383 1:105892244-105892266 TCCCTAGGTACTCTGTATGGTGG - Intergenic
913054148 1:115141928-115141950 TCCCCAGGCATACTATGTGCTGG - Intergenic
916579862 1:166097385-166097407 TGCCTGTGCAGTCTGTATGCTGG - Intronic
916687190 1:167158111-167158133 TCCCTCGGCAGAATGTGTACTGG + Intergenic
916729451 1:167553345-167553367 TCCCCAGGCGGGCTGTGGGCGGG - Intronic
917482579 1:175424702-175424724 TCCCTATGTAGCCTGTCTGCTGG - Intronic
920880855 1:209879337-209879359 TGACTACGCAGTCTGTTTGCAGG + Intergenic
921429887 1:215053306-215053328 TCCCTAGGTATTCTGGGTGGTGG + Intronic
921772939 1:219064511-219064533 TCACTAGGCAGTCTTGGTACTGG - Intergenic
923735032 1:236598494-236598516 TCCCTAGGCACTCTTATTGCAGG - Intronic
1065147089 10:22780623-22780645 TCCCCAGGGAGACTGTGTGGTGG - Intergenic
1065316309 10:24467261-24467283 TCCGTGTGCAGTCTGTGGGCAGG + Intronic
1065754900 10:28922216-28922238 TCTCTAGGCTGCCTGTCTGCTGG + Intergenic
1067426782 10:46216791-46216813 TACCTAGCCAGGCTGTGTTCTGG + Intergenic
1068023608 10:51616356-51616378 TCCCTGGGCAGTTGGTGTGTGGG + Intronic
1069118831 10:64542467-64542489 TCTCTAGGCTGTCTGTCTCCAGG + Intergenic
1069830220 10:71278463-71278485 GCCCTGGGCAGTGTGTGTACGGG - Intronic
1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG + Intronic
1072726100 10:97815193-97815215 TCCCTTGGCAGGGTGTGTCCTGG + Intergenic
1073011384 10:100362619-100362641 ACCCTGAGCATTCTGTGTGCAGG - Exonic
1073479823 10:103779434-103779456 TCCCTAGGAAGTGTGGGAGCTGG + Intronic
1074403535 10:113161935-113161957 TCCCCAGGCATTCTGTGAGATGG + Intronic
1077060744 11:616926-616948 TCCCCAGGCAATCTCTGTGTAGG + Exonic
1077992477 11:7424317-7424339 GCCCTAGGCAGTCTGCTTGGGGG - Intronic
1078966230 11:16347178-16347200 TCCATAGGCAGTCAGTCAGCAGG - Intronic
1079423914 11:20322221-20322243 TCTCTAGCCAGTCTGTCAGCAGG + Intergenic
1079668817 11:23140586-23140608 TGCCTAAGCAGTCGGTGTTCTGG + Intergenic
1085718296 11:78891951-78891973 TCCCTAGGGATTCTGTCAGCAGG + Intronic
1091104373 11:132904777-132904799 ACCCTGGGCAGTCTGAGTGGTGG + Intronic
1091587124 12:1822735-1822757 TGCCTGGGCAGTGTGTGTGATGG + Intronic
1101724408 12:107377164-107377186 TCCCTAGGCAGCCCATGTCCAGG + Intronic
1102574705 12:113849086-113849108 TCCCTGGGCCGTCTGTGTAAGGG - Intronic
1105580318 13:21689706-21689728 TCACTGAGCAGTCTGTGTGAGGG + Intronic
1105778493 13:23685108-23685130 TGCCTATGCAGTCCCTGTGCAGG + Intergenic
1106553013 13:30787815-30787837 TCCCATGGCAGCCTGTGAGCAGG + Intergenic
1109702703 13:66047857-66047879 TCAATAGGGACTCTGTGTGCAGG + Intergenic
1116642756 14:47485980-47486002 TCACTAGGGACTCTGTGTGGGGG - Intronic
1118595018 14:67428617-67428639 TGCAGAGGCAGTGTGTGTGCTGG - Intergenic
1118609796 14:67531407-67531429 CCCCTTGGCAGTCTGTGGGAGGG - Intronic
1118723759 14:68612239-68612261 TCCCTCGTCAGTCTGTCTCCTGG - Intronic
1118737431 14:68711999-68712021 ACCCTGGCCAGTCTGGGTGCTGG - Intronic
1119136147 14:72222306-72222328 TCCCCAGGCAGTGAGTGGGCAGG - Intronic
1119142324 14:72278558-72278580 TCACTAGGAAGTGTGTGTGTGGG + Intronic
1119601090 14:75977888-75977910 AACCTAGACATTCTGTGTGCAGG - Intronic
1120632614 14:86909503-86909525 TCCATAGGGAGTGTGTGTTCAGG - Intronic
1121523837 14:94604670-94604692 TCCCTAGGCAGAACATGTGCTGG - Intronic
1122091591 14:99344314-99344336 TCCCTGGGCAGCATGTCTGCTGG + Intergenic
1122258421 14:100497947-100497969 TCCCCAGACTGTGTGTGTGCTGG + Intronic
1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG + Intronic
1123217465 14:106824511-106824533 TACATAGGCACTCTGTGTGTGGG - Intergenic
1124432148 15:29617140-29617162 TCCCACGGCAGGCTGTCTGCAGG + Intergenic
1128491693 15:68152938-68152960 TCTCTGGGTAGTCTGTCTGCTGG + Intronic
1128944822 15:71813025-71813047 CCCTCAGCCAGTCTGTGTGCTGG + Intronic
1129312706 15:74723795-74723817 TCCCTAAGGAGTCTGAGTCCTGG - Intronic
1131171507 15:90182059-90182081 TCCCAAGGTGCTCTGTGTGCTGG + Intronic
1132744447 16:1430890-1430912 TCCCCAGGCAGGCCGCGTGCAGG + Intergenic
1136115477 16:28091712-28091734 TCCCCAGGCAGGCTCTGTGAGGG + Intergenic
1136299106 16:29321277-29321299 GCCCGAGGCTGTCTGTGTGAAGG - Intergenic
1139527352 16:67525109-67525131 TCCCTAGGCAGACAGTGGGTAGG - Intronic
1141406874 16:83802337-83802359 CCCCTAGGCAGTCTGTCTCCAGG + Intergenic
1141648857 16:85381935-85381957 TCCTCAGGCACTCTGTGAGCAGG - Intergenic
1142563094 17:822756-822778 TCCCTATGCAGTGTGTGAGCAGG + Intronic
1144102742 17:11957665-11957687 TCGCTAGGCTGTCTCTTTGCTGG - Intronic
1144808767 17:17985254-17985276 TGACTAGGAAGTGTGTGTGCAGG - Intronic
1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG + Intronic
1148683463 17:49487514-49487536 TCCCTGGGGAGTCTGAGTCCCGG - Intergenic
1148718221 17:49730945-49730967 TCCCTTGGCTGTCTGTTTACTGG + Intronic
1149447710 17:56726352-56726374 TACCTTTGCAGTCTGTGTGTTGG - Intergenic
1151461850 17:74259020-74259042 TCCCCAGGTAGCCTGTGTGCAGG + Intronic
1152542316 17:80982475-80982497 GCCCTAGGCCTTCTGGGTGCAGG - Intergenic
1155041759 18:22070749-22070771 TCCCAAGGCCGTCTCTGTCCTGG - Intergenic
1155703376 18:28777969-28777991 TCCCTAGGGAGTGTCTGTGGAGG + Intergenic
1155833941 18:30554262-30554284 TCCCAAGGCAGTCAGTTGGCTGG - Intergenic
1159309646 18:66690307-66690329 TTCCTTGGCAGTCTATCTGCAGG - Intergenic
1159971995 18:74666358-74666380 TTCCTGGGCACTCTGTGTTCAGG + Intronic
1160058608 18:75509506-75509528 TCTCCAGGCAGCCTGTGTGTTGG - Intergenic
1162959958 19:14119754-14119776 TGCCTGGGCAGTCTGTCTCCGGG - Exonic
1163393475 19:17044935-17044957 CCCCTAGACAGTCCCTGTGCTGG - Intergenic
1164459641 19:28435728-28435750 TCCCTAGGCAGTCAGGGGCCAGG - Intergenic
1164469839 19:28520788-28520810 TCACTAGGCAGGCTCTGTGCTGG + Intergenic
1165075912 19:33279786-33279808 GCCCCAGGCAGGCTGGGTGCAGG - Intergenic
1167421870 19:49408832-49408854 TCCCTAGGCAGTATGTGTCTGGG + Intronic
1168333234 19:55581318-55581340 TCCCTTGGCTGTCTGGGTGAAGG + Intergenic
928301350 2:30127984-30128006 TCCAGAGGCAGTGTGTGTGTGGG - Intergenic
929574198 2:43041939-43041961 TCTCTAGGCAGTCTGTGGAGGGG - Intergenic
930254168 2:49069839-49069861 TTACAAGGCAGTCTGTGAGCAGG + Intronic
933707492 2:85302868-85302890 TCCATAGGCAGTGTGTGGGGTGG + Intronic
935601257 2:104924238-104924260 TCCATAGGTGGTCTGTGTCCAGG - Intergenic
935899221 2:107772918-107772940 TCCCTAGGCAGTGGGTGTCAAGG - Intergenic
941468030 2:165854010-165854032 TCCCTAGGCAGTATGTGCAGTGG + Intergenic
942431701 2:175918478-175918500 TCTATATGCTGTCTGTGTGCTGG - Intergenic
944984677 2:205161899-205161921 TTCCTGTGCATTCTGTGTGCTGG + Intronic
946595495 2:221301564-221301586 ACCCTAGGCAATCTGATTGCAGG - Intergenic
947532529 2:230921776-230921798 ACCCGAGGCTGTCTGTCTGCAGG + Intronic
1169488084 20:6050341-6050363 TCCCTTGGAAGTCTATGGGCAGG - Intronic
1170832049 20:19851157-19851179 TCTCTAGGCATGCTGGGTGCTGG + Intergenic
1173472785 20:43336708-43336730 TGCCTAGACTGTCTGTGTGAGGG + Intergenic
1176284168 21:5010369-5010391 TCCCTAGGTAGTCTGCATGTTGG + Intergenic
1178643326 21:34364132-34364154 TACCTATGCAGTGTGTGGGCAGG - Exonic
1178723286 21:35029065-35029087 TCACTAGGCAGTGAGTGTGAAGG - Intronic
1179873013 21:44253106-44253128 TCCCTAGGTAGTCTGCATGTTGG - Intronic
1181629930 22:24145496-24145518 TCCACAGGCAGTCTGGGTCCTGG - Intronic
1182257800 22:29050704-29050726 TCCCTTGGCAGTCCGAGGGCAGG - Exonic
1183237317 22:36629320-36629342 TCCCTGGGCAGGCTGTGAGCTGG + Intronic
1184098467 22:42329267-42329289 GCCCTTGGCAGCCTGTGTGCTGG - Intronic
1185223640 22:49641217-49641239 TCCCTGGGGTGTCTGTGGGCAGG - Intronic
1203274716 22_KI270734v1_random:79617-79639 TCCCTGGGCAATCCGTGTCCTGG - Intergenic
961479595 3:127171395-127171417 TCCCTGGGCAGTCTGAACGCTGG - Intergenic
962263655 3:133930551-133930573 TCCCTTGAAGGTCTGTGTGCAGG + Intergenic
962821661 3:139054581-139054603 TCCCATGGCAGTATATGTGCTGG + Intronic
965866773 3:173214733-173214755 TATCCAGGCAGCCTGTGTGCAGG + Intergenic
967224224 3:187275485-187275507 TCCCCAGGCGGTAGGTGTGCTGG + Intronic
967945406 3:194799947-194799969 TCCCAAGTGAGTATGTGTGCTGG + Intergenic
968566017 4:1313295-1313317 TGCCCAGGCTGTCTCTGTGCTGG - Intronic
969477358 4:7429161-7429183 GCCCTAGGCAGGGGGTGTGCCGG - Intronic
975646993 4:76555394-76555416 TCCCTGGGCAGGCAGGGTGCTGG + Intronic
976455831 4:85246185-85246207 TCCCTAGGGCGTGGGTGTGCAGG + Intergenic
984590683 4:181614284-181614306 TCACTAGGCAGGCAGTTTGCAGG - Intergenic
985429506 4:189865519-189865541 TCCCTAGGCCTCCTATGTGCTGG - Intergenic
985619630 5:947411-947433 TCCCTAGGCTGTCTGAGGTCCGG + Intergenic
990611022 5:57457000-57457022 TCCCAAGGAAGTCTGGCTGCTGG + Intergenic
998084559 5:139307920-139307942 TCCCTAGGTACTCTGTATGGTGG - Exonic
999868398 5:155726905-155726927 TCCCTAGGCAATGGGTGGGCGGG - Intergenic
1001684202 5:173580984-173581006 TCCATATGCAGGCTGTGTCCAGG - Intergenic
1001919845 5:175591154-175591176 TCCCTGGGCAGTGTGGATGCAGG + Intergenic
1002181034 5:177431297-177431319 TCCCAAGGCAGTCAGTCTGTGGG - Intronic
1010141494 6:72620129-72620151 TCCCTATGGAGTTTCTGTGCAGG - Intergenic
1010347532 6:74829542-74829564 ACCCTAGGCAGCCTGTATTCAGG + Intergenic
1014747852 6:125220938-125220960 TCCCTCTGCATTCTGTGTCCTGG + Intronic
1017761900 6:157575612-157575634 TCCCTAGACAATGTGTGTGGGGG - Intronic
1018438267 6:163782870-163782892 TCACCAGGCAGTGTCTGTGCAGG - Intergenic
1018630726 6:165819662-165819684 TGCCAAGGCTGTCAGTGTGCTGG + Intronic
1020002434 7:4763528-4763550 TCCCTGGGCTGTCCGTGAGCAGG + Exonic
1020221621 7:6242846-6242868 CCTCTAGGCAGTCCCTGTGCTGG + Intronic
1022813912 7:33895522-33895544 TCTCTCGGGAGTCTGGGTGCTGG + Intergenic
1024207585 7:47177118-47177140 TCAGTAGGGAGTCTGTGTGGGGG - Intergenic
1029751061 7:102542665-102542687 GCCCAGGGCACTCTGTGTGCAGG + Intronic
1031220465 7:118958467-118958489 TCTCCAGGCAGCTTGTGTGCTGG + Intergenic
1032091567 7:128914132-128914154 TCCCTGGGCAGCCTCTGTGAGGG + Intergenic
1032472681 7:132189815-132189837 TCCCTAGAAACTCTGTGTGAGGG + Intronic
1034030468 7:147757142-147757164 TCCCTTGGCAGCCAGTTTGCAGG - Intronic
1039242156 8:35568764-35568786 TGCCTAGACAGTCGGAGTGCAGG + Intronic
1039468740 8:37800995-37801017 TCCTTGGGGAGTCTGAGTGCTGG + Intronic
1042245158 8:66702576-66702598 AACCTAGGCAGTGTGTGTCCAGG + Intronic
1044952025 8:97444203-97444225 TGTCTAGGCAGTCAGCGTGCAGG - Intergenic
1047074229 8:121381926-121381948 TGCCTAGGGAGTCAGAGTGCTGG + Intergenic
1047937544 8:129797440-129797462 TATCCAGGCAGTCAGTGTGCAGG + Intergenic
1048020362 8:130532804-130532826 AACTCAGGCAGTCTGTGTGCAGG + Intergenic
1048170788 8:132104388-132104410 TTGCTAGGCATTGTGTGTGCTGG + Intronic
1048976024 8:139673621-139673643 TCTCTTTGCAGTCTGTTTGCCGG - Intronic
1053331347 9:37210943-37210965 GCCCTAGGGAGTATGTGTACAGG - Intronic
1057873341 9:98734166-98734188 ATCCTAGGAAGTTTGTGTGCTGG - Exonic
1060372493 9:123087757-123087779 CCCCTAGTCAGGCTGTTTGCAGG - Intronic
1060736662 9:126070535-126070557 TCCCTGGCCTGTCTGTCTGCTGG + Intergenic
1061488128 9:130930592-130930614 TCCCTGGGCTGTCACTGTGCAGG - Intronic
1062403301 9:136381846-136381868 TCTCTGGGAAGCCTGTGTGCAGG + Exonic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1198322255 X:135529867-135529889 TTCCTAGTCAGTCTGTGTACTGG + Intronic
1198963216 X:142204181-142204203 TTCCTAGGGAGTTTGTCTGCTGG + Intronic
1200852835 Y:7903553-7903575 CACCTAGGCAGTATGTGTACTGG - Intergenic