ID: 1145961186

View in Genome Browser
Species Human (GRCh38)
Location 17:28887351-28887373
Sequence CAGGCTAGGGACTAGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 0, 3: 39, 4: 342}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145961168_1145961186 27 Left 1145961168 17:28887301-28887323 CCTGCCAGCCTAGGGAAATAAAG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG 0: 1
1: 1
2: 0
3: 39
4: 342
1145961176_1145961186 -2 Left 1145961176 17:28887330-28887352 CCTGTGGAGGCGTCCCCCAAGCA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG 0: 1
1: 1
2: 0
3: 39
4: 342
1145961175_1145961186 2 Left 1145961175 17:28887326-28887348 CCAGCCTGTGGAGGCGTCCCCCA 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG 0: 1
1: 1
2: 0
3: 39
4: 342
1145961170_1145961186 19 Left 1145961170 17:28887309-28887331 CCTAGGGAAATAAAGCCCCAGCC 0: 1
1: 0
2: 2
3: 18
4: 207
Right 1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG 0: 1
1: 1
2: 0
3: 39
4: 342
1145961169_1145961186 23 Left 1145961169 17:28887305-28887327 CCAGCCTAGGGAAATAAAGCCCC 0: 1
1: 1
2: 2
3: 9
4: 130
Right 1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG 0: 1
1: 1
2: 0
3: 39
4: 342
1145961174_1145961186 3 Left 1145961174 17:28887325-28887347 CCCAGCCTGTGGAGGCGTCCCCC 0: 1
1: 0
2: 1
3: 2
4: 134
Right 1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG 0: 1
1: 1
2: 0
3: 39
4: 342
1145961173_1145961186 4 Left 1145961173 17:28887324-28887346 CCCCAGCCTGTGGAGGCGTCCCC 0: 1
1: 0
2: 1
3: 13
4: 190
Right 1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG 0: 1
1: 1
2: 0
3: 39
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145961186 Original CRISPR CAGGCTAGGGACTAGGGAAG AGG Intronic
901790758 1:11652740-11652762 CAGGCCAGGCACTGGGGAAGGGG + Intronic
902970518 1:20044814-20044836 CAGTCTAGGGAGGAGGGGAGAGG + Intronic
903256560 1:22106060-22106082 CAGACTGGGGTCTAGGGAATTGG - Intergenic
904099806 1:28015372-28015394 TGGGCTAGGGAATAGGGAATGGG + Intronic
904841471 1:33374401-33374423 GGGGCTAGGGACAAGGGTAGGGG + Intronic
905275974 1:36818558-36818580 CAGGGCAGGGACTTGGGCAGAGG - Intronic
905321582 1:37120956-37120978 CAGACCAGGGACTAGGAATGTGG + Intergenic
905563837 1:38947771-38947793 CAGGCAGGGGGCTAGGGAATGGG - Intergenic
905879259 1:41452947-41452969 AAGGCTAGTGACTAGGAAATAGG - Intergenic
906554695 1:46699772-46699794 CAGGCTACACTCTAGGGAAGGGG - Intronic
907038148 1:51235027-51235049 CACGCTAAGGACTGGGGAAAAGG - Intergenic
907895590 1:58687093-58687115 CAGGCTTGGGAGTAGGGACTTGG - Intronic
910742904 1:90540887-90540909 CAGTCTAGGGACTGGGGATTAGG + Intergenic
911163375 1:94704053-94704075 GGGGCTAGGGAGTAGGGAATTGG + Intergenic
911183132 1:94878325-94878347 CAGGCTGGGGACTGGGGACAGGG - Intronic
912706924 1:111921534-111921556 CAGGGGAGGGAGTAGGGATGAGG + Intronic
912802407 1:112728392-112728414 CAGGAGAGGGAAGAGGGAAGAGG - Intergenic
913349049 1:117837715-117837737 GAGGCTGGAGACTAGGGGAGGGG + Intergenic
913597779 1:120394818-120394840 TGGGCTAGGGGTTAGGGAAGGGG - Intergenic
914089554 1:144484496-144484518 TGGGCTAGGGGTTAGGGAAGGGG + Intergenic
914309057 1:146449716-146449738 TGGGCTAGGGGTTAGGGAAGGGG - Intergenic
914513986 1:148357993-148358015 CAGGCAAGGGGCTAGGGAATGGG - Intergenic
914593054 1:149123411-149123433 TGGGCTAGGGGTTAGGGAAGGGG + Intergenic
915120763 1:153628511-153628533 CAGGCCAGGGACTAGCCCAGTGG - Intronic
915213747 1:154327273-154327295 CAGGCTGGGGAGTAAGGATGAGG + Intronic
915324750 1:155075640-155075662 GAGGCTAGGGCCTGGGGAAGGGG - Intergenic
915356005 1:155255452-155255474 CAGGTCGGGGACTAGAGAAGGGG + Intronic
916052967 1:161048998-161049020 CAGGCTAGACATCAGGGAAGAGG - Exonic
917344712 1:174017543-174017565 TTTGCTAGGGATTAGGGAAGAGG + Intronic
919728440 1:200898475-200898497 GGGACTAGGGACTAGGGCAGGGG - Intronic
919808432 1:201394742-201394764 CAGGCTATGGACAAGGGACGGGG - Intronic
919870014 1:201813128-201813150 GAAGCAAGGGCCTAGGGAAGAGG - Exonic
920268260 1:204743205-204743227 CAGGCCAGGGAAGAGGGAAACGG - Intergenic
920907911 1:210188931-210188953 CAGCCTAGGGAGGAGGGGAGAGG - Intergenic
921730541 1:218573137-218573159 CAGGCTACAGTCCAGGGAAGAGG + Intergenic
921944409 1:220877075-220877097 CAGGCTTGGGCCTGGGGAAGGGG + Intergenic
922546124 1:226458216-226458238 CAGGTTAAGGACTAGCGCAGAGG + Intergenic
1063395386 10:5682657-5682679 TAGGCTAGGGAAGAGGGATGGGG + Intergenic
1064086158 10:12348499-12348521 CAGGTTGGGGACCAGGGAACTGG + Intergenic
1064314610 10:14243635-14243657 GTTGCTAGGGACTAGGGGAGGGG + Intronic
1065437541 10:25718063-25718085 CAGCCTGGGGAGAAGGGAAGAGG - Intergenic
1065548295 10:26844520-26844542 CAGGGAAGGGAAGAGGGAAGAGG - Intronic
1067107336 10:43374902-43374924 AGGGCTGGGGACTAGGGAAAGGG - Intronic
1072438282 10:95432993-95433015 CAGGCTGGCAACTACGGAAGTGG + Intronic
1072523323 10:96249534-96249556 CAGGATAGGGAATTGGGAAAAGG + Intronic
1073053402 10:100683952-100683974 CAGACTAGGGACGGGGGGAGGGG + Intergenic
1076839606 10:133039520-133039542 CAGGCCTGGGACTGGGGAATGGG + Intergenic
1077231394 11:1459545-1459567 CAGGCTGTGGCCTAGGGGAGGGG + Intronic
1077660699 11:4066059-4066081 CAGGCCTGAGACAAGGGAAGTGG - Intronic
1077864696 11:6212346-6212368 TAGGCTGGGGAAGAGGGAAGTGG - Intronic
1078601208 11:12732727-12732749 CAGAGTTGGGACTAGGGGAGTGG + Intronic
1080836434 11:35944582-35944604 CACGCCAGAGACTCGGGAAGAGG - Intronic
1081620029 11:44613937-44613959 CTGGCTTGGGGCTTGGGAAGGGG + Intronic
1081631727 11:44694084-44694106 TGGGCTGGGGGCTAGGGAAGGGG + Intergenic
1082165656 11:48947393-48947415 GAGGCCAGGGACTGGGGATGAGG + Intergenic
1082237555 11:49837597-49837619 GAGGCCAGGGACTGGGGATGAGG - Intergenic
1082610929 11:55296561-55296583 GAGGCCAGGGACTGGGGATGAGG - Intergenic
1082658999 11:55887128-55887150 GAGGCCAGGGACTGGGGATGAGG + Intronic
1083899902 11:65638539-65638561 CAGGCCAGGGACTGGGGTGGAGG - Intronic
1083990717 11:66244299-66244321 CAGGCTGGGGCCTAAGGAGGGGG - Exonic
1084430510 11:69108221-69108243 CAGGCTGGGGACCAGGGTGGAGG - Intergenic
1085395721 11:76206274-76206296 CAGGCCAGGGACTGGGGCGGCGG - Intronic
1085396606 11:76209889-76209911 CAGGCTGGGGGCTAGGGAGGAGG - Intronic
1086004928 11:82026845-82026867 CAGCCTGGGGAGTAGGGGAGAGG - Intergenic
1086182342 11:83968279-83968301 CAGGTTAGGGACTGTGGAACTGG + Intronic
1087920363 11:103860298-103860320 CAGGCAGGGGACTCGGAAAGGGG - Intergenic
1088017699 11:105080929-105080951 CATGCCAGGGAGTAGAGAAGAGG - Intronic
1088102120 11:106167165-106167187 CAGGCAAGGGACTAGAGAATTGG - Intergenic
1089016327 11:115168224-115168246 CAGTCCTGGGACTAAGGAAGAGG + Intergenic
1089113715 11:116077396-116077418 CATGTTAGGGGCTAGGGAAGGGG + Intergenic
1089324860 11:117650074-117650096 CAGGCAAGGGACTAGAGCTGTGG + Intronic
1089443561 11:118534348-118534370 CAGCCAAGGTACTGGGGAAGGGG + Exonic
1090611742 11:128477496-128477518 CGTCCTAGGGAATAGGGAAGCGG - Intronic
1092230827 12:6774378-6774400 CAGGCCAGGGACGGGGAAAGTGG + Intronic
1092739415 12:11613749-11613771 CAGCCTGGGGAGAAGGGAAGAGG + Intergenic
1093751399 12:22804218-22804240 CAGGATAGGGAGTTGGAAAGGGG + Intergenic
1094234546 12:28148581-28148603 CAGGCAGGGGGCTAGGGAATGGG + Intronic
1095955601 12:47803979-47804001 CTGGGTAGGGACTGGGGAGGTGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096657123 12:53098620-53098642 CAGGCTAGGGCGTAGGTTAGGGG + Intronic
1096846066 12:54407796-54407818 CAGGCTGGGGCCAAGGGAGGGGG - Intronic
1097177387 12:57151354-57151376 GAGGCTAGGAAGCAGGGAAGAGG - Intronic
1097417955 12:59336987-59337009 AAGGGTGGGGACTAGCGAAGAGG - Intergenic
1098909961 12:76198904-76198926 CAGGCAGGGGGCTAGGGAATGGG - Intergenic
1099183056 12:79489558-79489580 TAGGCAATGGACAAGGGAAGGGG + Intergenic
1099704771 12:86138014-86138036 CTGGTAAGGGAGTAGGGAAGAGG - Intronic
1101741985 12:107507771-107507793 CTGGCTAGGGGGTGGGGAAGAGG - Intronic
1101827330 12:108230839-108230861 CAGGGCAGTGACCAGGGAAGAGG + Intronic
1102012487 12:109627204-109627226 CAGGCCAGGAGCTAGGGAATTGG - Intergenic
1104062614 12:125281168-125281190 CAGGGGAGGGAGGAGGGAAGAGG + Intronic
1104939211 12:132387001-132387023 CAGGCCAGGTCCTAGGGAAGGGG + Intergenic
1106821529 13:33469831-33469853 CAGGGTAGGGACAAGGGAAAAGG + Intergenic
1106918297 13:34538593-34538615 CAGGCTGGGTAGGAGGGAAGGGG + Intergenic
1107750162 13:43556909-43556931 CAGGGAAGGGACTAGGGGAGAGG + Intronic
1109470211 13:62793816-62793838 CAGGCAAGGGGTTAGGGAATCGG - Intergenic
1110457146 13:75702044-75702066 TTGGCTATGGTCTAGGGAAGTGG + Intronic
1114221579 14:20702192-20702214 CAGCCTGGGGAGGAGGGAAGAGG - Intergenic
1115848466 14:37565732-37565754 CAGGCTAGGTCCTAGGTAAGAGG - Intergenic
1117233641 14:53748125-53748147 CATGCTAGGTACTAAGTAAGTGG + Intergenic
1117445737 14:55802134-55802156 CAGGCAGGGGCCTAGGGAATGGG - Intergenic
1117497008 14:56315415-56315437 CAAGCAGGGGACTAGGGAATGGG - Intergenic
1117546375 14:56797673-56797695 CAGGCTCTGGAATGGGGAAGCGG - Intergenic
1119781193 14:77277824-77277846 AAGGCCAGGGACTGGGGAAGCGG + Intronic
1120252897 14:82080875-82080897 CTGTCTAGAGACTAGAGAAGGGG - Intergenic
1121114322 14:91332763-91332785 CAGTCTCGGGAGGAGGGAAGGGG - Intronic
1121437157 14:93927507-93927529 CAGGCTGGGGCCTGGGGGAGGGG + Intronic
1121702528 14:95965579-95965601 TGGGCAAGGGACTAGGGAATGGG - Intergenic
1123078515 14:105680872-105680894 GAGGCCAGGGACTGGGGATGGGG - Intergenic
1123816363 15:23983403-23983425 CATGCAAGGGGCTAGGGAAAGGG + Intergenic
1125818100 15:42603661-42603683 CAGGCAGGGGGCTAGGGAATGGG + Intronic
1126528768 15:49688840-49688862 CAGGACAGGGAATGGGGAAGTGG - Intergenic
1127215394 15:56818213-56818235 CAGGATGGGGACCAGGGGAGAGG + Intronic
1127403192 15:58612732-58612754 CGGGCTTGGGTCCAGGGAAGAGG - Intronic
1127902065 15:63348323-63348345 CAAGATGGTGACTAGGGAAGAGG + Intronic
1129256881 15:74338831-74338853 AGGGCAGGGGACTAGGGAAGGGG - Intronic
1130116961 15:81013775-81013797 CAGGCTGAGGACTGCGGAAGCGG - Intronic
1130995130 15:88899292-88899314 AGGGCTGGGGACTGGGGAAGGGG - Exonic
1131301291 15:91201875-91201897 GAGGCTAGGCACAAGGAAAGAGG - Intronic
1131499908 15:92952317-92952339 CAGGCTGGGGAGGAGGGAGGGGG + Intronic
1132663489 16:1071612-1071634 CAGGCTGGGGAGGAGGGGAGGGG + Intergenic
1133763942 16:8822130-8822152 CTGGGTAGGGGCTTGGGAAGTGG + Intronic
1135122848 16:19781447-19781469 CAGGGTAGAGATTAGTGAAGGGG + Intronic
1136296538 16:29307263-29307285 CAGTCTAAGGACTAGGCATGGGG - Intergenic
1136547834 16:30965506-30965528 CAGGGTTGGGCCTAGGGGAGAGG + Intronic
1137283427 16:46997225-46997247 GAGGCCAGGGAGTGGGGAAGAGG - Intergenic
1139520969 16:67482602-67482624 CAGGGTCGGGGCTAGGGTAGGGG - Exonic
1139654215 16:68377562-68377584 CAGGCCAGTGTCTAGGGAGGGGG - Intronic
1139830446 16:69793511-69793533 CAGGTAGGGGACTAGGGAATGGG + Intronic
1140728390 16:77834391-77834413 CCTGCTAGGTACTAGGGCAGGGG - Intronic
1140812894 16:78595239-78595261 CAGTCGTGGGACTAGGGAAGTGG + Intronic
1140988822 16:80188256-80188278 CTGGCTAGGGTCTAGGGCTGTGG + Intergenic
1141437268 16:84007384-84007406 CAGGCAAGGGCCTTGGGAATTGG - Intergenic
1141749873 16:85951304-85951326 AAGGCGAAGGTCTAGGGAAGTGG - Intergenic
1141869283 16:86773533-86773555 CAGCCAAGGGACCAGGGCAGTGG + Intergenic
1142058164 16:88013574-88013596 CAGTCTAAGGACTAGGCATGGGG - Intronic
1143155191 17:4832180-4832202 TGGGCTAGGGGTTAGGGAAGGGG + Intergenic
1143238661 17:5425151-5425173 CAGTCTAGACATTAGGGAAGGGG - Intronic
1143267815 17:5653557-5653579 CAGGCCAGTGAGTAGGGAAACGG + Intergenic
1143268541 17:5658679-5658701 CCAGCCAGGGATTAGGGAAGAGG + Intergenic
1143352008 17:6295698-6295720 CAGGCTGGGGCTGAGGGAAGAGG - Intergenic
1143657241 17:8302494-8302516 GCGGGTAGGGACTTGGGAAGTGG + Intergenic
1145080764 17:19892509-19892531 CAGCCTGGGGAGGAGGGAAGAGG + Intergenic
1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG + Intronic
1147235748 17:39056185-39056207 CAGGCTGGGGGCTAGGGAGTGGG - Intergenic
1147464172 17:40597943-40597965 CAGGCTGGGGAGTAGAGAAGGGG + Intergenic
1147636644 17:41967990-41968012 CAGTCTAGGGACTAGGGGTAAGG + Intronic
1147905263 17:43818433-43818455 GAGGCTGGGGAGTAGAGAAGGGG - Intronic
1148198471 17:45731776-45731798 CAGTCAAGGGGCTAGGGAATGGG + Intergenic
1148394106 17:47294873-47294895 CAGGCCATGGGCTAGGGAAATGG - Intronic
1148757041 17:49978688-49978710 CAGGCCAGGAAATGGGGAAGTGG - Intergenic
1149453443 17:56767896-56767918 GTGGCTAGGGCATAGGGAAGGGG + Intergenic
1149798452 17:59543448-59543470 CAAGCTAGAGCCTAGAGAAGAGG + Intergenic
1151439857 17:74121193-74121215 CAGAAGAGGGAGTAGGGAAGTGG + Intergenic
1152562984 17:81087799-81087821 AAGGCTGGGGACACGGGAAGAGG - Intronic
1152671841 17:81612931-81612953 CAGGGGAGGGAGGAGGGAAGGGG - Intronic
1153805242 18:8705134-8705156 CAGGGGAGGGGCGAGGGAAGGGG - Intergenic
1154237103 18:12616413-12616435 CAGGCCAGGATCCAGGGAAGTGG + Intronic
1155714083 18:28918380-28918402 CAGGCAGGGGGCTAGGGAATAGG - Intergenic
1157059591 18:44272353-44272375 CAGGGTAAGTACTAGGGAAGAGG + Intergenic
1158217124 18:55111775-55111797 CAGGAGAGGGAGTAGGAAAGAGG + Intergenic
1158543261 18:58375305-58375327 CAGGGTAGGCACTAGAGAACAGG - Intronic
1158567882 18:58570433-58570455 CAGGCTAGTTACTAGGCAGGTGG - Intronic
1159545761 18:69838795-69838817 TAGGGAAGGGATTAGGGAAGGGG - Intronic
1159894966 18:73987884-73987906 CAGGCAGGGGGCTAGGGAATGGG - Intergenic
1161004099 19:1925852-1925874 CAGGCGAGAGGCTGGGGAAGGGG - Exonic
1161436817 19:4268517-4268539 CAGGCCAGGGACAAGGCACGGGG - Intronic
1161596714 19:5154370-5154392 GAAGCTAGGGACCAGGGCAGGGG + Intergenic
1161621362 19:5299057-5299079 GAGGCTGGGGACCAGGGCAGAGG - Intronic
1161989582 19:7677069-7677091 CGGGCTGGGGACCATGGAAGTGG + Exonic
1162369847 19:10271890-10271912 CCAGCTAGGGAAGAGGGAAGGGG + Intronic
1162422321 19:10572892-10572914 CAGCCTATGGAATAAGGAAGAGG + Exonic
1162902095 19:13801184-13801206 CACTCTAGGGACAAGGGTAGAGG + Intronic
1164663442 19:30001482-30001504 GATGGTAGGGAATAGGGAAGTGG - Intronic
1165058417 19:33193733-33193755 GAGGCTGGGGACTTGGGAGGAGG - Intronic
1165066140 19:33229705-33229727 GAGGCTAGGGGCTGGGGAGGTGG - Intergenic
1165097721 19:33418746-33418768 CATGCTGGGGCCTGGGGAAGGGG - Intronic
1165172964 19:33906414-33906436 CAGGGGAGAGAATAGGGAAGAGG + Intergenic
1166592638 19:44014566-44014588 CAGGCAGGGGGCTAGGGAATGGG + Intergenic
1166755299 19:45187132-45187154 CAGGATAGGGACTGGGGCAGGGG + Intronic
1166763885 19:45241134-45241156 GAGGCTGGGGACCAGGGAGGAGG - Intronic
1167427585 19:49437337-49437359 CAGCCTAGGGGGTAGGGAGGGGG + Intronic
927208400 2:20624228-20624250 CGGGATAGGGACTAGGGACAGGG + Intronic
931006012 2:57850479-57850501 CAGGCTGGCGTCTAGGGCAGGGG + Intergenic
932568889 2:72926717-72926739 AAGGGAAGGGACTAGGGATGGGG - Intronic
932886587 2:75554429-75554451 CAGGCTGGGGAGAAGGAAAGGGG + Intronic
932886916 2:75556905-75556927 CAGGCCAGGGACCAGCCAAGGGG + Intronic
934679273 2:96271036-96271058 CAGGCCAGGAACTATGGAACAGG + Intronic
935606877 2:104980485-104980507 TAGGCTGGGGAAAAGGGAAGGGG - Intergenic
935928984 2:108102781-108102803 CAGGCTACTGACTTGGGATGTGG + Intergenic
936126089 2:109790007-109790029 CAAGATGGGGAGTAGGGAAGTGG + Intergenic
936218604 2:110581461-110581483 CAAGATGGGGAGTAGGGAAGTGG - Intergenic
936918016 2:117659914-117659936 GACGAGAGGGACTAGGGAAGAGG + Intergenic
939320595 2:140615323-140615345 CAGTCAGGGGACTAGGGAATGGG - Intronic
940883145 2:158967750-158967772 CAGGATAGGGACTAGGGATTCGG - Intergenic
941157895 2:162001324-162001346 CTGGCTAGGGAGCAGAGAAGGGG + Intronic
944453945 2:199874274-199874296 CAGGCAGGGGGCTAGGGAATGGG - Intergenic
945804930 2:214478833-214478855 CAGCCTAGGGACTAGGGACAGGG - Intronic
946006097 2:216526207-216526229 CAGGCTAGGCACTGAGCAAGTGG + Intronic
946365970 2:219249285-219249307 CAGCCTAGGGGCGAGGGGAGTGG + Exonic
946374859 2:219301970-219301992 TATGCCAGGCACTAGGGAAGTGG - Intronic
946760160 2:222985533-222985555 AAGGCAGGGGACTAGGGAATGGG + Intergenic
946765588 2:223037121-223037143 GAGGGTAGGGGCTTGGGAAGTGG + Intergenic
948429117 2:237908092-237908114 CAGGGTTGGGACTAGGGCACTGG + Intronic
948440254 2:237982398-237982420 CAGTCTAGTGACAAGGGAAGAGG - Intronic
948674119 2:239587233-239587255 CAGGACAGGCACTTGGGAAGTGG + Intergenic
948711273 2:239827249-239827271 CAGGCCAAGGACTGGGGCAGGGG - Intergenic
1168890674 20:1293782-1293804 CAGGCCAGGGAGGAAGGAAGAGG + Intronic
1169197025 20:3688833-3688855 CAGGCTTGGGAGTGGGGAAGAGG + Intronic
1170129166 20:13000397-13000419 CAGGCTAGGAACCAGGGATCAGG - Intergenic
1171238755 20:23548362-23548384 CAGGCTCTGGATTAGGGGAGGGG + Intergenic
1171242850 20:23585876-23585898 CAGGCTCTGGATTAGGGGAGGGG - Intergenic
1171256658 20:23693687-23693709 AGGGCTGGGGACTAGGGATGAGG - Intergenic
1171378131 20:24709189-24709211 CAGGCCAGGGAGTGGGGTAGAGG - Intergenic
1172123332 20:32611124-32611146 CTGGATAGGGCCTGGGGAAGAGG + Intergenic
1172631132 20:36378925-36378947 CGTGCCAGGGACTGGGGAAGTGG + Intronic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1172793314 20:37520931-37520953 CAGGCCAGGGACTGGGGAGAAGG + Intronic
1173222198 20:41139364-41139386 CAGCATAGGGAGTAAGGAAGGGG - Intronic
1173669273 20:44786424-44786446 CAGGATAGGGACTAGCAGAGAGG - Intronic
1174569145 20:51488773-51488795 CAGGATAGGGACAAGGGACAAGG - Intronic
1174690000 20:52494641-52494663 CGGGCTAGGTACCAGGCAAGGGG + Intergenic
1174897995 20:54471035-54471057 CAGGGCTGGGACTAGGGTAGTGG - Intergenic
1174924759 20:54746990-54747012 CAGGCACGGGGCTAGGGAATGGG + Intergenic
1175284339 20:57827833-57827855 CAGGCTGGGGGATGGGGAAGGGG + Intergenic
1175639833 20:60619657-60619679 CAGGGGAGGGAGCAGGGAAGTGG + Intergenic
1175912127 20:62410045-62410067 CAGGCCAGGGACTAGTGAGGAGG + Intergenic
1178132646 21:29590787-29590809 CTAGCAAGAGACTAGGGAAGTGG - Intronic
1178584138 21:33858798-33858820 CAGGCTGGGGATTAGAGGAGAGG - Intronic
1178858040 21:36266524-36266546 CAGGCAAGGTACGTGGGAAGGGG + Intronic
1178992303 21:37366475-37366497 GAGGGTAGGGGCTGGGGAAGGGG - Intronic
1179823432 21:43950747-43950769 CGGGCTGGGGAACAGGGAAGAGG - Intronic
1181035598 22:20168456-20168478 CAAGCTGGGGCTTAGGGAAGTGG - Intergenic
1181162388 22:20966284-20966306 CAGCCTAGTGCCCAGGGAAGGGG + Intronic
1181236172 22:21448810-21448832 CAGGCTAGGGACCTGGGGGGAGG + Exonic
1181319111 22:21991049-21991071 CAGGCTTTCGACTGGGGAAGGGG + Intergenic
1181467752 22:23119244-23119266 CAGGCTGGGCACTAGGTCAGAGG + Intronic
1181496576 22:23290606-23290628 CAGGCTAGGGGAGAGGGCAGAGG - Intronic
1182823286 22:33238011-33238033 CAGGATGGGGACGAGGAAAGGGG + Intronic
1184129362 22:42508649-42508671 CAGCCTATGGACTGGGAAAGGGG + Intergenic
1184139561 22:42570742-42570764 CAGCCTATGGACTGGGAAAGGGG + Intronic
1184310672 22:43639725-43639747 AAAGACAGGGACTAGGGAAGAGG - Intronic
1185013805 22:48331974-48331996 GAGGCTGGGGACAAGGGAGGAGG - Intergenic
950991484 3:17442890-17442912 GAAGCGAGGGACAAGGGAAGTGG + Intronic
951738742 3:25896744-25896766 CAGGGTAGGGATAAAGGAAGAGG + Intergenic
951785905 3:26418893-26418915 CAGGCTAGGAACTGAGGAAAAGG - Intergenic
952169858 3:30794992-30795014 GACCCTAGGGCCTAGGGAAGTGG + Intronic
952582281 3:34848601-34848623 CAGGGTAGGGAGGAAGGAAGAGG - Intergenic
952909200 3:38167296-38167318 GAGGCTGGGGACTGGGGATGAGG + Intronic
953672583 3:44975659-44975681 CATCCTAGGGACTAGAGAAATGG + Intronic
954200956 3:49022761-49022783 CCGGATAGGTACTGGGGAAGGGG + Exonic
954574932 3:51670890-51670912 CAGGCTGGGGACCAGGGAGCTGG - Intronic
956259471 3:67322837-67322859 CAGCCAAAGGACTAGGAAAGGGG - Intergenic
958026874 3:88059205-88059227 CCGGCTAGGGAGGAGGGAAGGGG + Intronic
960357189 3:116668035-116668057 CAGGGTAAGGAATAAGGAAGAGG - Intronic
960457263 3:117887743-117887765 CAGTCTAAGGACTAAGAAAGCGG - Intergenic
961635004 3:128327792-128327814 CAGGCTCTGTACTAGGGAAGTGG + Intronic
962754852 3:138459293-138459315 CAGGGTGGGGATCAGGGAAGGGG + Intronic
962969511 3:140385822-140385844 CAAGCTGGGGTCTAGGGCAGGGG + Intronic
963111941 3:141695346-141695368 CAGTCTGGGGAGGAGGGAAGAGG + Intergenic
963456756 3:145555225-145555247 CAGGCTGGGGAGGAGGGGAGAGG + Intergenic
964941054 3:162158231-162158253 CAGCCTAGGGAGGAGGGGAGAGG + Intergenic
967108064 3:186269816-186269838 CAGGCTAGGCACTTGGAAACAGG + Intronic
968266142 3:197364896-197364918 CAAGCTAGGGATGAGGGTAGAGG + Intergenic
969141438 4:5077638-5077660 TAGGCTAGGAAATAGGTAAGAGG - Intronic
969828000 4:9773266-9773288 CAGGGCAGGGAATAGGGTAGAGG - Intronic
970058565 4:12003158-12003180 CAGTCTAGGAACTAGGAAACAGG + Intergenic
971811374 4:31432414-31432436 CAGGGAAGGGAATAGGGAACAGG + Intergenic
974724605 4:65782556-65782578 CAGACAAGGGGCTAGGGAATAGG - Intergenic
975863616 4:78703391-78703413 CAGGCAAGTGGCTAGGGAATTGG + Intergenic
977446530 4:97138680-97138702 CAGCCTGGGGAGGAGGGAAGAGG + Intergenic
977776357 4:100924563-100924585 CAGGACAGGGATTGGGGAAGAGG + Intergenic
978863276 4:113476965-113476987 CAGGCAGGGGGCTAGGGAAAGGG - Intronic
979593451 4:122506478-122506500 CGGGCTATGGACTTGGGAAGTGG + Intergenic
980110408 4:128630816-128630838 AAGGCTAGGGGCAAGGAAAGAGG + Intergenic
981843204 4:149136211-149136233 CTGGATAGGGAACAGGGAAGAGG - Intergenic
983468445 4:168124982-168125004 GAGGCTAGGAACGAGGGAATGGG + Intronic
983865283 4:172759174-172759196 TAGGCTAGGGGCTTGGTAAGTGG - Intronic
984247964 4:177298069-177298091 TAGGCAAGGGGCTAGGGAATGGG - Intergenic
984966533 4:185144707-185144729 CAGGGTAGAGAGAAGGGAAGAGG - Intronic
985237545 4:187892558-187892580 CAGGCCAGGGTCTGCGGAAGAGG - Intergenic
986794024 5:11191727-11191749 CTGGCCAGGACCTAGGGAAGTGG - Intronic
987859549 5:23466913-23466935 CAGACAAGGGGCTAGGGAATGGG - Intergenic
990307292 5:54505801-54505823 CTGGGTAGGGGCTAGGGAATGGG + Intergenic
992175585 5:74146194-74146216 CAGCCCAGGGACAAGGGCAGGGG + Intergenic
992326624 5:75666269-75666291 CAGGCTGGGGCTTGGGGAAGAGG - Intronic
993196757 5:84758344-84758366 CAGGATAGGGACTAGGTGGGAGG + Intergenic
997456962 5:134024878-134024900 CTGGCTAGGGGGTAGGGGAGTGG - Intergenic
997948904 5:138226313-138226335 CAGGCAGGGGGCTAGGGAATGGG - Intergenic
998378133 5:141704841-141704863 CAGGGTAGAGTCTATGGAAGTGG - Intergenic
998416059 5:141946683-141946705 CAGGAGAGGGACTGGGGTAGTGG + Intronic
999180267 5:149665229-149665251 CAGGCTTGGTCCTTGGGAAGGGG - Intergenic
999765969 5:154741066-154741088 CAGTCCAGGGACTGGGGAAGAGG + Intronic
999937346 5:156501604-156501626 GAGGCTAGGGGCAGGGGAAGGGG - Intronic
999968846 5:156838790-156838812 CACGCTTGGGAAGAGGGAAGAGG + Intergenic
1000023818 5:157341680-157341702 TAGGCAAGGGAATAGGGATGTGG + Exonic
1000353963 5:160375427-160375449 CAGGCTGGGGGCTGGGGTAGAGG - Intergenic
1001312330 5:170620162-170620184 CTCTCTAGGGACAAGGGAAGTGG - Intronic
1001909291 5:175501992-175502014 GTGGCTAGGGGCTTGGGAAGTGG + Intronic
1002375174 5:178783673-178783695 CAGGCACGGGGCTAGGGAGGGGG - Intergenic
1003098913 6:3162672-3162694 CAGCCTCGGGATTAGGGGAGAGG - Intergenic
1003693047 6:8373792-8373814 CAGGCAGGGGGCTAGGGAATAGG + Intergenic
1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG + Intergenic
1005351634 6:24941620-24941642 AAGGCCAGGGACTAGGGACTGGG - Intronic
1005825876 6:29631702-29631724 CAGGCTGGGGACAGAGGAAGAGG + Intronic
1006604175 6:35244293-35244315 CAAGCTTGGGACTAGTGGAGGGG - Intronic
1007066001 6:38991019-38991041 TAGGCCAGGGACTAGGAGAGAGG - Intronic
1007766613 6:44164327-44164349 CAGGATAGGGAGTAGGGGAGGGG + Intronic
1007777055 6:44229803-44229825 CAGGCTGGGGGCTGGGGAGGGGG - Intronic
1008626853 6:53325616-53325638 CAGGCTTGGGACAAAGGGAGAGG + Intronic
1012057590 6:94433211-94433233 CAGGCAGGGGACTAGGGGAGGGG + Intergenic
1012248403 6:96952977-96952999 CAGGCAGGGGACCAGGGAATGGG - Intronic
1012772403 6:103455562-103455584 GAGGCTAGGGAGCAGGGAGGTGG + Intergenic
1012788205 6:103658590-103658612 CAGCCTAGGGACTAGGTGACTGG - Intergenic
1013478867 6:110535094-110535116 CAGGCAGGGGGCTAGGGAATGGG - Intergenic
1014251222 6:119117317-119117339 TAGGCTAGGAAACAGGGAAGAGG + Intronic
1015174984 6:130296658-130296680 CTGTATAGGGACTAGGGATGGGG - Intronic
1016778568 6:147933488-147933510 CAGGCTAGGGAATAGGGAAGTGG + Intergenic
1017156796 6:151329737-151329759 CAGACTAGGCACTCAGGAAGTGG - Intronic
1017810312 6:157979655-157979677 GAGGGTAGGGAATTGGGAAGGGG - Intergenic
1017984714 6:159433841-159433863 AAGGCAGGGGACTAGGGAATGGG + Intergenic
1019661350 7:2225696-2225718 CAGGCTGGGGAACAGGGGAGGGG + Intronic
1019714348 7:2531453-2531475 CAGGCTGGGGACGAGGGCAGTGG + Intergenic
1019725986 7:2602988-2603010 AAGGCTGAGGACTAGGGCAGTGG - Intronic
1019741975 7:2679619-2679641 CAGGCTGGGGACGAGGGCAGTGG - Exonic
1019773441 7:2897909-2897931 CTGAATAGGGACTTGGGAAGAGG + Intergenic
1020450914 7:8319643-8319665 TAGGCAGGGGACTAGGGAATGGG + Intergenic
1021570996 7:22065176-22065198 CAGGATAGGGAATGGGGGAGAGG + Intergenic
1022261645 7:28711191-28711213 CAGGAGAGGGGCTAGGGAAGAGG + Intronic
1023661789 7:42477984-42478006 CAAGCTAGGGAATCTGGAAGTGG + Intergenic
1023817085 7:43959438-43959460 CAGGCAGGGGGCTAGGGAATGGG - Intergenic
1024156487 7:46630463-46630485 CAGGAGGGGGACTAGGGGAGTGG - Intergenic
1024698258 7:51878908-51878930 CAGGCAAGGCAGTGGGGAAGTGG - Intergenic
1024824000 7:53367639-53367661 CAGGCTGGGGACTTGGGTAAAGG + Intergenic
1025627155 7:63232860-63232882 AAGGCTATGCACAAGGGAAGCGG - Intergenic
1025850384 7:65239304-65239326 CAGGCTTGAGAGTAGGGTAGGGG + Intergenic
1026451126 7:70530619-70530641 CAGGCTGGGGGCTGGGGAAGAGG - Intronic
1028159809 7:87473336-87473358 CAGGTTTGGGAGTAGGGATGTGG - Intronic
1028653067 7:93171943-93171965 CAGGCAGGGGACTAGGGAATGGG + Intergenic
1029489568 7:100863008-100863030 GATGCTAGGGACTAGTGATGGGG + Intronic
1029529226 7:101114425-101114447 CAGGCTAGGGGCTAAGACAGGGG - Intergenic
1030472457 7:109982275-109982297 CAGGCAGGGGACTAGGGAATGGG - Intergenic
1032007107 7:128311394-128311416 AAGGAAAGAGACTAGGGAAGGGG + Intronic
1033049688 7:137992911-137992933 CAGGGTAGAGACTAAGGAAATGG + Intronic
1033194101 7:139312158-139312180 CAGAGTGGGGACTAAGGAAGAGG - Intergenic
1033704966 7:143877443-143877465 CAGGCTAGGTAAGAGGAAAGTGG + Intronic
1035215768 7:157365480-157365502 CATGCCAGGGCCTAGGCAAGTGG - Intronic
1036807713 8:11846930-11846952 CAGGTGAGGGGCTGGGGAAGAGG - Intronic
1043853526 8:85240502-85240524 CAGGCAGGGGGCTAGGGAATGGG - Intronic
1046194290 8:110838661-110838683 GTAGCTAGGGACTAGGGAAGGGG + Intergenic
1047326670 8:123845151-123845173 CAGGATAGGTACAAGGGAAATGG + Intergenic
1048626245 8:136188593-136188615 CAGGCTAGAGAATAGGAATGGGG - Intergenic
1049426643 8:142540805-142540827 TTGGGTAGGGACGAGGGAAGGGG + Intronic
1050163277 9:2739809-2739831 CAGGCAAGGGTCCAGGGAATGGG + Intronic
1050233040 9:3548805-3548827 CAGGCTAGGGAGTATGCAGGAGG + Intergenic
1051033531 9:12714160-12714182 CACGGCAGGGACTAGGTAAGAGG - Intergenic
1052827245 9:33186166-33186188 CAGGCTGGGGACCTGGGGAGTGG - Intergenic
1053221338 9:36315765-36315787 CAGCCTTCGGCCTAGGGAAGGGG - Intergenic
1053479048 9:38402553-38402575 CTGGGAAGGGAATAGGGAAGTGG + Intergenic
1055686412 9:78779765-78779787 CAAGCTAGGGCTTAGGAAAGAGG - Intergenic
1056047376 9:82733122-82733144 CAGGCTGGGGTCAAAGGAAGGGG - Intergenic
1056331175 9:85522592-85522614 CAGGCTGTTGAGTAGGGAAGTGG + Intergenic
1056603074 9:88061635-88061657 CAGTTTAAGGAGTAGGGAAGGGG - Intergenic
1057939103 9:99265146-99265168 CAGGCTAGAGACCAGGGAAATGG - Intergenic
1057973213 9:99576945-99576967 CAGGCAAGAGACTATGGATGAGG + Intergenic
1059664020 9:116428655-116428677 AAGCCTAGGAACTAGGGCAGTGG + Intronic
1059715237 9:116907240-116907262 CAGGCCAGGGAAAAGGGAACGGG - Intronic
1060937083 9:127522062-127522084 CAGGCCAGGGGCTGGGGAGGCGG + Intronic
1061910082 9:133717700-133717722 GAGGCTTGTGAGTAGGGAAGGGG - Intronic
1062511216 9:136907232-136907254 CAGACTGCAGACTAGGGAAGCGG - Intronic
1062591629 9:137277183-137277205 CAGGCTGGGGACGGAGGAAGGGG + Intergenic
1186056755 X:5657329-5657351 CAGGAAAGGGACTGGGGGAGGGG + Intergenic
1192032834 X:67533190-67533212 CAGGCTCTGGGCTAGGGCAGTGG + Intergenic
1194648008 X:96482158-96482180 GCGGCTAGGGGCTAGGAAAGTGG - Intergenic
1195095138 X:101494178-101494200 TAGGCTTGGGGCTGGGGAAGAGG + Exonic
1197074781 X:122341227-122341249 CAGCCTAGGGCCTAGGGACTTGG - Intergenic
1197128240 X:122972830-122972852 CAGGCTAGGGACTTGGTGCGGGG + Intergenic
1197856019 X:130914928-130914950 CATGCTAGGGAATAGTGAAGTGG + Intergenic
1198024343 X:132690524-132690546 CAGGCTAAGGAGAAAGGAAGAGG - Intronic
1198089885 X:133318140-133318162 CAAGCTATGGAGTGGGGAAGGGG - Intronic
1199190408 X:144963585-144963607 CAGCCTAGAGACTAGGGGTGTGG - Intergenic
1199555993 X:149109353-149109375 TAGGCAAGGGGCTAGGGAATGGG - Intergenic
1199979134 X:152911495-152911517 CAGGCCAGGGACCAGGGAGGAGG + Intergenic
1200812712 Y:7502010-7502032 CAGCCCAGGGACAAGGGGAGAGG - Intergenic