ID: 1145962785

View in Genome Browser
Species Human (GRCh38)
Location 17:28897279-28897301
Sequence GAGGAGAAGCAAATAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 448}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145962782_1145962785 -7 Left 1145962782 17:28897263-28897285 CCCGCCTAGGGAGGGGGAGGAGA 0: 1
1: 0
2: 6
3: 41
4: 406
Right 1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG 0: 1
1: 0
2: 3
3: 24
4: 448
1145962769_1145962785 21 Left 1145962769 17:28897235-28897257 CCAACCTCACAGTAGAGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG 0: 1
1: 0
2: 3
3: 24
4: 448
1145962767_1145962785 23 Left 1145962767 17:28897233-28897255 CCCCAACCTCACAGTAGAGCGGC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG 0: 1
1: 0
2: 3
3: 24
4: 448
1145962773_1145962785 17 Left 1145962773 17:28897239-28897261 CCTCACAGTAGAGCGGCGGGGAG 0: 1
1: 0
2: 1
3: 1
4: 87
Right 1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG 0: 1
1: 0
2: 3
3: 24
4: 448
1145962783_1145962785 -8 Left 1145962783 17:28897264-28897286 CCGCCTAGGGAGGGGGAGGAGAA 0: 1
1: 0
2: 4
3: 31
4: 309
Right 1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG 0: 1
1: 0
2: 3
3: 24
4: 448
1145962765_1145962785 24 Left 1145962765 17:28897232-28897254 CCCCCAACCTCACAGTAGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG 0: 1
1: 0
2: 3
3: 24
4: 448
1145962768_1145962785 22 Left 1145962768 17:28897234-28897256 CCCAACCTCACAGTAGAGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG 0: 1
1: 0
2: 3
3: 24
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145962785 Original CRISPR GAGGAGAAGCAAATAAACAC AGG Intronic
901403056 1:9027460-9027482 GAGGAGCAGCAAACAAACACTGG - Intergenic
902288548 1:15422183-15422205 CAGGAGAATCACTTAAACACAGG - Intronic
905753167 1:40484162-40484184 AAAGAGAAACAAATAAACAAAGG - Intronic
907857025 1:58313555-58313577 CTGGAGAGGCAAAGAAACACTGG - Intronic
908037493 1:60072093-60072115 GAGGAGTATCAAATACAAACAGG + Intronic
908089307 1:60669707-60669729 GAGAAGAAGAAAATAAATCCAGG + Intergenic
908201439 1:61799734-61799756 CAGAAGAAGATAATAAACACTGG - Intronic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
909446905 1:75758153-75758175 GAGGAGAATCAATTGAACCCAGG - Intronic
910079896 1:83329126-83329148 GAAGAGAAAAAAATAAAGACAGG - Intergenic
910226727 1:84943478-84943500 GAGGAGAAGCAAACAGAACCAGG + Intronic
910573777 1:88736025-88736047 GAGGAGAAACAATTAAAAAAAGG - Intronic
911634723 1:100221700-100221722 AAGAAAAAGCAAACAAACACTGG + Intronic
911758602 1:101589921-101589943 GAGGAGAAAAAAATGAAAACTGG - Intergenic
911831404 1:102554684-102554706 GAGGAGAAGCAGCTAGACATCGG + Intergenic
912571765 1:110629836-110629858 GAGGAGACCGAATTAAACACAGG + Intronic
915188053 1:154124092-154124114 CAGGAGAATCACATGAACACAGG + Intronic
915243096 1:154537744-154537766 GAGGAGAAACAAAAATACAAAGG - Intronic
916909429 1:169329948-169329970 GTAAAGAAGCAAATAAACAATGG + Intronic
917876029 1:179287882-179287904 GGGGAGAAGAAAAGAAACAATGG - Intergenic
917947154 1:179986184-179986206 GAGGAGCAGCAAATCAAAAGAGG + Exonic
918246255 1:182662218-182662240 GAGGAGAAGCTTTTTAACACAGG + Intronic
919219002 1:194601048-194601070 AAGGAGAAGAGAATAAACGCTGG + Intergenic
919863985 1:201765193-201765215 GAGTTAAAGCAAATAAACACAGG - Intronic
920870714 1:209792089-209792111 GGGAAGAAGTAAAGAAACACTGG - Intronic
920903055 1:210131845-210131867 CAGGAGGAGAAAATAAACACAGG - Intronic
923370188 1:233302618-233302640 AAGGAGAAGCAAAAAAATGCAGG - Intergenic
923972657 1:239222264-239222286 GAGGAGACTCAAATGAAAACCGG - Intergenic
924472983 1:244359628-244359650 CAGGAGAATCACTTAAACACAGG + Intronic
924811232 1:247404290-247404312 CAGGAGAAGCACTTGAACACAGG - Intergenic
1063860020 10:10296655-10296677 GATCCTAAGCAAATAAACACAGG - Intergenic
1064579286 10:16777821-16777843 AAGGAAAAGCAAAGAAACACAGG + Intronic
1065909268 10:30287245-30287267 GAGGAGAAGCAGCTGGACACTGG - Intergenic
1066272519 10:33837420-33837442 GAGAAGAAGCAACTGAACATTGG + Intergenic
1066348819 10:34617160-34617182 GAGGAGAATCACTTGAACACGGG + Intronic
1067548130 10:47211208-47211230 GAGGAGAAAGAAATAGACAGGGG - Intergenic
1067946909 10:50695433-50695455 GAGGAGAGGCAGATAAGCACTGG + Intergenic
1068118801 10:52763284-52763306 AAGGAGAAGAAATGAAACACAGG - Intergenic
1068241672 10:54309701-54309723 GAGGAGAATCACTTGAACACAGG + Intronic
1069300967 10:66906857-66906879 GAGTATAAGTAAATAAACTCTGG + Intronic
1069351778 10:67534993-67535015 AAGGAGAAGAAAATAAAAGCAGG + Intronic
1070882220 10:79860426-79860448 GAGGAGAGGCAGACAAGCACTGG + Intergenic
1070923363 10:80202951-80202973 GAGGAGAATCATTTAAACCCAGG + Intronic
1071648790 10:87376737-87376759 GAGGAGAGGCAGACAAGCACTGG + Intergenic
1071888688 10:89978774-89978796 GAGGAGGAGGAATTTAACACGGG + Intergenic
1072329064 10:94328094-94328116 GAGGAGAAGCAAAATGGCACAGG + Exonic
1072661214 10:97364622-97364644 CAGGAGAATCACATAAACTCAGG + Intronic
1073997015 10:109327073-109327095 TAGGAGAAGCATATATAGACAGG - Intergenic
1075643213 10:124080205-124080227 GAAGAGAAGAAAATCAACCCAGG + Intronic
1077080772 11:723824-723846 GAGGAGAGGCAAGGAAAGACGGG - Intronic
1077399010 11:2343873-2343895 GAGGATGAGCTAATACACACAGG + Intergenic
1077517709 11:3011891-3011913 AAGGAGAGGCAAATCAACCCTGG + Intronic
1077741264 11:4848535-4848557 TAGGAGAAGAAAATAAGCAGGGG + Exonic
1078098004 11:8312250-8312272 GATGAAAAGCAAATAGACATAGG - Intergenic
1078856007 11:15206861-15206883 GAGGAAAAGGAAACAGACACAGG - Intronic
1081461586 11:43277228-43277250 TAGGAGAAGGGAATAAACATTGG + Intergenic
1081501845 11:43674765-43674787 GAGGAGAAAGCAATCAACACCGG - Intronic
1082255485 11:50028731-50028753 AAGGAGAGGGAAATGAACACTGG + Intergenic
1084222567 11:67692979-67693001 GAGGAGAAGCAAAGAAGCTTTGG - Intergenic
1084676566 11:70638902-70638924 CAGGAGAAGCATTTGAACACGGG + Intronic
1085665427 11:78411177-78411199 AAGGAGAAGAAAATAAACGAAGG + Intronic
1085839414 11:79993935-79993957 GAGGAGAATCAAATAAGAATTGG + Intergenic
1085928633 11:81054260-81054282 CAGGAGAAGCACTTAAACCCAGG - Intergenic
1087317521 11:96621155-96621177 GAGGACAAGAAAATAAAGACAGG - Intergenic
1088232881 11:107690711-107690733 GAGAAGAAGCAACTACATACGGG + Intergenic
1088737067 11:112736685-112736707 CAGGAGAAGCAAATAAAGAATGG + Intergenic
1089445076 11:118545518-118545540 GAACAGAAGCAAACAAACTCCGG + Intronic
1089784680 11:120899463-120899485 GAGGAGAATCAAATAAAAAAGGG - Intronic
1090126225 11:124087776-124087798 GAGGTGAATAAAATGAACACGGG - Intergenic
1090199986 11:124847043-124847065 GAGGAGAATCACTTAAACCCAGG - Intergenic
1090558514 11:127903067-127903089 GAGGAGATACAAAAAAACACAGG + Intergenic
1092206319 12:6616196-6616218 GAGGAGAAGGAAGGAAACCCGGG + Intergenic
1092480891 12:8858165-8858187 GAGTAGAAGCAAAAGAGCACTGG + Intronic
1093089829 12:14908671-14908693 GAGGAGCAGGAAATGAAGACAGG + Intergenic
1094825349 12:34265110-34265132 TAAAACAAGCAAATAAACACGGG - Intergenic
1095666294 12:44803115-44803137 GATGAGTAACAAGTAAACACTGG + Intronic
1095722364 12:45414531-45414553 GAGGAGATGCAAATATTCATGGG - Intronic
1095820288 12:46471019-46471041 GAGGAGCTTCAAATAAGCACTGG - Intergenic
1097892107 12:64787642-64787664 GAAGAGAAGCAAGAAAATACAGG - Intronic
1099063888 12:77949479-77949501 GAGGAGAAGGAAAAAAATAGCGG - Intronic
1099668719 12:85662743-85662765 GATCATAAGCAAATTAACACAGG - Intergenic
1100231897 12:92617456-92617478 CAGGAGAATCACTTAAACACAGG + Intergenic
1101079894 12:101171870-101171892 GAGTAGCAGCAAAAGAACACGGG + Intronic
1101811632 12:108112729-108112751 GAAGAGAAGAAAGTCAACACAGG + Intergenic
1101844440 12:108351258-108351280 GATGAGAAGCCCATAATCACAGG + Intergenic
1102929560 12:116851844-116851866 GAGGAGAAAGACATAAAGACAGG - Intronic
1103019144 12:117519847-117519869 TTGGAGAAGCACATAAACACCGG + Intronic
1103926473 12:124426295-124426317 GAGGAGAAGCACAGAGACAAAGG + Intronic
1104063414 12:125286794-125286816 CAGGAGAAGCACTTAAACCCAGG - Intronic
1104334198 12:127877932-127877954 GAGGTTAAGCAAATAGGCACTGG - Intergenic
1104740880 12:131172824-131172846 AAGGAGAAGGAAGTAAGCACAGG + Intergenic
1105484694 13:20815952-20815974 CAGGAGAAGGAAAAAACCACAGG + Intronic
1106581088 13:31018925-31018947 GAGGAGTAGCATTTACACACTGG - Intergenic
1106729609 13:32526336-32526358 GAGGAGATTCAATTACACACTGG + Intronic
1106869578 13:34004271-34004293 GAGGAGAAGCAATGCATCACTGG - Intergenic
1106947118 13:34841256-34841278 TTGGAGAACCAAATGAACACAGG - Intergenic
1107013780 13:35693311-35693333 GAGGAGAACTGTATAAACACAGG - Intergenic
1107736973 13:43409140-43409162 GAGAATAAGGAAATAAACAAGGG + Intronic
1108960633 13:56223464-56223486 GAGATGAAGAAAATAAACAAAGG - Intergenic
1109860119 13:68187409-68187431 GAGGATACGCAAATAAAGAATGG + Intergenic
1109972648 13:69788983-69789005 CAGGAGAAAAAGATAAACACTGG + Intronic
1110212302 13:72987953-72987975 CAGGAGAATCACATAAACCCGGG - Intronic
1110314452 13:74089239-74089261 GTGGAGAATCAAAGACACACAGG + Intronic
1110602628 13:77393256-77393278 GAGGAAAAGAAAATAATCCCAGG - Intergenic
1112715887 13:102184333-102184355 GAGGAGGAGACAATAAAGACAGG + Intronic
1112966018 13:105195245-105195267 TAGGTGATGCATATAAACACTGG - Intergenic
1113191789 13:107757167-107757189 GATTTGCAGCAAATAAACACAGG + Intronic
1113403658 13:110018638-110018660 GAGGAGATGGAAATTATCACTGG - Intergenic
1113976726 13:114233012-114233034 GAGGAAAAGGAAATATACAGGGG + Intergenic
1114178511 14:20345046-20345068 GAGGAAAAGCTAATAAGGACAGG + Exonic
1114767597 14:25391660-25391682 CAGAAGAAGATAATAAACACTGG - Intergenic
1115782868 14:36789323-36789345 GGGGAGGAGAAAATAAAAACTGG + Intronic
1116035916 14:39626972-39626994 GAGGAGAAGCAACTGAGCATTGG + Intergenic
1116609171 14:47045170-47045192 GACCAGTTGCAAATAAACACAGG + Intronic
1117566675 14:57000676-57000698 GAAGAGAAGCAGATATGCACAGG - Intergenic
1117799834 14:59431827-59431849 AAGGAGAAGAAAATAAAGAGGGG + Intronic
1117923070 14:60745728-60745750 GAGGCAAAGAAAATAAACAGGGG - Intronic
1118568369 14:67167901-67167923 GTGAAGAAGCAAACAACCACTGG - Intronic
1118588630 14:67382239-67382261 TAGCAAAAGCAAATCAACACAGG - Intronic
1119198398 14:72734116-72734138 GAGGTGAACCAAATAAAGACAGG + Intronic
1119252558 14:73169230-73169252 GAGGAGAAGGAAGAAAACTCAGG - Intronic
1119677966 14:76570336-76570358 GAGGATAAATAAATAATCACTGG - Intergenic
1119728329 14:76935703-76935725 GAGAAGCAGCAAATAACCATGGG - Intergenic
1121037756 14:90720447-90720469 GAGTGGAAGCTGATAAACACTGG + Intronic
1121328305 14:93034461-93034483 GAGGAAAAGCACAGAAATACAGG - Intronic
1123143258 14:106104277-106104299 GGGGAAAAGCAAATAAACACGGG - Intergenic
1123159872 14:106267998-106268020 CAGGAAAAGCAAATAAAAAAGGG + Intergenic
1123891216 15:24781553-24781575 GAGAAGAAGAAAACAAACAAAGG - Intergenic
1124133743 15:27014809-27014831 GAAGATAAGCAAAGAAACAGAGG - Intronic
1125323543 15:38513530-38513552 GAGTAGAAGGAAATACAAACAGG - Intronic
1125635017 15:41180503-41180525 GACAAGAAGCCAAGAAACACTGG + Intergenic
1125867684 15:43068711-43068733 CAGGAGAATCACTTAAACACGGG - Intronic
1126388101 15:48114848-48114870 GAGAAGATCCAGATAAACACAGG + Intergenic
1126580422 15:50237672-50237694 GAGGTAAAGCAATTAAACCCAGG - Intergenic
1127206673 15:56727676-56727698 GAAGAGAAGAAAATTAACAGAGG + Intronic
1127231964 15:57006395-57006417 GAGGAGAATCAATTGAACCCAGG - Intronic
1129318074 15:74758140-74758162 CAGGAGAATCAAATGAACCCAGG + Intergenic
1130098399 15:80873221-80873243 AAGGAGAAGAAAATGAATACTGG + Intronic
1130232556 15:82108167-82108189 GAGGAGAATCACTTAAACCCGGG - Intergenic
1130419341 15:83727905-83727927 GAAAATAAGCAAAGAAACACTGG - Intronic
1131171238 15:90179718-90179740 GAGCAGAAGCAAGGAAAGACAGG + Intronic
1131341130 15:91602083-91602105 AGGGAGAAACAAATAAATACAGG - Intergenic
1131568123 15:93505112-93505134 GAGGTGAACCAAACAAACAATGG - Intergenic
1133614372 16:7462396-7462418 GAGGAGAATCACTTAAACCCAGG + Intronic
1133688196 16:8187248-8187270 GAGGAGAAGTAACGAAACAGAGG - Intergenic
1134250102 16:12568447-12568469 GATGAAAAGCAAATGACCACAGG - Intronic
1134807609 16:17139145-17139167 GAGGAGAAACAATCAATCACTGG + Intronic
1135096149 16:19566401-19566423 GAGGAGAATCACTTAAACCCAGG + Intronic
1136114153 16:28084046-28084068 GAGGAGCAGCAAAGAGACCCGGG + Intergenic
1137927820 16:52558051-52558073 CAGGAGAATCACTTAAACACAGG - Intergenic
1138019367 16:53463659-53463681 CAGGAGAAGCAATTGAACCCAGG - Intronic
1138295202 16:55879560-55879582 GAGGAAAACATAATAAACACTGG - Intronic
1138833809 16:60409066-60409088 GAGGAGAATCACTTAAACCCGGG - Intergenic
1138949954 16:61900240-61900262 AAGGTGAGACAAATAAACACAGG - Intronic
1140036231 16:71373238-71373260 GAAGAGCTGCAAATAAACAGTGG - Intronic
1140564588 16:76026908-76026930 GAGGAGAAGCAACTGGACATTGG + Intergenic
1140772949 16:78222901-78222923 GAGGAGATGCAAATAGGCTCAGG + Intronic
1141713065 16:85711221-85711243 GAGGAGAATCACTTAAACCCGGG + Intronic
1141732573 16:85832906-85832928 AAGGAGAAAAAAATAAAAACAGG - Intergenic
1144273946 17:13646825-13646847 GTGGGGAATCAAATAAACACAGG - Intergenic
1144818445 17:18053518-18053540 TAGGAGAATCACATAAACCCAGG + Intronic
1145083212 17:19913068-19913090 GAGGAGAATCACTTAAACCCAGG - Intronic
1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG + Intronic
1146813969 17:35927345-35927367 CAGGAGAATCAATTAAACCCGGG + Intronic
1147138760 17:38449978-38450000 GAGTAGAAGCAAGTAGGCACTGG - Intronic
1147550037 17:41435065-41435087 GAAGATAAGCAAATGAACATGGG - Intergenic
1147699883 17:42387356-42387378 GAGGAGAGGGAAACAAAGACAGG - Intronic
1147731180 17:42603575-42603597 GAGGGGAAGTAAATAAACCAAGG + Intronic
1148150486 17:45394121-45394143 GAGGAGCAGACAATAAATACCGG + Exonic
1149476216 17:56963115-56963137 CTGAAGAAGCACATAAACACAGG - Intergenic
1150009241 17:61489512-61489534 GAGGGGAGGAAAACAAACACGGG - Intergenic
1150489298 17:65563376-65563398 CAGGAGAATCATTTAAACACAGG + Intronic
1150577118 17:66440342-66440364 GAGAAGAAACAAATGAACATTGG - Intronic
1150601683 17:66656360-66656382 GAGGAGAAGCAAATTATTTCTGG + Intronic
1150908170 17:69360870-69360892 CAGGAGAAGCACTTAAACCCTGG + Intergenic
1151690297 17:75679965-75679987 GTGGAGAAAAAAATAAACAAGGG - Intronic
1151849319 17:76681020-76681042 GATGAGAAGCAAATCAGCAGTGG - Intronic
1151898148 17:76994245-76994267 GAGGAGAATCAGAGAAACAATGG + Intergenic
1152988156 18:338098-338120 GAGGAGGATGGAATAAACACAGG - Intronic
1153526780 18:6003505-6003527 GAAGATAAGTAAATAAACAGAGG + Intronic
1153625675 18:7020337-7020359 GAGGGGAAACAGATAAATACTGG + Intronic
1153767410 18:8387501-8387523 GAGGAAAAAAAAAAAAACACTGG + Intronic
1154250828 18:12743259-12743281 GACGAGAATCACTTAAACACAGG - Intergenic
1155250166 18:23946538-23946560 GAGGAGAAGCCAATAGATTCAGG - Intronic
1155284661 18:24275320-24275342 GAGCAGATGCAGATAAAAACTGG + Intronic
1155313049 18:24543759-24543781 GAGAAAAAGCAAATAAGCCCAGG + Intergenic
1155703984 18:28784349-28784371 CAGGAGAATCAATTAAACCCAGG + Intergenic
1155725633 18:29078699-29078721 AAGGAGATGCAAAGAGACACAGG + Intergenic
1156142911 18:34138456-34138478 GAGGAGAAAAAAATAAGGACTGG + Intronic
1156642439 18:39118670-39118692 GAGGAGAAATAAATTAGCACTGG + Intergenic
1156669729 18:39453663-39453685 GAGAAGAAACAAATAAGCAAAGG + Intergenic
1156877270 18:42029970-42029992 GAGGAGAAGAAAGTAAAGAGAGG + Intronic
1156988233 18:43374864-43374886 TAGGTGAAGCAAAGAAAAACAGG - Intergenic
1157041909 18:44049687-44049709 GAGGAAAAAAAAAAAAACACTGG - Intergenic
1158293632 18:55969900-55969922 GAAACTAAGCAAATAAACACAGG + Intergenic
1159490474 18:69127404-69127426 GTGAAGAAGCATATAAACCCAGG - Intergenic
1159968661 18:74621902-74621924 GAGGACTAGCACATAAACACTGG - Intronic
1159974585 18:74694694-74694716 GACGAGAAGAAGATAAACAAGGG - Intronic
1160293814 18:77619500-77619522 ATGCAGAAGAAAATAAACACTGG + Intergenic
1160363555 18:78305003-78305025 GAATAGAAGCAAATAATGACAGG - Intergenic
1161795555 19:6384413-6384435 GAGGAGAATCAATTGAACCCAGG + Intronic
1161830047 19:6596254-6596276 GAGGAGAATCACTTAAACCCGGG - Intronic
1163600553 19:18246832-18246854 GAGGAGAATCACTTAAACCCGGG + Intronic
1164948570 19:32316900-32316922 GCAGAGAAGCAAAAAAACTCAGG + Intergenic
1165578180 19:36839153-36839175 AAAGAGAAGCAAATGAAAACTGG - Intronic
1165660076 19:37570313-37570335 AAGGTGAAGAAAATAATCACAGG - Intronic
1166839564 19:45688489-45688511 GAGGAGGAGGAATTTAACACCGG - Exonic
1167151437 19:47712631-47712653 CAGGAGAATCACTTAAACACAGG - Intergenic
1167203511 19:48084430-48084452 GAGGAGAAGCTCTTAAACCCAGG - Intronic
1168202037 19:54822533-54822555 CAGGAGAAGCACTTAAACCCAGG + Intronic
1168269745 19:55243021-55243043 GAGGAGCTGCTAATGAACACAGG + Intronic
1168438335 19:56340631-56340653 AATGAGAAGCCAATAAAAACAGG - Intronic
1168491279 19:56812202-56812224 GAGGGGAAGCAAAGGAGCACAGG + Exonic
925590803 2:5507617-5507639 CTGGAAAAGCAAACAAACACAGG - Intergenic
926049248 2:9732965-9732987 CAAGAGAAGCAAATAAACAATGG + Intergenic
926785460 2:16513742-16513764 GATGAATAGTAAATAAACACAGG + Intergenic
927115182 2:19892599-19892621 GAGGAGATGCAAATGAACTCTGG - Intergenic
927381173 2:22480731-22480753 GAGGAGAAGCTTATAAGCTCTGG - Intergenic
928842670 2:35629703-35629725 CAGGAGAATCAATTAAACCCGGG - Intergenic
930214900 2:48684818-48684840 CAGGAGAATCACATAAACCCAGG - Intronic
930844537 2:55888135-55888157 GAGGAAGAGCAAAGAAACAAAGG + Intronic
930878542 2:56246388-56246410 AAGCATAAGCAAATAAAAACTGG - Intronic
931548751 2:63418846-63418868 GAAGAAAAGCACAGAAACACAGG + Intronic
932131672 2:69193133-69193155 GAGGAGAAGAAGAGACACACAGG - Intronic
932864497 2:75327462-75327484 GAGGAAAAGCAAAAGAAAACGGG - Intergenic
933317174 2:80728598-80728620 GAGGAAACTCAAATAAATACAGG + Intergenic
935833213 2:107022213-107022235 GAGGAAAACCAATCAAACACTGG + Intergenic
937181555 2:120000794-120000816 CAGGAGAATCACTTAAACACAGG - Intergenic
938206179 2:129425920-129425942 CAGGAGAAGCACTTGAACACAGG - Intergenic
939203613 2:139071407-139071429 GAGGAAAAAAAAATAGACACTGG - Intergenic
940289221 2:152061917-152061939 GAGGAGAATCACATGAACCCAGG + Intronic
941053227 2:160758901-160758923 TAGGAGAAGGAAATAAATAAAGG - Intergenic
941054422 2:160770618-160770640 TAGGAGAAGGAAATAAATAAAGG + Intergenic
941689056 2:168479699-168479721 CAGGAGAATCACTTAAACACAGG - Intronic
942367891 2:175248145-175248167 GAAGAGAATCAAAGAAACACAGG + Intergenic
942490331 2:176483526-176483548 GAGGAGAAGCACTTAAAAATAGG + Intergenic
942504991 2:176632652-176632674 GAGGGGAAGAAAATAAAAATAGG - Intergenic
942706985 2:178785376-178785398 GAGGAGAGACAAATCCACACAGG - Intronic
943269656 2:185782727-185782749 CAGGAGAAGAAAATATACCCGGG - Exonic
943723817 2:191232690-191232712 GAGGTGAAACAAAGAAAGACAGG - Intergenic
943735365 2:191348224-191348246 GAGGAGAGTAGAATAAACACTGG - Intronic
944546153 2:200800839-200800861 AAGGAAAAACAAACAAACACAGG + Intergenic
944671600 2:201998839-201998861 CAGGAGAATCACTTAAACACAGG + Intergenic
945800393 2:214421797-214421819 GAGGAGAAACAATTAAAAATAGG - Intronic
946608420 2:221431686-221431708 GAGGAGAATGAAAGCAACACTGG + Intronic
946649239 2:221872998-221873020 CAGGAGCAGCAGATAAATACTGG + Intergenic
947137955 2:226993943-226993965 GAGGGAAAGCAAGTAAACAGTGG - Intronic
1169525483 20:6420807-6420829 GAGGACAGGCAAACAACCACAGG - Intergenic
1169550011 20:6692879-6692901 GAGCAGAAGCAATGAAACAGGGG - Intergenic
1169878407 20:10322344-10322366 GATGAGCAGAAAATAAACATGGG + Intergenic
1169940833 20:10935271-10935293 GAGGAGAAGCAGAAAAAAGCTGG - Intergenic
1170013556 20:11755375-11755397 GAGGAGAGACCAATAAACAGAGG - Intergenic
1172000667 20:31773962-31773984 GAGGAGAATCACTTGAACACGGG - Intronic
1172550410 20:35794678-35794700 GAGTAGAGGGAAATAAACTCTGG - Intronic
1173943210 20:46929631-46929653 GAGCAGAGGCTCATAAACACTGG + Intronic
1174892067 20:54406100-54406122 GAGGAGAAGAAATAAATCACTGG + Intergenic
1175691834 20:61071073-61071095 GAGGATAAGAAAAAAAAAACAGG - Intergenic
1177206037 21:18013207-18013229 GAGGTGACCCCAATAAACACTGG - Intronic
1178303635 21:31472432-31472454 GAGGAGAATCGCTTAAACACAGG + Intronic
1178329591 21:31676291-31676313 GAGGAGAAGCAGGTAAAGAGTGG - Intronic
1179281679 21:39939192-39939214 GAGCAAAAGCAAACAAACAGTGG + Intergenic
1182910249 22:33978348-33978370 CAGGAGAATCACTTAAACACGGG - Intergenic
1183858612 22:40653136-40653158 GAGGAGAAGCACTTGAACCCGGG + Intergenic
1184467888 22:44679612-44679634 GAGGAGAAGCACTTGAACCCAGG + Exonic
1185174114 22:49310116-49310138 CAGGAGAATCACATAAACTCGGG + Intergenic
1203273866 22_KI270734v1_random:74720-74742 CAGGAGAAGGACATAAACCCGGG + Intergenic
949187595 3:1211430-1211452 GAGGAAAAGCAGCCAAACACTGG + Intronic
949716061 3:6932845-6932867 CAGGAGAATCAAATGAACCCAGG - Intronic
950694895 3:14691235-14691257 GAGATGAAGCACATCAACACAGG - Intronic
950978905 3:17280519-17280541 GAGGAGAAGCAGCTAGACATTGG + Intronic
952943422 3:38459893-38459915 GAGGAGTAGAAAATAAACATGGG - Intronic
953658417 3:44872241-44872263 GAGGTGAAGCAACTAAAACCCGG + Intronic
954518124 3:51198201-51198223 TTGGAGAAGCAAATAGACCCAGG + Intronic
955084342 3:55688230-55688252 GAGGAGGTGCAAATACATACTGG - Intronic
955160394 3:56459778-56459800 GAAGAGAAGAAAATAAATAAAGG - Intronic
955595720 3:60588415-60588437 GAAGAGAAGAAAATAAAGAGGGG + Intronic
956759850 3:72431007-72431029 GAGGAGAATCACTTAAACCCGGG + Intronic
957169832 3:76724174-76724196 ATGGAGAAGCAAATGAAGACAGG - Intronic
959361603 3:105401036-105401058 AAGGAAAAGCAAACAAACTCTGG + Intronic
959733774 3:109633891-109633913 CATGATAAGCAAATTAACACAGG - Intergenic
959929954 3:111969467-111969489 GGGGAGAGGCAGATAAACTCAGG - Intronic
960876275 3:122298154-122298176 GACGAGAAGCCAAGGAACACAGG + Intergenic
961624661 3:128253580-128253602 GAAAAGAAGAAAAGAAACACAGG - Intronic
964237930 3:154555909-154555931 GAGGAGAATCACTTAAACCCAGG - Intergenic
964475112 3:157091017-157091039 GATGTGAAGCAAATGAGCACCGG + Intergenic
964732049 3:159877905-159877927 GAGGAGAATGAAATCAAGACTGG + Intronic
965783482 3:172312680-172312702 GAGAAGCAGTAAAAAAACACAGG - Intronic
966485662 3:180466516-180466538 AGAGAGAACCAAATAAACACAGG + Intergenic
967538548 3:190636854-190636876 GAGGAGATAAAAATAAAGACAGG - Intronic
968670660 4:1849355-1849377 CAGGAGAATCAATTAAACCCAGG - Intronic
968776953 4:2548010-2548032 CAGGAATGGCAAATAAACACAGG - Intronic
971249101 4:24957328-24957350 GAGGAGAGTCAATGAAACACTGG - Intronic
972124676 4:35748406-35748428 AAGGAGAAGAAGAAAAACACAGG - Intergenic
972141686 4:35968317-35968339 CAGGAGAATCAACTGAACACAGG + Intronic
972207091 4:36786915-36786937 GAGGAGAAGAAAATTAAGCCAGG - Intergenic
972597597 4:40543703-40543725 CAGGAGAATCACATAAACCCAGG + Intronic
972725279 4:41742004-41742026 GAGGAAAAACAAATAGCCACAGG - Intergenic
972736186 4:41843946-41843968 GAGGAAAAATAAATAAACATGGG - Intergenic
974300175 4:60054117-60054139 GGAGAGAAGAAAATAAACAGAGG + Intergenic
974960130 4:68688447-68688469 GAGTGAAAGCAAGTAAACACTGG + Intergenic
975144432 4:70952343-70952365 GTGTAAAAGCAAATAAAAACAGG + Intronic
975742004 4:77438369-77438391 CAGGAGAAGCACTTGAACACGGG - Intergenic
975826049 4:78320463-78320485 ATGGAGAAGCAATTAAACAGAGG - Intronic
976349929 4:84049552-84049574 CAGGAGAATCACATGAACACGGG + Intergenic
977291132 4:95165577-95165599 GATAAGAAGAAAATAAAAACAGG + Exonic
977294527 4:95195771-95195793 GAGAAGAATGAAAGAAACACTGG - Intronic
978297025 4:107217334-107217356 GAAGTGAAGCAAATAAACCCAGG - Intronic
978471119 4:109068485-109068507 GAGGGAAAGCAAACAAACTCAGG + Intronic
978937847 4:114399701-114399723 GAGGAGAAGCAGCTGGACACTGG - Intergenic
979686595 4:123517231-123517253 GAGGAAAAGCAGGTAAACAGTGG - Intergenic
980113553 4:128657960-128657982 GAGGAAAAGCAAACAAAAAAAGG + Intergenic
980714768 4:136615064-136615086 GAGGAGAAGGAAAAAAAAACTGG - Intergenic
981487491 4:145302410-145302432 GTGGAGATGGAAATAAACACAGG - Intergenic
981625659 4:146751958-146751980 GAGAAGATGCAAATAAAAAATGG + Intronic
981951600 4:150415680-150415702 CAGAAGAACAAAATAAACACAGG + Intronic
982514062 4:156321956-156321978 GGGGAGAAGTAAACAAACAATGG - Intergenic
982812243 4:159840381-159840403 GAAGAGAAGCAAATACATATAGG + Intergenic
983997667 4:174205308-174205330 GAGGAGATGAAATTAAGCACAGG - Intergenic
984436486 4:179717045-179717067 AATGAGAAGAAAAGAAACACTGG - Intergenic
984484855 4:180355157-180355179 TATGAGGAGCAAAAAAACACAGG + Intergenic
984732172 4:183078315-183078337 GAGGAGAAAGAAACACACACAGG + Intergenic
986123524 5:4865543-4865565 GAAGAGAAAAAAATAACCACTGG + Intergenic
986253345 5:6081377-6081399 GAGGAGAAGGAAAGAGACAGGGG - Intergenic
986602491 5:9486819-9486841 GAGGAGAAGCAGATTATCATAGG - Intronic
986874147 5:12085451-12085473 GAGTAGGAGCAAATAAATACAGG + Intergenic
988702214 5:33686451-33686473 AAGAAGAAGTAAAGAAACACAGG - Intronic
988838101 5:35053558-35053580 CAGGAGAATCACTTAAACACGGG + Intronic
989467744 5:41776455-41776477 GATGAAAAACAAAAAAACACAGG - Intronic
990509423 5:56476964-56476986 GAGCAGAAGCAAAGCAAAACTGG - Intronic
991959691 5:72031940-72031962 CAGGAGAAGCACTTAAACCCAGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992557132 5:77915017-77915039 GAGGAGAAGGAAATAAGGAAGGG + Intergenic
993705642 5:91166763-91166785 CAGGAGAATCACATAAACCCAGG - Intergenic
994802086 5:104391393-104391415 GAGGAGGAGGAAAAAAAAACAGG - Intergenic
995491837 5:112701650-112701672 GAGGAGAAGGAAGTAAACACTGG + Intergenic
995842327 5:116454542-116454564 GAAGAGAAGAAAACAAACAAGGG + Intronic
996740250 5:126792233-126792255 CAGGAGAATCACTTAAACACAGG - Intronic
996916294 5:128715624-128715646 GAGGACCAGCAAGTAAATACTGG - Intronic
996920356 5:128761011-128761033 GAGGCCAAGCAAACTAACACAGG + Intronic
997605692 5:135174295-135174317 TGGGCGAAGCACATAAACACGGG - Intronic
997679128 5:135736911-135736933 GAGGAGAAGAGAATAAAAAGAGG + Intergenic
997831829 5:137157053-137157075 GGGGAGAAGGAAATAATAACAGG - Intronic
998397008 5:141825205-141825227 GAGGAGAAGCGAAGAGACTCAGG - Intergenic
999150662 5:149424065-149424087 GGGGAGGAGAAAATAAACAGTGG - Intergenic
999405371 5:151302541-151302563 GAGGAGAACAAGACAAACACTGG + Intronic
1001624234 5:173117285-173117307 GAGGAGAATCACTTAAACCCGGG + Intronic
1003081489 6:3025024-3025046 GGGGAGAGGGAAATAAGCACAGG + Intergenic
1003441927 6:6150880-6150902 GAGGAGAGGGAAATAAAGTCAGG + Intronic
1004101572 6:12617420-12617442 GAGAAGAAGGAGGTAAACACAGG + Intergenic
1006356517 6:33561996-33562018 GAGAAGAAGCAGAAACACACAGG - Intergenic
1006583569 6:35090628-35090650 GAGGAGAAGAAAAGAAAGAAAGG - Exonic
1006650623 6:35548440-35548462 CAGGAGAATCACATAAACCCAGG - Intergenic
1006886183 6:37384231-37384253 GAGGAGAATCACTTAAACCCGGG - Intronic
1007047608 6:38793244-38793266 TAGGAGAATCACATAAACCCAGG - Intronic
1007082506 6:39117818-39117840 TAGGAGAAGCAAGGAGACACAGG + Intergenic
1007696732 6:43738822-43738844 GAGCAGCAGCAGATAACCACGGG - Intergenic
1008883842 6:56410624-56410646 GAGAAGAATCTAATAAACAGAGG - Intergenic
1009679813 6:66877620-66877642 GAAGATAAGCAAATGAAGACTGG + Intergenic
1010361043 6:74994331-74994353 AAGGAAAAAGAAATAAACACAGG + Intergenic
1010454690 6:76041368-76041390 GAGGAGAAACAAATAAAGAGTGG - Intronic
1010949954 6:82023753-82023775 GAAGAGAAGCAAGCAAAAACAGG - Intergenic
1011579783 6:88848133-88848155 AAGGAAAAGCAAATTAAAACAGG + Intronic
1012985352 6:105869467-105869489 GAGGAGAAGAAAAGAATCAGGGG - Intergenic
1013772121 6:113639755-113639777 AAGCAAAAGCAAATTAACACTGG + Intergenic
1014492143 6:122075675-122075697 GAGGGGAAGAAAAAAAGCACTGG + Intergenic
1014777166 6:125524568-125524590 GAGGAGAAAAAAAAAAAAACAGG - Intergenic
1015055586 6:128899076-128899098 GAAGAAAAGTAAATAAACAAGGG - Intronic
1015127857 6:129774339-129774361 GAGGAAAAGCACATAAATACAGG + Intergenic
1015352932 6:132244435-132244457 CAGGAGAATCACTTAAACACAGG - Intergenic
1015687527 6:135881642-135881664 GAATAGAAGCTAATAAACCCAGG + Intronic
1016218613 6:141636102-141636124 GAGATGAAGCAAATAATCATTGG + Intergenic
1017062452 6:150497377-150497399 GAGGAGTAACAAAAATACACTGG - Intergenic
1018224029 6:161610660-161610682 CAGGAGGAGCAAATAAACCAGGG + Intronic
1018301167 6:162404275-162404297 CAGGAGAATCATTTAAACACAGG + Intronic
1018829459 6:167432136-167432158 GTGGAAAACTAAATAAACACTGG - Intergenic
1019888893 7:3929500-3929522 GGGGAAAAGAAAAGAAACACAGG - Intronic
1019952222 7:4382921-4382943 GAGGAGAAGCACCTAGACTCAGG - Intergenic
1021135725 7:16963023-16963045 GAGGAGAGGCATTTTAACACAGG + Intergenic
1021163324 7:17301975-17301997 AAAGAGAATAAAATAAACACAGG - Intronic
1022075639 7:26967047-26967069 CAGGAGAATCAATTGAACACAGG - Intronic
1022368044 7:29744484-29744506 GAGCAGAAAAAAATAACCACTGG + Intergenic
1024294027 7:47828539-47828561 GAGGTGAAGCAATTAGACCCAGG - Intronic
1026060950 7:67025548-67025570 GCAGAGAAGCAAATTTACACTGG - Intronic
1026717416 7:72801850-72801872 GCAGAGAAGCAAATTTACACTGG + Intronic
1027297659 7:76794405-76794427 GAAGAGAAAAAAATAAAGACAGG - Intergenic
1027333598 7:77125099-77125121 CAGGAGAATCACTTAAACACAGG + Intronic
1028430550 7:90742442-90742464 AAAGAGAACTAAATAAACACTGG - Intronic
1028985780 7:97007028-97007050 GAGGGGAAGCAAAGAACCTCGGG + Intronic
1029782194 7:102746234-102746256 CAGGAGAATCATTTAAACACAGG - Intergenic
1030869650 7:114739531-114739553 GAGAATAAGGAAATCAACACTGG - Intergenic
1030876600 7:114820594-114820616 GAGGAGAATCACTTAAACTCAGG + Intergenic
1031543062 7:123018884-123018906 GAGGGGAAGAAGATAACCACAGG - Intergenic
1032031626 7:128489020-128489042 GAGGAGAATCACTTAAACTCAGG + Intronic
1033094709 7:138420284-138420306 GAGGAGAATCGAATGAACCCAGG - Intergenic
1033112700 7:138596094-138596116 CAGGAGAAGCACTTAAACCCAGG + Intronic
1033160283 7:138990168-138990190 GAGGAGAGGCAAACAAAAAGGGG + Intergenic
1033430117 7:141281578-141281600 GTGGAGAAGCAAATGCACCCTGG + Intronic
1033684382 7:143625038-143625060 GAGGAGCTGAAAATACACACAGG + Intronic
1033687558 7:143704257-143704279 GAGGAGCTGAAAATACACACAGG + Intronic
1033700229 7:143832585-143832607 GAGGAGCTGAAAATACACACAGG - Intergenic
1033853798 7:145532054-145532076 GGAGAGAAGCAAATAAAGAATGG + Intergenic
1034098970 7:148435709-148435731 GAGGAAAAGCCAATAAGCAAAGG - Intergenic
1034722181 7:153303537-153303559 AAGAGGAAGCAAAGAAACACTGG + Intergenic
1036448752 8:8846372-8846394 AAGGAGAAGAAAATGACCACTGG + Intronic
1036973089 8:13376951-13376973 GAGGAGAAGGAAAAAAAATCTGG + Intronic
1037277796 8:17200203-17200225 GCAGAGAAGAAAAGAAACACAGG - Intronic
1037350089 8:17943748-17943770 GTAGAGAAAAAAATAAACACAGG - Intronic
1037491966 8:19404851-19404873 GAAGAGGAGCAACTGAACACTGG - Exonic
1037792257 8:21955819-21955841 CAGGAGAATCACATAAACCCAGG - Intronic
1038608569 8:29036460-29036482 GAGGAGAATTAAATAAACCCTGG - Intronic
1038979537 8:32742648-32742670 GAGAAGAAACAAAAAAACAATGG - Intronic
1039186126 8:34918243-34918265 GAGGAGAATCACTTAAACCCGGG + Intergenic
1039249016 8:35641201-35641223 GAGGAGATGAATATCAACACAGG - Intronic
1040429733 8:47327653-47327675 CAGGAGAATCACTTAAACACAGG - Intronic
1041052065 8:53944443-53944465 GAGGAGAATCACTTAAACCCGGG + Intronic
1041154317 8:54968979-54969001 GAGGAAAAGCAAAGAGACACTGG + Intergenic
1041322430 8:56627209-56627231 AAGGAACAGCAAATGAACACAGG - Intergenic
1041804098 8:61831360-61831382 GAGGATAAGCAAAAGAACAGGGG - Intergenic
1042844894 8:73159943-73159965 GAAGAGAAACAGATAAACCCTGG + Intergenic
1043171984 8:76977246-76977268 CAGGAGAATCACGTAAACACAGG - Intergenic
1043559492 8:81474417-81474439 GAAGACAAGTAAATAAACAGAGG - Intergenic
1044327819 8:90879982-90880004 TTTGAGAAGAAAATAAACACAGG - Intronic
1044474619 8:92611804-92611826 GGGGAAAAGCAAACAAAAACAGG + Intergenic
1045472725 8:102526825-102526847 GAAGAGCAATAAATAAACACAGG + Intergenic
1046724827 8:117663014-117663036 TTGGAGAAGCAAATAAAGGCAGG + Intergenic
1046853639 8:119004436-119004458 GAGGAGAGAAAAATAAACAATGG - Intronic
1047244090 8:123123087-123123109 GAGGAAAAAGAACTAAACACTGG + Intronic
1047407831 8:124599896-124599918 GAGGATAAGCAGAGAACCACAGG + Intronic
1047505261 8:125474583-125474605 GTAGAGAACCAAATAAAGACAGG - Intergenic
1047522044 8:125602434-125602456 GAGGAGAATCATTTAAACCCGGG - Intergenic
1047543027 8:125788804-125788826 GAACAGAAGAAAATAAATACAGG - Intergenic
1047757566 8:127930471-127930493 GTGGAGAATAAAATAAACCCGGG + Intergenic
1048003994 8:130403643-130403665 GAGGAGAATCAATTGAACCCAGG - Intronic
1050112037 9:2227258-2227280 TAGGAGAAACAAATGATCACTGG - Intergenic
1050330407 9:4540121-4540143 GAGGAGAAGCAGCTAGACATTGG + Intronic
1050687046 9:8183487-8183509 GAGAAGAAGCAAAGAGATACAGG + Intergenic
1050799505 9:9592500-9592522 TAGGAGAAGGTAATAAAAACAGG + Intronic
1052993001 9:34532805-34532827 CAGGAGAATCACTTAAACACAGG - Intergenic
1053299420 9:36938420-36938442 GAGGTGAAGGAAATAAAATCAGG - Intronic
1053393832 9:37754389-37754411 GAGGAACAGCAAATAGACCCCGG + Intronic
1055907540 9:81311485-81311507 GAGAAGCAGCATATAAATACAGG - Intergenic
1057025150 9:91729521-91729543 GAAGTGCAGGAAATAAACACTGG - Intronic
1057178329 9:93015361-93015383 CAGGAGAAGCTCTTAAACACGGG + Intronic
1057900261 9:98943206-98943228 TAGGAGATGCCAATAAACGCTGG - Intronic
1058332910 9:103786297-103786319 TTAGAGAAGCAAATAAAGACAGG - Intergenic
1058744187 9:107973944-107973966 GAAGAGAAGACAAAAAACACTGG - Intergenic
1059185785 9:112269307-112269329 GAGGAGAAAGAAAAAAACAGAGG + Intronic
1059588327 9:115630147-115630169 GAGGAGGAGCAGAGGAACACAGG + Intergenic
1059787654 9:117603634-117603656 GAGGAGAAGAAGATAACCAGAGG + Intergenic
1060046496 9:120345603-120345625 GAGGAGCAGCAAATATGCATGGG + Intergenic
1060694480 9:125695819-125695841 CAGGAGAAGCAATTGAACCCGGG - Intronic
1060865252 9:126990094-126990116 AAGGAGCAGCAAAGACACACAGG - Intronic
1061625788 9:131840006-131840028 CAAGAGAAGCAAACAAGCACAGG - Intergenic
1186139749 X:6559121-6559143 GAGGAAGAGCAATTAAACAATGG - Intergenic
1187516983 X:19981116-19981138 GAGGTTAAACAAATCAACACCGG + Intergenic
1187994440 X:24910221-24910243 CAGGAGAAGGAAATAAATAAAGG - Intronic
1189432967 X:40965691-40965713 ACAGAGAAGGAAATAAACACCGG + Intergenic
1190367965 X:49715370-49715392 GAGGAGAATCACATGAACCCAGG - Intergenic
1190373467 X:49765317-49765339 AAGGAGAAGCAGATAAAAAAGGG + Intergenic
1191057269 X:56254784-56254806 GAGGAGAAGCAGCTAAACGTTGG - Intronic
1192375394 X:70555128-70555150 CACAAGAAGCAAGTAAACACTGG - Intronic
1192838075 X:74824011-74824033 GAGGGGAAGCAATTAAACTTTGG - Intronic
1193207820 X:78769613-78769635 GAGGAGATGCAAATGAGCAGTGG + Intergenic
1193270227 X:79520514-79520536 GAGGAGAGCTAAATAAAAACAGG + Intergenic
1193332204 X:80247178-80247200 GAGGAGAAGGTAATAAAGGCAGG - Intergenic
1193907704 X:87262933-87262955 GAAGATATGCAAATAAAAACAGG + Intergenic
1194767190 X:97855403-97855425 CAGAAGAGACAAATAAACACAGG - Intergenic
1195776864 X:108415887-108415909 GAGGGTAACCAAATAAGCACAGG + Intronic
1196262102 X:113595172-113595194 GAGGATATGCAAATGGACACAGG - Intergenic
1198260161 X:134958706-134958728 GGGGAGAAGCAAATAAAGGGTGG - Intergenic
1198936812 X:141907631-141907653 GAGGAGGAGCAGATACTCACAGG - Exonic
1198967504 X:142243813-142243835 GAGGAGAGGGAAATGAGCACAGG + Intergenic
1200445172 Y:3253296-3253318 CAGGAGAATCACTTAAACACAGG - Intergenic
1200445185 Y:3253367-3253389 CAGGAGAATCACTTAAACACAGG - Intergenic
1201273500 Y:12278128-12278150 AAGGAGAATCAATTGAACACGGG + Intergenic
1201479347 Y:14422554-14422576 GAGGAGAATCAATTGAACCCAGG - Intergenic