ID: 1145963716

View in Genome Browser
Species Human (GRCh38)
Location 17:28902527-28902549
Sequence TCTGTGTCCCGGCGGGTTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145963706_1145963716 8 Left 1145963706 17:28902496-28902518 CCGGATCCTCCGCAGCCCCTTTG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963705_1145963716 9 Left 1145963705 17:28902495-28902517 CCCGGATCCTCCGCAGCCCCTTT 0: 1
1: 0
2: 0
3: 10
4: 224
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963704_1145963716 15 Left 1145963704 17:28902489-28902511 CCTGGACCCGGATCCTCCGCAGC 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963702_1145963716 19 Left 1145963702 17:28902485-28902507 CCTCCCTGGACCCGGATCCTCCG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963711_1145963716 -8 Left 1145963711 17:28902512-28902534 CCCTTTGCTGGCTTCTCTGTGTC 0: 1
1: 0
2: 2
3: 41
4: 480
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963700_1145963716 28 Left 1145963700 17:28902476-28902498 CCGCGCTCTCCTCCCTGGACCCG 0: 1
1: 0
2: 2
3: 24
4: 360
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963708_1145963716 2 Left 1145963708 17:28902502-28902524 CCTCCGCAGCCCCTTTGCTGGCT 0: 1
1: 0
2: 2
3: 23
4: 276
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963712_1145963716 -9 Left 1145963712 17:28902513-28902535 CCTTTGCTGGCTTCTCTGTGTCC 0: 1
1: 0
2: 1
3: 48
4: 560
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963709_1145963716 -1 Left 1145963709 17:28902505-28902527 CCGCAGCCCCTTTGCTGGCTTCT 0: 1
1: 0
2: 4
3: 58
4: 522
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963710_1145963716 -7 Left 1145963710 17:28902511-28902533 CCCCTTTGCTGGCTTCTCTGTGT 0: 1
1: 2
2: 4
3: 48
4: 449
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963703_1145963716 16 Left 1145963703 17:28902488-28902510 CCCTGGACCCGGATCCTCCGCAG 0: 1
1: 0
2: 2
3: 6
4: 94
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145963716 Original CRISPR TCTGTGTCCCGGCGGGTTCT CGG Intronic
901657889 1:10781095-10781117 TCTGTGTCCTGGGGGTTTGTTGG - Intronic
904000683 1:27336724-27336746 TCTGTACCCCGGCGGGTGGTGGG - Intergenic
905584313 1:39105243-39105265 TCCGGGTCCCGGCGAGTCCTCGG - Intronic
915542926 1:156580120-156580142 TCTGTCTGCTGGCTGGTTCTAGG - Intronic
916120164 1:161522509-161522531 TCTGTGCCCCGGCGTGTTAAGGG - Intronic
916129927 1:161604159-161604181 TCTGTGCCCCGGCGTGTTAAGGG - Intronic
921522452 1:216173377-216173399 TCTGTGTTCAGGCATGTTCTGGG - Intronic
1064278994 10:13933765-13933787 TCTGTGTCCCAGGGGCCTCTAGG - Intronic
1073445281 10:103576693-103576715 GCTGGGTCCGGGAGGGTTCTAGG + Intronic
1075655747 10:124160022-124160044 TCTGTGTCCAGCAGGCTTCTTGG - Intergenic
1076479077 10:130772546-130772568 CCTGTGGCCCTGCAGGTTCTTGG - Intergenic
1077156832 11:1095835-1095857 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077156853 11:1095904-1095926 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077156930 11:1096180-1096202 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077156988 11:1096387-1096409 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157011 11:1096456-1096478 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157047 11:1096594-1096616 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157096 11:1096771-1096793 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157117 11:1096840-1096862 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157135 11:1096909-1096931 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157154 11:1096978-1097000 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157175 11:1097047-1097069 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157192 11:1097116-1097138 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157214 11:1097185-1097207 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157235 11:1097254-1097276 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157254 11:1097323-1097345 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157273 11:1097392-1097414 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157315 11:1097530-1097552 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157335 11:1097599-1097621 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157354 11:1097668-1097690 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157376 11:1097737-1097759 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157397 11:1097806-1097828 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157416 11:1097875-1097897 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157435 11:1097944-1097966 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157458 11:1098013-1098035 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157477 11:1098082-1098104 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157498 11:1098151-1098173 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157537 11:1098295-1098317 TCTGTGTGCCGGTGGGTTTTGGG - Intergenic
1077157561 11:1098368-1098390 TCTGTGTGCCGGTGGGTTGTTGG - Intergenic
1077157581 11:1098437-1098459 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157600 11:1098506-1098528 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157642 11:1098644-1098666 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157663 11:1098713-1098735 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157680 11:1098782-1098804 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157702 11:1098851-1098873 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157723 11:1098920-1098942 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157742 11:1098989-1099011 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157761 11:1099058-1099080 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157803 11:1099196-1099218 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157842 11:1099334-1099356 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157861 11:1099403-1099425 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157883 11:1099472-1099494 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157935 11:1099679-1099701 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077365724 11:2160796-2160818 TCTGCCTCCCGGCGGGTCTTGGG + Exonic
1077641935 11:3889066-3889088 TCTGTATCCAGGAGTGTTCTTGG + Intronic
1078045441 11:7910072-7910094 TCTGTGTCCCATTGGGTTATTGG + Intergenic
1085637407 11:78169221-78169243 CCTGTGTCCCAGGGGGCTCTGGG - Intergenic
1096186435 12:49584724-49584746 TCTGTGTCCAGGCTGAGTCTGGG - Intronic
1103600795 12:122053378-122053400 TCTGTGTCCCGGCCTGTCCCAGG + Intronic
1105830115 13:24156815-24156837 TCTCTGTCCATGTGGGTTCTAGG - Intronic
1108519530 13:51233955-51233977 TCTGTGTCCAGCAGGGTCCTGGG + Intronic
1113636463 13:111922268-111922290 TCTGTGTCCCTGGGGGAGCTGGG - Intergenic
1117524059 14:56579855-56579877 TCCGTGTCGCACCGGGTTCTTGG + Exonic
1122228454 14:100293025-100293047 TCTCTGTCCCCGCAGGTGCTGGG - Exonic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1133032886 16:3020177-3020199 TCTGCGTCCCTGCGGGGTCCTGG + Intronic
1133498736 16:6345190-6345212 GCTGCGTCCAGGAGGGTTCTTGG + Intronic
1138179784 16:54933345-54933367 TCCGGGTCCCGGCGGGCCCTCGG + Exonic
1142333289 16:89469845-89469867 TCTGTCTCCGGGCGCGATCTTGG - Intronic
1143165364 17:4894752-4894774 TCTGTGCCCAGGCAGGTGCTAGG - Intronic
1144486315 17:15667918-15667940 ACAGTGTCCCGGCGGGATCCTGG - Intronic
1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG + Intronic
1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG + Intronic
1146054873 17:29576016-29576038 TCTGAGCCCCAGGGGGTTCTGGG - Intronic
1146278481 17:31530190-31530212 TGTGTGTCACGGCTGGTTCAAGG - Intronic
1148071792 17:44912794-44912816 TCTGTGTCCTGGGGGGTGCCTGG + Intronic
1150327291 17:64267427-64267449 TCTGTGTCCCCACGGCTCCTGGG - Intergenic
1153003848 18:480266-480288 CCTGTGTCCAGGCAGATTCTTGG + Intronic
1155219539 18:23671791-23671813 TCAGTGTCCCAGGGGGATCTGGG + Intergenic
926133005 2:10317076-10317098 TGTGTGTCCCTGCGGTTTCCTGG + Intronic
928348236 2:30520165-30520187 TCTCTGACCTGGGGGGTTCTTGG - Intronic
931241162 2:60453569-60453591 GCTGCGTCCAGGTGGGTTCTGGG + Intronic
934156429 2:89205253-89205275 CCAGAGTCCCGGCCGGTTCTGGG - Intergenic
934210889 2:89977507-89977529 CCAGAGTCCCGGCCGGTTCTGGG + Intergenic
934690239 2:96353121-96353143 TCTGTGTCCCTGCCTCTTCTGGG - Intronic
935348490 2:102131963-102131985 TCTGTGTCACTGCTGTTTCTTGG - Intronic
937984843 2:127633772-127633794 TCTGTGTCACGGTGGGGTCCTGG - Intronic
948936381 2:241167589-241167611 TCTGTCTCCCGGTGGATGCTTGG - Intronic
1169806814 20:9568078-9568100 TCTGTCCCCCGGCAGCTTCTCGG - Intronic
1171330797 20:24337264-24337286 CCTGTGACCCGGCAGGTTCCAGG + Intergenic
1171877760 20:30594212-30594234 TCTGTGTCCCTGCCGGCTCAGGG + Intergenic
1172591705 20:36122444-36122466 TCTGTGTCCTTCCTGGTTCTTGG + Intronic
1178910074 21:36667195-36667217 CCTGTGGCCCTGCCGGTTCTCGG + Intergenic
1179179617 21:39034496-39034518 TCTGTGTCCCTGGGGGTCCCAGG - Intergenic
1180950578 22:19718848-19718870 TCTGTGACCCCGCGGGCTCCGGG + Intronic
1182467940 22:30529501-30529523 TCTGTGTCTGGGTGGGTTCTTGG - Intronic
1183146267 22:35995438-35995460 ACTGTCTCCCGGCAGGCTCTGGG - Intronic
1185193584 22:49454029-49454051 TGTGTGTCCCGGCGGTGTCCAGG - Intronic
953657004 3:44862053-44862075 TCTGTGCGCCGGCGCGTTCGGGG + Exonic
955084919 3:55693448-55693470 TCTGGGTCACAGAGGGTTCTTGG - Intronic
959902704 3:111677701-111677723 TCTGTGCCCCTGAGGGGTCTTGG + Intronic
961675210 3:128560841-128560863 TCTCTGTCCTGGGGGGCTCTGGG - Intergenic
962451103 3:135517887-135517909 TCTGAGTCCTGGCAGGGTCTAGG - Intergenic
968850608 4:3075111-3075133 TCCCTGTCCCGGCGGGTCCCAGG + Intronic
968958042 4:3728914-3728936 TCTGTCTCCTGGGGGGTTCTTGG + Intergenic
969786822 4:9464969-9464991 TCTGTGGCCTGGGGGGTTCAAGG - Intergenic
969790251 4:9489452-9489474 TCTGTGTCCTGGGGGGCTCAAGG - Intergenic
985649236 5:1099536-1099558 TCTGTGTCCTGGCCGGAACTGGG - Intronic
987846632 5:23295704-23295726 TCAGGGTCCCGGCTGGTACTGGG + Intergenic
994812427 5:104538645-104538667 TCTGTGTCCAGAAGAGTTCTTGG + Intergenic
999239362 5:150118603-150118625 TCAGTTTCCCTGCTGGTTCTAGG - Intronic
999670984 5:153959127-153959149 TTTGTGTCCAGGCTGGCTCTTGG + Intergenic
1005722438 6:28616420-28616442 TCTGTGTCCCGGCGGCCACCCGG + Intergenic
1005859054 6:29887710-29887732 TCTGAGTCCCGGTGGGTGCGTGG - Intergenic
1006950838 6:37819993-37820015 TCGCTGTCCCTGCGGCTTCTGGG + Exonic
1017815637 6:158014683-158014705 GCTCTGTCCAGGCTGGTTCTCGG - Intronic
1018522697 6:164668965-164668987 TCTGTGTCTAGCCGTGTTCTAGG + Intergenic
1019618127 7:1975805-1975827 TCTGGGTCCCGGGAGGTGCTGGG - Intronic
1033683643 7:143620467-143620489 TCAGGGTCTCTGCGGGTTCTTGG - Intergenic
1033700969 7:143837171-143837193 TCAGGGTCTCTGCGGGTTCTTGG + Intergenic
1035162885 7:156963919-156963941 TCTGCTTCCGGGCGAGTTCTAGG - Exonic
1050278964 9:4030683-4030705 TCTGTTTCCCAGCGTGTTCTTGG + Intronic
1052715232 9:32108076-32108098 TCTGTGACCTAGCTGGTTCTTGG - Intergenic
1056258519 9:84824690-84824712 TCTGTGTCCTGGTGAGTTCTGGG + Intronic
1057288087 9:93777014-93777036 GCTGTGTCCTGGCGGCTTGTCGG - Intergenic
1059048172 9:110893710-110893732 TTTGTGTCCCAGTGGGTTCCAGG - Intronic
1062737116 9:138143662-138143684 CCTGTGGCCCAGCGGGTCCTTGG + Intergenic
1196437407 X:115687410-115687432 TCTGTGTCTTGGAGGTTTCTGGG - Intergenic