ID: 1145963716

View in Genome Browser
Species Human (GRCh38)
Location 17:28902527-28902549
Sequence TCTGTGTCCCGGCGGGTTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145963710_1145963716 -7 Left 1145963710 17:28902511-28902533 CCCCTTTGCTGGCTTCTCTGTGT 0: 1
1: 2
2: 4
3: 48
4: 449
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963705_1145963716 9 Left 1145963705 17:28902495-28902517 CCCGGATCCTCCGCAGCCCCTTT 0: 1
1: 0
2: 0
3: 10
4: 224
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963712_1145963716 -9 Left 1145963712 17:28902513-28902535 CCTTTGCTGGCTTCTCTGTGTCC 0: 1
1: 0
2: 1
3: 48
4: 560
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963704_1145963716 15 Left 1145963704 17:28902489-28902511 CCTGGACCCGGATCCTCCGCAGC 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963711_1145963716 -8 Left 1145963711 17:28902512-28902534 CCCTTTGCTGGCTTCTCTGTGTC 0: 1
1: 0
2: 2
3: 41
4: 480
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963702_1145963716 19 Left 1145963702 17:28902485-28902507 CCTCCCTGGACCCGGATCCTCCG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963708_1145963716 2 Left 1145963708 17:28902502-28902524 CCTCCGCAGCCCCTTTGCTGGCT 0: 1
1: 0
2: 2
3: 23
4: 276
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963709_1145963716 -1 Left 1145963709 17:28902505-28902527 CCGCAGCCCCTTTGCTGGCTTCT 0: 1
1: 0
2: 4
3: 58
4: 522
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963703_1145963716 16 Left 1145963703 17:28902488-28902510 CCCTGGACCCGGATCCTCCGCAG 0: 1
1: 0
2: 2
3: 6
4: 94
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963700_1145963716 28 Left 1145963700 17:28902476-28902498 CCGCGCTCTCCTCCCTGGACCCG 0: 1
1: 0
2: 2
3: 24
4: 360
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145963706_1145963716 8 Left 1145963706 17:28902496-28902518 CCGGATCCTCCGCAGCCCCTTTG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145963716 Original CRISPR TCTGTGTCCCGGCGGGTTCT CGG Intronic