ID: 1145963825

View in Genome Browser
Species Human (GRCh38)
Location 17:28902969-28902991
Sequence TCCAGGGCGGTGCGGGGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145963825_1145963832 -9 Left 1145963825 17:28902969-28902991 CCCAGGCCCCGCACCGCCCTGGA 0: 1
1: 0
2: 1
3: 17
4: 281
Right 1145963832 17:28902983-28903005 CGCCCTGGATCGCCGCCAGGCGG 0: 1
1: 0
2: 1
3: 6
4: 62
1145963825_1145963839 18 Left 1145963825 17:28902969-28902991 CCCAGGCCCCGCACCGCCCTGGA 0: 1
1: 0
2: 1
3: 17
4: 281
Right 1145963839 17:28903010-28903032 CGATCCGCCCTGCACAGGCCTGG 0: 1
1: 0
2: 1
3: 3
4: 101
1145963825_1145963844 30 Left 1145963825 17:28902969-28902991 CCCAGGCCCCGCACCGCCCTGGA 0: 1
1: 0
2: 1
3: 17
4: 281
Right 1145963844 17:28903022-28903044 CACAGGCCTGGAACGGCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 175
1145963825_1145963841 23 Left 1145963825 17:28902969-28902991 CCCAGGCCCCGCACCGCCCTGGA 0: 1
1: 0
2: 1
3: 17
4: 281
Right 1145963841 17:28903015-28903037 CGCCCTGCACAGGCCTGGAACGG 0: 1
1: 0
2: 2
3: 33
4: 231
1145963825_1145963837 13 Left 1145963825 17:28902969-28902991 CCCAGGCCCCGCACCGCCCTGGA 0: 1
1: 0
2: 1
3: 17
4: 281
Right 1145963837 17:28903005-28903027 GCTGCCGATCCGCCCTGCACAGG 0: 1
1: 0
2: 0
3: 9
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145963825 Original CRISPR TCCAGGGCGGTGCGGGGCCT GGG (reversed) Exonic
900174833 1:1287048-1287070 TCGAGTGGGGAGCGGGGCCTGGG + Intronic
900296714 1:1955608-1955630 TCCAGGGGGCTGAGGGGCCCAGG - Intronic
900431056 1:2603413-2603435 CACAGGGCGGTGCCTGGCCTGGG + Intronic
900651579 1:3732565-3732587 TCCTGGCCTGTGCGGGGCCTGGG - Intronic
903323708 1:22557197-22557219 TCTAGGGCTGTGCAGGGACTGGG + Intergenic
904443667 1:30550599-30550621 CCCAAGGCGGAGCTGGGCCTGGG + Intergenic
905448455 1:38042660-38042682 TCCAGGCCTGTGAGAGGCCTGGG - Intergenic
906718464 1:47988003-47988025 TCCAGGGGTGTCTGGGGCCTCGG + Intronic
907053529 1:51345150-51345172 TCCAGGGCGGGGAGGAGCCACGG - Intergenic
912568626 1:110606465-110606487 CCCAGGGCGGGGAGGGGTCTGGG + Intronic
915106942 1:153540674-153540696 TCCAGGGCTGAGAGGGGGCTGGG + Intronic
915166951 1:153953287-153953309 TGCTGGGAGGTGTGGGGCCTGGG + Exonic
915322414 1:155063047-155063069 GCCAGGGCGGAGCGGGGCGGCGG + Intergenic
915517388 1:156421305-156421327 TCCGGGGCTCTGCAGGGCCTGGG - Intronic
919464085 1:197911066-197911088 TCCTTGGCGGTGCGTGGCGTGGG - Intergenic
920850981 1:209627647-209627669 TCCAGGGAGGGGCGCTGCCTGGG + Intronic
922505178 1:226122001-226122023 TCGCCGGCGGGGCGGGGCCTCGG - Intergenic
922561082 1:226570051-226570073 TCCAGGGAGGGGCGGGGCTCAGG - Intronic
923006776 1:230056271-230056293 TACAGGTCTGTGCTGGGCCTAGG - Intergenic
923299791 1:232630308-232630330 TCCCGCGCGCCGCGGGGCCTGGG - Intergenic
1062907926 10:1191248-1191270 TCCAGGAGGGTGGGGGGCCAGGG + Intronic
1067498072 10:46776316-46776338 TTGAGCGCGGTGCGGGTCCTCGG - Intergenic
1067521831 10:47013674-47013696 TCCGGGGCGCTGCAGGGCCAGGG - Intergenic
1067596574 10:47564098-47564120 TTGAGCGCGGTGCGGGTCCTCGG + Intergenic
1070794117 10:79207141-79207163 GCCAGGGCAGGGAGGGGCCTAGG - Intronic
1070912697 10:80132489-80132511 TCCCAGGAGGTGCGGGGACTCGG + Intronic
1071061024 10:81570918-81570940 TCCAGGTCCTTGCTGGGCCTAGG + Intergenic
1071061128 10:81571341-81571363 CCCAGGGCAGTGCTGGGCCCAGG - Intergenic
1071503877 10:86221645-86221667 TCCTGGAGGGTGCTGGGCCTTGG - Intronic
1071695094 10:87862555-87862577 TCCAGGTCGGTTCGCGGCGTCGG - Exonic
1076160492 10:128240755-128240777 TTCAGGGCTGGGTGGGGCCTGGG + Intergenic
1076239669 10:128894902-128894924 TCCTGGCAGGAGCGGGGCCTTGG - Intergenic
1076357252 10:129862078-129862100 TCCAGGGCTGTCCTGGCCCTGGG - Intronic
1076495957 10:130898067-130898089 TTCAGGGCTGAGAGGGGCCTGGG + Intergenic
1076795008 10:132794140-132794162 TCCAGGGGGGTGAGGGCCCCCGG + Intergenic
1076890486 10:133280880-133280902 GCCAGGGCGGTGCTGGGCAGGGG + Intronic
1076890522 10:133281004-133281026 GCCAGGGCGGTGCTGGGCAGGGG + Intronic
1076890579 10:133281198-133281220 GCCAGGGCGGTGCTGGGCAGGGG + Intronic
1077169463 11:1159757-1159779 TGCAGGGCTGTGCGGGGCTGGGG + Intronic
1077169523 11:1159973-1159995 TGCAGGGCTGTGCGGGGCTGGGG + Intronic
1077194365 11:1272045-1272067 TCCAGTGGGGTGCGGGGCGCCGG + Intergenic
1077239544 11:1503353-1503375 TCCAGGGTGGGACAGGGCCTAGG - Intergenic
1077269131 11:1666846-1666868 TCCCGGGCGGTGGGGGGCCGGGG - Intergenic
1077271416 11:1683868-1683890 TCCCGGGCGGTGGGGGGCCGGGG + Intergenic
1077442551 11:2575362-2575384 CCCTGGGCGGTGGGGGGCCCAGG - Intronic
1077530965 11:3094542-3094564 GCCTGGGAGGTGCGGAGCCTGGG + Intronic
1082009079 11:47438245-47438267 TCCAGGGCAGAGCAGGGGCTGGG + Intronic
1083148010 11:60773041-60773063 TCCTGCGAGGTGCTGGGCCTGGG + Intronic
1083463888 11:62832747-62832769 TCCAGGGCCACGCGGGGCCATGG - Intronic
1083667648 11:64284588-64284610 CCACGGGCGGGGCGGGGCCTGGG - Exonic
1083725095 11:64623722-64623744 TCCCAGGCAGTGCTGGGCCTTGG - Intronic
1083965713 11:66042579-66042601 GCCGGGGCGGTGCGCGGGCTCGG - Exonic
1084004740 11:66316891-66316913 TCCAGGAAGGTGCGGCGCCGTGG + Exonic
1084156764 11:67317500-67317522 CCCAGGCTGGGGCGGGGCCTCGG + Intergenic
1084191978 11:67503601-67503623 GCCGGGTTGGTGCGGGGCCTGGG - Intronic
1084225268 11:67711499-67711521 TCCAAGGCGGAGTGGAGCCTTGG - Intergenic
1084263082 11:67991346-67991368 TCCAAGGCGGAGTGGAGCCTTGG - Exonic
1084269484 11:68021400-68021422 TCCAGGGAGGAGCGGGGCCGTGG + Intronic
1084484395 11:69439350-69439372 TGCAGGGAGGTGCAGGACCTTGG - Intergenic
1085349926 11:75791807-75791829 TGCAGGGCTGTGCTGGGCATGGG + Intronic
1088352782 11:108909178-108909200 TCCAGGGAGGTGGGGGGAATAGG - Intronic
1089348742 11:117809237-117809259 TCCAGGGTGGGGCAGGTCCTGGG + Intronic
1090178602 11:124673752-124673774 TCCCGGCAGGGGCGGGGCCTGGG + Exonic
1090364364 11:126193338-126193360 TCCAGGTCGGAGCTGGGCCTCGG + Intergenic
1091588469 12:1829157-1829179 TCCAGGGAGGTGGGGGGCGCAGG + Intronic
1097793971 12:63843667-63843689 CGGAGGGAGGTGCGGGGCCTCGG + Intergenic
1101131745 12:101697630-101697652 TCGCGGGTGGGGCGGGGCCTCGG - Exonic
1101504061 12:105330653-105330675 CCCCGGGCGGGGCGGGGCCGGGG + Exonic
1102245392 12:111352712-111352734 TCCAGGGCTGATGGGGGCCTGGG - Intergenic
1102633534 12:114302513-114302535 TCCAAGGTGCTGCTGGGCCTTGG + Intergenic
1103400529 12:120640531-120640553 CCCAGGGCGGGGCGGGGCAAGGG + Exonic
1104989674 12:132618653-132618675 TGCGGGGCGGGGCGGGGCCGGGG + Intergenic
1106256401 13:28026098-28026120 TCCAGCACTTTGCGGGGCCTAGG + Intronic
1107838812 13:44435229-44435251 GCGAGCGCGGGGCGGGGCCTGGG - Intronic
1109138834 13:58687831-58687853 TCCTGGGCGGAGGGGGGACTTGG + Intergenic
1110626374 13:77660166-77660188 TCCCAGGCGGTGCGGGGGATGGG + Intergenic
1113627943 13:111860103-111860125 TCCAGGGCGCTTCCAGGCCTAGG + Intergenic
1114120921 14:19669522-19669544 TCCCGGGCGTGGCGGGGCCGAGG - Intergenic
1120769277 14:88360968-88360990 TCCAGGTGGGTGTGGGGCCCTGG - Intergenic
1122130940 14:99604293-99604315 TCGGGGGCGGGGCCGGGCCTCGG - Intergenic
1122284361 14:100642040-100642062 CACAGGGCGCTGCGGGGCCAAGG - Intergenic
1122372253 14:101235315-101235337 CCCAGGGTGGTGAGGGGCCCTGG - Intergenic
1122556494 14:102583539-102583561 TCCTGGGCGGGGTGGGGTCTGGG + Intergenic
1122768094 14:104085395-104085417 TGCGGGGCGGGGCGCGGCCTTGG - Intergenic
1122871601 14:104641289-104641311 ACCAGGGCTGTGCTGGGGCTGGG + Intergenic
1122937848 14:104968137-104968159 GCCAGGGCGCTGGGGGGCCCGGG - Intronic
1122993033 14:105247876-105247898 TCCTGGGAGGTGCGTGGCATGGG - Intronic
1123037950 14:105478941-105478963 GTCAGGGCGGGGCGGGGCCGGGG - Intronic
1123054367 14:105562123-105562145 TGCTGGGCGGTGGGCGGCCTGGG + Intergenic
1123078951 14:105682542-105682564 TGCTGGGCGGTGGGCGGCCTGGG + Intergenic
1123110703 14:105865640-105865662 TCCAGGGCGGGTCGGGTCCAGGG + Intergenic
1123113037 14:105881916-105881938 TCCACTGCAGTGCTGGGCCTGGG - Intergenic
1125664251 15:41417461-41417483 TCCTGGAGTGTGCGGGGCCTTGG + Intronic
1125937393 15:43648865-43648887 AGCGGGGCGGGGCGGGGCCTAGG - Intronic
1125957403 15:43799943-43799965 CCCAGGGAGGTGCCGGGGCTGGG + Exonic
1126619565 15:50623488-50623510 TCCAGGGCGGGGCGGGGAGGGGG - Intronic
1126662112 15:51043497-51043519 TCCAGGGGGGTGGGGGGCAAAGG - Intergenic
1129328233 15:74813129-74813151 TCCAGGGTGGGGCAAGGCCTGGG + Intronic
1129351113 15:74956526-74956548 GCCAGCGGGGTGCGGGGCCGAGG - Exonic
1129423806 15:75451064-75451086 TCCTGGGGTGGGCGGGGCCTCGG - Intronic
1129851997 15:78798728-78798750 TCCAGGGAGGGGAGGGGCCCTGG + Intronic
1129854035 15:78811536-78811558 GCCGGGGCGGGGCGGGGCCAGGG - Intronic
1131831477 15:96357324-96357346 TCCCGGGCGGGGCGGAGGCTGGG + Intergenic
1132495167 16:259759-259781 GCCAGGGCAGTGCTGGGACTGGG - Intronic
1132609393 16:807681-807703 CCCAGGGCGTGGCGGGCCCTCGG + Intronic
1132658649 16:1051875-1051897 TCCAGGGAGGTGCCGGGCCCGGG - Intergenic
1136723563 16:32341119-32341141 TCCAGGGCAGGGCCGGGCCCAGG + Intergenic
1138507503 16:57485717-57485739 TCTAGGGCCTTGCGGGCCCTGGG + Intronic
1138651420 16:58463587-58463609 CGCGGGGCGGTGCCGGGCCTGGG - Intronic
1139484611 16:67248682-67248704 TCCAGAGCGGTGCGCGGCCACGG - Intronic
1141572398 16:84941854-84941876 TCCAGAGAGGTCCGGGTCCTGGG - Intergenic
1142068516 16:88076344-88076366 TCGGGGGCGGGCCGGGGCCTGGG + Intronic
1142219002 16:88843844-88843866 TCCAGGGCCGTGCGCGGTGTGGG - Intronic
1142319180 16:89370165-89370187 TCCAGGGCAGGGAGGGGCGTGGG - Intronic
1203002869 16_KI270728v1_random:176646-176668 TCCAGGGCAGGGCCGGGCCCAGG - Intergenic
1203134474 16_KI270728v1_random:1713052-1713074 TCCAGGGCAGGGCCGGGCCCAGG - Intergenic
1142848950 17:2695160-2695182 CCCAGGGTGGTGTGGGGCGTCGG - Intronic
1143178076 17:4967953-4967975 GCGGGGGCGGGGCGGGGCCTAGG - Intergenic
1143865143 17:9917955-9917977 TCCCGGGCGACACGGGGCCTGGG - Intronic
1145963825 17:28902969-28902991 TCCAGGGCGGTGCGGGGCCTGGG - Exonic
1146548856 17:33762885-33762907 TCCAGTCCGTTGCGGGGCCTTGG + Intronic
1147539725 17:41347007-41347029 TCCGGGGCCCTGGGGGGCCTCGG + Intronic
1147541674 17:41365338-41365360 TCCGGGGCCCTGGGGGGCCTCGG + Intronic
1147545148 17:41395408-41395430 TCCGGGGCCCTGGGGGGCCTTGG + Intronic
1147839696 17:43362418-43362440 TGCAGGGCTGGGCGGAGCCTTGG + Intergenic
1147840573 17:43368852-43368874 TCGAGGGCTGGGCGGAGCCTTGG + Intergenic
1148154266 17:45413699-45413721 TCCAGGGCGGGGTGGGAGCTGGG + Intronic
1148243206 17:46013295-46013317 GCCATGGCTGTGTGGGGCCTGGG - Intronic
1148770330 17:50062669-50062691 GGCAGGGCAGTGCAGGGCCTGGG - Intronic
1150390515 17:64787419-64787441 GCCTGGGCGGGGCAGGGCCTAGG + Intergenic
1151740477 17:75978877-75978899 TCAGGGGCGCTGTGGGGCCTAGG - Intronic
1151884435 17:76915320-76915342 TGCAGCGGGGTGGGGGGCCTGGG + Intronic
1152539129 17:80966123-80966145 TCCAGGGTGGAGCGGGGGCGGGG - Exonic
1152798806 17:82321733-82321755 TTCAGGGCTGTGGGGGGCCTTGG - Exonic
1152860898 17:82696804-82696826 TCCAGGGCAGCGCTGGCCCTCGG + Intronic
1152926388 17:83089639-83089661 TCCAGGGCGGTGGGGAGGGTCGG - Intronic
1154379594 18:13837404-13837426 TCCTGGGAGGAGCGGGGCCAGGG - Intergenic
1155499396 18:26471889-26471911 TCCAGAGAGCTGCTGGGCCTTGG + Intronic
1156526822 18:37775632-37775654 TCCAGGTGGGTGAGGAGCCTTGG + Intergenic
1157205068 18:45691157-45691179 TCCTGGGCGGGGCGGGGCGGGGG - Intergenic
1160014057 18:75127471-75127493 TGCAGGGCGGTGAGGGGCCCAGG - Intergenic
1160373051 18:78390449-78390471 TGCAGTGCGGTCAGGGGCCTGGG + Intergenic
1160540559 18:79617935-79617957 CTGAGGGCGGTGCGGGGCGTTGG - Intergenic
1160570707 18:79815838-79815860 TCCAGGGCGGTGGGTGCCATCGG - Intergenic
1160697598 19:492190-492212 CCCAGGGAGAGGCGGGGCCTGGG - Intronic
1160720601 19:595470-595492 TCAAGGCCGGTGGGCGGCCTCGG - Intronic
1160836681 19:1127809-1127831 TCCAGTGCGTGGAGGGGCCTTGG - Intronic
1161288588 19:3480824-3480846 TCCAGAGTGGCACGGGGCCTGGG - Intergenic
1161705530 19:5819094-5819116 TCCAGAGAGGTCCGGGGCCCGGG + Intergenic
1162050359 19:8028974-8028996 TCCAGCACAGTGAGGGGCCTGGG + Intronic
1162531272 19:11237660-11237682 TCCAGGGCAGTGCCCGGCCGGGG + Exonic
1163027135 19:14518765-14518787 TCCAGGAAGGGGTGGGGCCTGGG + Intronic
1163055390 19:14714044-14714066 TCCAGGGTGGTGCCAGCCCTTGG + Intronic
1163428414 19:17251875-17251897 TCCTGGGCTGTGCGGGGGGTGGG - Intronic
1163672404 19:18636816-18636838 TCCAGGGCGGGGCCTGGGCTAGG - Intergenic
1164682741 19:30146330-30146352 GCCAGGGCGGGGCAGGGGCTGGG + Intergenic
1164802844 19:31092010-31092032 TCCAGGGCTTTGGGGGGACTGGG - Intergenic
1165089753 19:33378348-33378370 TCCAAGGAAGTGCGGGTCCTGGG - Intronic
1165897884 19:39154469-39154491 TCCAGGGCTGAGCTGGGCCAGGG + Intronic
1166655928 19:44611871-44611893 TCCAGGGAGGTGAGGGGCCCAGG - Intergenic
1166772237 19:45290831-45290853 TCCAGGGCTGTGCAGAGCCCGGG + Intronic
1166780714 19:45341041-45341063 GCGAGGACGGGGCGGGGCCTGGG + Intronic
1166824845 19:45602245-45602267 GCCTGGCCGGGGCGGGGCCTCGG - Intergenic
1167008241 19:46788805-46788827 GCCAGGAAGGGGCGGGGCCTTGG + Intergenic
1167201167 19:48066536-48066558 GCCAGGGCTGTGTGTGGCCTGGG - Intronic
1167268101 19:48493384-48493406 TCTAGAGTGGGGCGGGGCCTGGG - Intronic
1167492775 19:49801800-49801822 TCCAGGGCGCTGCCGGCCCCTGG - Exonic
1167586124 19:50376893-50376915 TGCAGCGCGGTGCGGGGGCGGGG + Intronic
1167838688 19:52095961-52095983 TCCAGGGGTGGGCGGGGCCGAGG + Intergenic
925464708 2:4096429-4096451 TCCAGGCAGCTGCAGGGCCTTGG + Intergenic
925899196 2:8496292-8496314 GCCCGGGCTGTGCAGGGCCTTGG - Intergenic
926625291 2:15085512-15085534 TCCAGGTCCTTGCTGGGCCTGGG - Intergenic
927679778 2:25131929-25131951 GCCGGGGCGGGGCGGGGCCGAGG + Intronic
927679939 2:25132591-25132613 ACCAGGGCGGAGCGGGGGGTCGG - Intronic
927705746 2:25295323-25295345 TGCAGGGCAGGGCGGGGCTTAGG - Intronic
928839524 2:35588144-35588166 TCTTGGGCAGTGTGGGGCCTAGG + Intergenic
929581500 2:43084280-43084302 TCCAGGGAGGTGGCGGGGCTGGG + Intergenic
930001661 2:46865821-46865843 GCCAGGGCAGTGCTGAGCCTGGG + Intergenic
930033248 2:47070753-47070775 TCCAGGGAGGTGCAGGGCTCTGG - Intronic
931321383 2:61177390-61177412 GGCAGGGCGGGGCGGGGCCGGGG + Intergenic
935661442 2:105469912-105469934 TGCAGGGCGGTGCAGAGCCAAGG + Intergenic
935997085 2:108786521-108786543 TGCAGGCAGGTGCGGGGCCTCGG + Intergenic
936093886 2:109517307-109517329 CCCCGGACTGTGCGGGGCCTGGG + Intergenic
936234603 2:110732471-110732493 GCCAGGGCAGGGCGGGGCCGGGG + Intergenic
936399446 2:112154532-112154554 TCGAGGGCTGTGCGGAGCCTGGG + Intronic
937306866 2:120877036-120877058 GCCTGGGAGGAGCGGGGCCTCGG + Intronic
938385703 2:130865432-130865454 TCCAGAACGGTGCTGAGCCTCGG + Intronic
943363727 2:186949842-186949864 TTCGGGGCGGGGAGGGGCCTGGG - Intergenic
946431102 2:219627792-219627814 TCCCGGGCGTGGCTGGGCCTCGG + Intronic
948824606 2:240568307-240568329 TCGAGCGCGGCGCGGGGCCGGGG - Intronic
948869269 2:240790115-240790137 TCCAGGCCCGTCCAGGGCCTGGG - Intronic
1168762673 20:360189-360211 TCCAGGGTGGTGTGGGGGTTGGG - Intergenic
1170358249 20:15516534-15516556 CCCAGGGCAGTGCGGGTGCTGGG + Intronic
1173822936 20:46030460-46030482 TCGGGGGCGGCGGGGGGCCTGGG - Intronic
1175068809 20:56314523-56314545 TGCAGGGAGATGCAGGGCCTGGG + Intergenic
1175243803 20:57569000-57569022 TCCAGGGAGATGTAGGGCCTCGG - Intergenic
1175894664 20:62330780-62330802 TCCACAGCGGTGGGGGGCCGAGG + Exonic
1176219545 20:63963492-63963514 ACCTGGGCGGGGCGGGGCCAGGG - Intronic
1176365692 21:6031547-6031569 TCCAGGGTGGTGCAGTGCCAGGG + Intergenic
1178878418 21:36430002-36430024 CCCAGGGCGGTGCGGTGGTTTGG - Intergenic
1178948397 21:36966688-36966710 GCCGGGGCGGGGCCGGGCCTGGG - Intronic
1179757824 21:43506998-43507020 TCCAGGGTGGTGCAGTGCCAGGG - Intergenic
1179902165 21:44399936-44399958 TCCTGGGCTGTGCCAGGCCTAGG + Intronic
1179902906 21:44403018-44403040 TCCAGGACTTGGCGGGGCCTGGG + Intronic
1180096490 21:45557622-45557644 TTCAGGGCAGTGAGTGGCCTTGG - Intergenic
1180198876 21:46213160-46213182 TCCAGGCCAGTGCCAGGCCTCGG - Intronic
1180229500 21:46418513-46418535 TCCAGGGTGGAGCGTGGCCCGGG - Intronic
1181048524 22:20227883-20227905 GCCAGGACTGTGCGGTGCCTTGG - Intergenic
1181741636 22:24925811-24925833 TCCAGGGCCGTGCTAGGTCTGGG + Intronic
1182441738 22:30368636-30368658 GCCAGAGAGGGGCGGGGCCTTGG + Intronic
1183622209 22:38981170-38981192 TCCCAGACGGTGCGGGGGCTGGG - Intronic
1183912708 22:41091655-41091677 TCCGGAGGGGGGCGGGGCCTAGG - Intergenic
1185140968 22:49101029-49101051 TCCAGGGCGGGACGCGGTCTGGG - Intergenic
1185276065 22:49950603-49950625 CGCAGGGGGGTGTGGGGCCTGGG + Intergenic
950438438 3:12994024-12994046 ACCGGTGCGGTGCGGGGCCCCGG - Intronic
950494302 3:13324460-13324482 TGCAGGGAGGTGAGGAGCCTGGG - Intronic
950707820 3:14793874-14793896 CCCAGGGTGGCGAGGGGCCTGGG - Intergenic
953914590 3:46910122-46910144 TCCAAGGCAGTGAGGGGCTTGGG + Intergenic
954459404 3:50617701-50617723 TCCAAGCAGGTGCTGGGCCTGGG + Exonic
955356585 3:58237460-58237482 TCCGGGGCGGGGCGGGGCGGGGG + Intergenic
955782145 3:62496278-62496300 TCCAGGGAGGTGCTGAGCATGGG - Intronic
956711933 3:72046761-72046783 TCCAGGGCACTGGGGGGCCAAGG + Intergenic
957078522 3:75619283-75619305 TCCAAGGCGGAGTGGAGCCTTGG - Intergenic
963804987 3:149714116-149714138 CCCAAGGCGGAGCTGGGCCTGGG + Intronic
967882066 3:194308455-194308477 TCCAGGGCTGTGCTAGGCCCTGG - Intergenic
968221472 3:196943017-196943039 TCCTGGGCTGTGCGGGGCCGAGG + Intergenic
968356674 3:198113632-198113654 TCCAGGGCGGGCCGAGGGCTGGG + Intergenic
968521833 4:1037683-1037705 ACCAGGGGCGGGCGGGGCCTGGG - Intergenic
968955674 4:3717586-3717608 TGCAGGGCGGTGGGGGCTCTGGG + Intergenic
969021606 4:4143256-4143278 TCCAAGGCGGAGTGGAGCCTTGG - Intergenic
969732262 4:8964160-8964182 TCCAAGGCGGAGTGGAGCCTTGG + Intergenic
976897376 4:90128131-90128153 TCCAGGGCGATGCGGAGCGCTGG + Intronic
982245547 4:153346907-153346929 TCAAGGGCGCTGCGGGGCAATGG - Intronic
985566856 5:623291-623313 ACCACGGAGGTGCGGGGCCCCGG + Intronic
985718173 5:1474560-1474582 GCCAGGCTCGTGCGGGGCCTCGG - Exonic
987999450 5:25330532-25330554 TCCAGGTCCTTGCTGGGCCTTGG - Intergenic
992939754 5:81750789-81750811 TCCCGGGAGGTGCGGGCGCTGGG - Intronic
993042047 5:82825202-82825224 TCTAGGGCTGTGATGGGCCTAGG - Intergenic
997475790 5:134141704-134141726 TGCAGGGCTGTGCAGGCCCTTGG + Intronic
998307650 5:141095457-141095479 ACCAGGGCCGTGCCGGACCTGGG - Exonic
1001462129 5:171925077-171925099 CCCAGGGCGGAGCGCGGCCCTGG + Intronic
1002059707 5:176619273-176619295 TGCGGGACGGGGCGGGGCCTCGG + Intergenic
1005968443 6:30743088-30743110 CCCAGGGAGGTGCGCGGGCTGGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006614032 6:35312575-35312597 TGCAGGGCGAAGGGGGGCCTGGG + Intronic
1006642870 6:35497533-35497555 GCCAGGGCGGAGCCGGGTCTGGG - Intergenic
1011099782 6:83708704-83708726 TCCAGGGCGGGCGGGGGACTGGG - Intronic
1018878994 6:167856362-167856384 TCCAGTGGGGTGGGGGGTCTTGG + Intronic
1018957706 6:168421492-168421514 GCCAGGGCGCTGGGGGGACTAGG - Intergenic
1019444877 7:1066165-1066187 TCCATGGCGCTGCGGGGTCCCGG + Intronic
1019520864 7:1459916-1459938 TCAGCGGCGGGGCGGGGCCTGGG - Intergenic
1019739337 7:2664987-2665009 TTCAGGGGTGGGCGGGGCCTCGG + Intergenic
1020001800 7:4760375-4760397 TCCAGGGTGGAGAGTGGCCTAGG - Intronic
1020309021 7:6855286-6855308 TCCAAGGCGGAGTGGAGCCTTGG - Intergenic
1021840578 7:24718708-24718730 TCCAGGGGTGAGGGGGGCCTAGG - Intronic
1025004766 7:55345098-55345120 GCCAGGGCGGGGCGCGGGCTGGG - Intergenic
1027187279 7:75979986-75980008 ACCGGGGCTGTGCGGTGCCTGGG + Intronic
1027960548 7:84940133-84940155 TCCCTGGCGCTGCGCGGCCTAGG - Intergenic
1029206179 7:98870355-98870377 TCCAGGGCGGGGAGGGGCTCGGG - Intronic
1029440805 7:100585804-100585826 TCCCGGGCCGGGCGGGGCCCGGG + Intronic
1031317300 7:120273432-120273454 GCCAGCGCGGTGCGGGGCTGCGG - Intergenic
1032089458 7:128904011-128904033 TCCAGGGAGGTGCAGGGCCTGGG + Intronic
1033663346 7:143418802-143418824 TCCAGGACTGTGCAGGGGCTGGG + Intergenic
1034458729 7:151186518-151186540 TGCAGGGCGGTGCGGCCCCCAGG + Exonic
1035394260 7:158525126-158525148 TCCAGCACTGTGCAGGGCCTGGG - Intronic
1035600782 8:895749-895771 TCCAGGTCGGTGTGGGGCAGTGG + Intergenic
1035749944 8:1990209-1990231 TCCAGGTGGGTGCTGGGCCTTGG + Intronic
1037825305 8:22156830-22156852 CGCGGGGCGGCGCGGGGCCTGGG + Exonic
1037888336 8:22606970-22606992 TCCAGGGCACTGCCTGGCCTGGG - Exonic
1038054879 8:23848938-23848960 AGCAGGGCGGTGCGAGGCTTGGG - Intronic
1045472995 8:102529029-102529051 GCCGGGGTGGGGCGGGGCCTGGG - Intronic
1049095772 8:140547342-140547364 GCCAGGACGGTGCTGGGCCCAGG + Intronic
1049230327 8:141478456-141478478 TCCAGGGTGGGGTGGGGCATGGG + Intergenic
1049789347 8:144465823-144465845 GCCTGGGTGGGGCGGGGCCTGGG + Intergenic
1049850230 8:144826851-144826873 TGGAGGGCGGTGCGGGGCCGGGG + Intergenic
1056684108 9:88745463-88745485 TACAGGGCGGAGCTGGGTCTGGG + Intergenic
1057502416 9:95606035-95606057 TCCATGGCGGGCCTGGGCCTGGG + Intergenic
1059406085 9:114098837-114098859 TCCGGGGGAGCGCGGGGCCTAGG + Intronic
1060468584 9:123929708-123929730 TCCAGGGAGGCGCGGGGGCGGGG - Intronic
1060544545 9:124452434-124452456 TCCAGGGCTGGGCGGAGCCAAGG - Intronic
1060962670 9:127692140-127692162 TCAAGGGCGGCGAGGGGGCTGGG - Exonic
1061278498 9:129583517-129583539 TCCAGGGCAGAGCAGAGCCTGGG - Intergenic
1061768274 9:132896647-132896669 CCCCGGGCGCTGCTGGGCCTGGG + Exonic
1061836722 9:133334340-133334362 TGCAGGGCGGGGCTGGGGCTGGG - Intronic
1061880256 9:133565447-133565469 CCCAGGGAGGTGCGGGGCTGGGG - Intronic
1061904917 9:133691853-133691875 CCCAGGGCTCTGCGGGTCCTGGG - Intronic
1061942992 9:133893014-133893036 TGCTGGGCGGTGAGGGGCCCTGG + Intronic
1062041581 9:134406834-134406856 TGCAGAGGGGTGCGGTGCCTGGG - Intronic
1062044698 9:134419608-134419630 CCCAGCGCGGGGCAGGGCCTGGG + Intronic
1062359510 9:136180881-136180903 TCCTGGGCGGAGAGGGGCCTGGG + Intergenic
1062363214 9:136197302-136197324 TGCAGGGTGGAGCCGGGCCTGGG + Exonic
1062540808 9:137040891-137040913 CCCAGGGAGGTGTGGGGCGTGGG + Exonic
1062636198 9:137492899-137492921 TCCAGGACAGGGCGGGGCCATGG + Intronic
1203790823 EBV:150763-150785 TCCCGGGCGGTGGGCGGCCCGGG + Intergenic
1185603944 X:1356355-1356377 TCCACGGGGGTGGGGGGGCTGGG - Intronic
1191720538 X:64224968-64224990 TCAAGGAGGGTGCGGGGTCTTGG + Exonic
1192262908 X:69518213-69518235 GGCAGGGCAGTGCAGGGCCTGGG + Intronic
1192361721 X:70445034-70445056 GCCCGGGCTGAGCGGGGCCTGGG - Exonic
1192799106 X:74449000-74449022 TGCAGGGCTGTCTGGGGCCTTGG + Intronic
1200630089 Y:5573304-5573326 TCCGGGGCGGCATGGGGCCTGGG + Intronic