ID: 1145965104

View in Genome Browser
Species Human (GRCh38)
Location 17:28911393-28911415
Sequence GTGTGGTGAGGAAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 731}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145965097_1145965104 10 Left 1145965097 17:28911360-28911382 CCCATAGGCTCTGGAACTCCTAG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 731
1145965098_1145965104 9 Left 1145965098 17:28911361-28911383 CCATAGGCTCTGGAACTCCTAGA 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 731
1145965094_1145965104 26 Left 1145965094 17:28911344-28911366 CCTTCTTGATTCTCAACCCATAG 0: 1
1: 0
2: 1
3: 9
4: 143
Right 1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 731
1145965100_1145965104 -8 Left 1145965100 17:28911378-28911400 CCTAGAGCTAAAAACGTGTGGTG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 731
1145965093_1145965104 27 Left 1145965093 17:28911343-28911365 CCCTTCTTGATTCTCAACCCATA 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145965104 Original CRISPR GTGTGGTGAGGAAGGGCAGA TGG Intronic
900612849 1:3551688-3551710 GTGTGGTGTGTCTGGGCAGAGGG - Intronic
900767416 1:4514430-4514452 ATGTGAAGAGGAAGGGCAGTAGG + Intergenic
901294635 1:8151409-8151431 ATGGGGAGAGGAAGGGCACACGG + Intergenic
901317823 1:8320886-8320908 GTGGGGAGAGGCTGGGCAGAGGG + Intronic
901452441 1:9344381-9344403 TGGCGGTGAGGAAAGGCAGATGG - Intronic
901497656 1:9631145-9631167 GTGTGATGCAGACGGGCAGATGG - Intergenic
901572096 1:10169216-10169238 GGGTAGTGAGGAAGGCAAGACGG + Intronic
901668798 1:10842085-10842107 GTGGGGTGGGGCAGGGCTGAGGG - Intergenic
901879672 1:12186318-12186340 GTGCTGTGAGGAAGGGGAGGAGG + Intronic
902123052 1:14184228-14184250 GTGGGGAGAAAAAGGGCAGAGGG - Intergenic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902329359 1:15723634-15723656 GTGGGCTGAGGCAGGGCAGGAGG + Intronic
902625343 1:17673187-17673209 GGGAGGTGAGGAAGGGGAGCTGG + Intronic
903140786 1:21338059-21338081 GAGGGATGAGGGAGGGCAGAGGG - Intronic
903195828 1:21687458-21687480 GTGTGAAGAGGAAAGGCAGGGGG + Intronic
903415680 1:23181166-23181188 GTGTAGTAATGAAGGGCAAAGGG + Intergenic
903548398 1:24141350-24141372 GGGTGGTGGGTCAGGGCAGAAGG + Intronic
903833626 1:26189254-26189276 GTGTGGAGAGGAGGGGCTAAGGG - Intronic
904222283 1:28982036-28982058 GTGGGGTGGGGAAGGGGGGAGGG - Intronic
904260412 1:29284542-29284564 CTGTGGCGTGGAAGTGCAGAAGG + Intronic
904348732 1:29891177-29891199 GGGCTGTGGGGAAGGGCAGAGGG + Intergenic
904354671 1:29931141-29931163 GTGGGGTGAGGGAGAGAAGATGG - Intergenic
904576377 1:31507640-31507662 TGGAGGAGAGGAAGGGCAGAGGG + Intergenic
904621297 1:31776884-31776906 ATCTGGGGAGGCAGGGCAGAGGG + Intergenic
905366393 1:37453952-37453974 GGATGGTGAGGACGGGCAGGGGG - Intergenic
905792080 1:40795157-40795179 GTGAGGTGAGCAGGGACAGATGG - Intronic
906145475 1:43557964-43557986 GTGGGGTGAGGCGGGGCAGGGGG - Intronic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
907198057 1:52703300-52703322 ATGAGGTGAGGAAGGGCTGCAGG - Intergenic
907458514 1:54591617-54591639 CTGTGGGGAGGAGGGGCAGGAGG - Intronic
907475183 1:54700687-54700709 GTGTGTATAGGAAGGGCAAAGGG + Intronic
907547428 1:55274428-55274450 GTGTGGTGGGGAAGAGCATGGGG + Intergenic
908061262 1:60352101-60352123 GTGAGGTGACGAAGGGGAGGTGG + Intergenic
908874024 1:68648936-68648958 GTGGGGTGGGGAAGGGGGGAGGG + Intergenic
909712523 1:78668145-78668167 ATGTGGTAATGAAGTGCAGATGG + Intergenic
910231190 1:84988820-84988842 GTGTAGTGAGGAAGGGGAAGAGG - Intronic
910246938 1:85149058-85149080 GTGTGGTGAGAGAATGCAGAAGG - Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
911574767 1:99562330-99562352 GTGGGGAGAGGGAGGGCAGCAGG + Intergenic
912284864 1:108358451-108358473 GTCAGGTGGGGAAGGGGAGAAGG - Intergenic
912903818 1:113682001-113682023 GTGGGGTGGGGTAGGGCAGGAGG - Intronic
912938957 1:114028227-114028249 TTGTGATTAGGAAGGGAAGAAGG - Intergenic
913259725 1:116987305-116987327 TTGTGGTGAGGAAGGGGTGATGG + Exonic
913593848 1:120354692-120354714 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
913645625 1:120851246-120851268 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914081087 1:144412280-144412302 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914093407 1:144524294-144524316 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914096278 1:144546810-144546832 GGGTGGGGCGGAAGAGCAGAAGG - Intergenic
914176002 1:145280814-145280836 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914302238 1:146387153-146387175 GGGTGGGGCGGAAGAGCAGAAGG + Intergenic
914305121 1:146409608-146409630 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914596937 1:149163217-149163239 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
915317691 1:155038636-155038658 GTGTTGTTAGGAGGTGCAGATGG - Intronic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
915835943 1:159174720-159174742 ATGTGAGAAGGAAGGGCAGATGG - Intronic
916242920 1:162657820-162657842 GTGGGGAGGGGAAGGGAAGAAGG - Intronic
916307136 1:163349804-163349826 GTGGAGTGAGGAAAGGAAGAGGG + Intronic
916717114 1:167455462-167455484 GCATGGTGAGGAAGGGCCGGAGG - Intronic
917179072 1:172274260-172274282 GAGTGATGATGCAGGGCAGATGG + Intronic
917582655 1:176395231-176395253 GAGAGGTGAGGAAGGGAAGGAGG - Intergenic
917755291 1:178093218-178093240 GTGTGGTGTGGATGGACGGACGG - Intergenic
918195908 1:182220919-182220941 GTGGGGTGGGGAAGGGGGGAGGG + Intergenic
918686118 1:187418095-187418117 GGGAGGTGGGGAAGGGCAGAGGG - Intergenic
919322662 1:196062594-196062616 GTGGGGTGGGGGAGGGCGGAGGG + Intergenic
919335945 1:196233900-196233922 GGGTGATGAGGAGGGGAAGATGG + Intronic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
920173033 1:204083409-204083431 GTGGGTTGAGGAAAAGCAGAAGG - Intronic
920307994 1:205031219-205031241 GAGGGGTGAGCAAGGCCAGAGGG - Intergenic
920500050 1:206480180-206480202 GAGTGGGCAGGAAGGGGAGATGG + Intronic
920547336 1:206829381-206829403 GTGGGGAGAGGAAAGGAAGAGGG + Intronic
920694001 1:208167882-208167904 GTGGGGTGAGGAGTGGCAAATGG - Intronic
921132225 1:212229689-212229711 GTGGGGAGAGGAAGGGAGGAGGG - Intergenic
921281679 1:213573918-213573940 GAGTGGTGATGATGGGCAGGTGG + Intergenic
921317352 1:213905131-213905153 GAGAGGTGAGGGAGGGAAGAAGG + Intergenic
922351279 1:224736479-224736501 GTGGGGTAAGGAAGGGAGGAAGG + Intronic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922579634 1:226687420-226687442 GTGTGATGTGGGAGGGCAGATGG - Intronic
922723474 1:227910727-227910749 GGGTGGTGAGGAAGGGAATCAGG - Intergenic
922987180 1:229874812-229874834 GTGTTCTGAGGAGCGGCAGAGGG + Intergenic
923051669 1:230394681-230394703 GTGAGGAGAGGAAGGGAGGAAGG - Intronic
923051700 1:230394794-230394816 GTGAGGAGAGGAAGGGAGGAAGG - Intronic
923279641 1:232430843-232430865 CTGTGGTATGGAAGGGCAAATGG - Intronic
923519144 1:234722559-234722581 GTGGGGAGAGGAAAGGCAGTGGG + Intergenic
1062842093 10:679620-679642 GTGTGGGGAGCATGGGCATAGGG - Intronic
1062897427 10:1114963-1114985 GTGTGCTGAGGGAGGTCTGAGGG - Intronic
1063337341 10:5228690-5228712 GTGGGGTGGGGGAGGGGAGAGGG + Intergenic
1063486160 10:6423091-6423113 GTGTGGTCAGCAAAGGCAGGAGG + Intergenic
1063968297 10:11363604-11363626 ATGTGATGGGGCAGGGCAGAGGG + Intergenic
1064245040 10:13661440-13661462 GGCTGGTGAGGAGGGGCAGGGGG + Intronic
1064385367 10:14886318-14886340 TGGAGGTGAGGAAGGGCAGGTGG - Intronic
1065225409 10:23538599-23538621 GTGTGGTGGGATAGAGCAGAAGG - Intergenic
1065703712 10:28450083-28450105 GTGTGATGAGAATGGCCAGAAGG + Intergenic
1065954513 10:30681893-30681915 ATGTGGTGGGGAGAGGCAGAGGG - Intergenic
1066440197 10:35431326-35431348 GTGGGGGGAGGAGGGGAAGATGG - Intronic
1067172866 10:43922289-43922311 GTTTGGGGAGGAAGGGAGGAAGG - Intergenic
1067523827 10:47026737-47026759 GTGGGGAGGGGGAGGGCAGAGGG + Intergenic
1068773441 10:60847252-60847274 GTGAGGTGGGGAACTGCAGAGGG + Intergenic
1069075719 10:64036740-64036762 GTGGGGAGAGGAAGCACAGATGG + Intergenic
1069841377 10:71341409-71341431 GTTTGGTGGGGAAGGGCTGCAGG + Intronic
1069856917 10:71446328-71446350 GGTTGGTGAAGAAGGGCAGCCGG - Intronic
1069914981 10:71781859-71781881 GAGAGGTGAGGAAGGCCTGATGG + Intronic
1069942338 10:71964320-71964342 GTGGGGTGAGGAAGAGGAGGAGG + Intergenic
1070537980 10:77393612-77393634 GTGTGGTGCGGCTGGGCAGTTGG - Intronic
1070684659 10:78471754-78471776 GTGTGGTGTGGTTGCGCAGATGG + Intergenic
1072044122 10:91637666-91637688 GTGAGGTGAGGAAAAGGAGAGGG + Intergenic
1072824622 10:98594295-98594317 TTGTGGTGGGGAAGGGGAGGCGG - Intronic
1073404733 10:103287248-103287270 GACTGGTGAGGGAGGGAAGAAGG + Intronic
1074269792 10:111942614-111942636 GTGTGGTGGGGAAGTGGAAAGGG - Intergenic
1074296710 10:112195946-112195968 GTGGGGTGAGGGAGAGAAGATGG - Intronic
1075048765 10:119166327-119166349 CTGTGCTGGGGAAGGGCAGGTGG - Intergenic
1075112188 10:119596524-119596546 GGGTGGGGAGGAAGGGGAGGGGG + Intronic
1075171632 10:120121005-120121027 GTTTCCTGAGGAAGGGAAGAGGG + Intergenic
1075564115 10:123491424-123491446 GTGAGCTGAGGGAGGGCAGGCGG - Intergenic
1075895281 10:125989802-125989824 GTGTGCTGAAGGAAGGCAGAGGG + Intronic
1075995625 10:126873993-126874015 GTGTGGAGAGGAAAGGAAGGAGG - Intergenic
1076241401 10:128910832-128910854 GTTTGGTGAGGAAGGGTCCAGGG + Intergenic
1076295216 10:129378594-129378616 GTGAGTTGAGGAAGGGCTCAGGG - Intergenic
1076489329 10:130846250-130846272 GTGAGGGGAGGAGAGGCAGAGGG - Intergenic
1076863880 10:133157980-133158002 GTCTGGTGGGAAAGGGCAGTGGG + Intergenic
1077050476 11:564201-564223 GTTAGGTGAGGCAGAGCAGATGG - Intergenic
1077160208 11:1109243-1109265 CTCTGGTGAGGGAGGGCAGCAGG - Intergenic
1077259334 11:1607434-1607456 GTGGGGTCAGGAAAGGAAGACGG + Intergenic
1077334757 11:1998289-1998311 GTGGGGTGCTGAGGGGCAGAGGG + Intergenic
1077352835 11:2100765-2100787 TTGGGCTGGGGAAGGGCAGACGG - Intergenic
1078087506 11:8243045-8243067 GTGAGGGGAGGAAGGGCTGGGGG + Intronic
1078103435 11:8343685-8343707 GGGTGCTGGGGAAGGGGAGAGGG - Intergenic
1078399275 11:11009988-11010010 GTTTGGAGAGGGAGGGGAGAAGG + Intergenic
1078924235 11:15859543-15859565 GGGTGGTGAGGCATGCCAGAGGG - Intergenic
1079144298 11:17837138-17837160 GTGTGGTAAGGAAGAAGAGAAGG - Intronic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1080126370 11:28739264-28739286 ATCTTTTGAGGAAGGGCAGAAGG + Intergenic
1080641329 11:34160212-34160234 GTGTGGTGATGCAGGGCGCAGGG + Intronic
1081338664 11:41900639-41900661 GTGTGGTGAGGAAGGAGAAATGG + Intergenic
1081366169 11:42238120-42238142 GTGTGGTGGGGCAGGGGATAAGG - Intergenic
1081542689 11:44047751-44047773 GTGTTCTGAGGAAGAGCAGGGGG - Intergenic
1081933569 11:46889354-46889376 CTGTTGTGAGGATGGGGAGAAGG - Intronic
1082009882 11:47442643-47442665 GTGTTGTGAGGTGGGGCAGCGGG - Exonic
1082649190 11:55766986-55767008 GTGTGGTGGGGAAGAGCACAAGG + Intergenic
1082781238 11:57289095-57289117 GTGTGGTGAAGCAGGGCTGGAGG + Intergenic
1083148538 11:60775812-60775834 ATGTGGTGAGGGAGGGCAGCTGG - Exonic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083851669 11:65371270-65371292 GTGTGGTGGGGAAAGCCACAGGG + Intergenic
1084097230 11:66919539-66919561 GGCTGGCGAGGAAGGGCAGGGGG + Intronic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1085267649 11:75246749-75246771 GGGTGGTGAGGCAGGGGTGAAGG - Intergenic
1085423525 11:76383178-76383200 GTGTGGGGAGGAAGACCAGGTGG + Intronic
1086264326 11:84979655-84979677 GTGGGGTGGGGGAGGGCGGAGGG + Intronic
1086361783 11:86068294-86068316 GGGTGGGAAGGAAGAGCAGAAGG + Intronic
1086415932 11:86588951-86588973 GGGAGGTGAGGGAGGGCAGGGGG - Intronic
1087262725 11:96028739-96028761 GTGTTCTGAAAAAGGGCAGAGGG + Intronic
1088242217 11:107784227-107784249 CTGGGGTGAGGAAGGGCAGGTGG + Intergenic
1088427136 11:109716203-109716225 GGGTGATGAAGAAGGGGAGAGGG + Intergenic
1088457141 11:110044609-110044631 GTGCGGAGAGCAAGGGGAGACGG - Intergenic
1088903725 11:114138115-114138137 AAGTGGTGAGGGAGGGCAGGAGG + Intronic
1089180382 11:116579570-116579592 GAGTGGTGAGGAAGGGCAGCTGG - Intergenic
1089575861 11:119442664-119442686 GGGTGGGGAGGAAGGGTGGATGG - Intergenic
1089961641 11:122622160-122622182 GTGGGGAGAGGAAGGGCAGCTGG + Intergenic
1090187121 11:124746055-124746077 GAGGGGTGAGGGTGGGCAGAGGG - Intronic
1090187249 11:124746601-124746623 GGGTGGAGTGGAAGGGCAAATGG - Exonic
1090299844 11:125626008-125626030 GTCCGGTGAGGAAGGGCGGCCGG + Exonic
1090312127 11:125750393-125750415 GTGGGGGAAGGAAGTGCAGATGG + Intergenic
1090418770 11:126559032-126559054 GTGGGGTGAGGAAGGAGAGCTGG + Intronic
1090939612 11:131375535-131375557 GTGCACTGGGGAAGGGCAGAAGG + Intronic
1091167448 11:133492172-133492194 GAGTGGACAGGAAGGGAAGAGGG + Intronic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1202817740 11_KI270721v1_random:53471-53493 GTGGGGTGCTGAGGGGCAGAGGG + Intergenic
1091656715 12:2351530-2351552 TTGAGGAGAGGAAGGACAGAAGG - Intronic
1091776305 12:3187186-3187208 GTGTGGTCAGAAAGAGCACAGGG + Intronic
1092090152 12:5797665-5797687 GTGTGGGGAGCCAAGGCAGATGG - Intronic
1092091709 12:5809122-5809144 GTGGGGAGAGGGAGTGCAGATGG + Intronic
1092473735 12:8801208-8801230 GTGGGGTGGGGAAGGGGGGAGGG + Intergenic
1092563769 12:9643172-9643194 GTGTAGTGACACAGGGCAGAGGG + Intergenic
1092943952 12:13436043-13436065 AAGAAGTGAGGAAGGGCAGAGGG - Intergenic
1094704806 12:32904285-32904307 GGGAAGGGAGGAAGGGCAGAAGG - Intergenic
1095550678 12:43435254-43435276 GTGTGGAGGAGAATGGCAGAGGG + Intronic
1095904065 12:47359322-47359344 GAGTGGGGAGGATGGGAAGAGGG - Intergenic
1096230461 12:49894003-49894025 GGGTCTGGAGGAAGGGCAGAGGG + Intronic
1096488015 12:51996646-51996668 GTGTGTGGGGTAAGGGCAGAAGG - Intronic
1096518690 12:52172164-52172186 GGCTGGTGAGGAAGGGCTGCAGG - Intronic
1096538535 12:52290297-52290319 GTGTGGGAAGGTGGGGCAGATGG + Intronic
1096540244 12:52303067-52303089 GTGTGGGAAGGTGGGGCAGATGG - Intronic
1096650678 12:53060652-53060674 CTGTAGGGTGGAAGGGCAGATGG - Intronic
1096826097 12:54279486-54279508 GGGTTGTGAGGAAGGGGAGTCGG - Intronic
1096876696 12:54635113-54635135 GTGTGGTGGGGAAGGGAGGAGGG - Intergenic
1096996395 12:55840816-55840838 GTGTGGGGTGGAAGGGTGGAGGG + Exonic
1097081397 12:56433810-56433832 GCTGGGTGAGGATGGGCAGAAGG + Exonic
1098039670 12:66341223-66341245 GTCTGGTGTCCAAGGGCAGAAGG + Exonic
1098211886 12:68175128-68175150 GTGGGGTGAGGAAGAGCATCAGG + Intergenic
1098369556 12:69742141-69742163 TAGTGGAGAGGAAGGACAGATGG + Intronic
1099571140 12:84320486-84320508 GTGGGGTGGGGGAGGGGAGATGG - Intergenic
1100005606 12:89891412-89891434 GTGGGGTGAGGGAGGGGGGAGGG + Intergenic
1100959848 12:99950412-99950434 GTGTGGTGGGGAAGGAGAGTGGG - Intronic
1101047375 12:100822714-100822736 GTGAGGTGAGGAGGGGAAGATGG + Intronic
1101729606 12:107416091-107416113 CTGTGGTCAGGAACCGCAGAAGG + Intronic
1102133819 12:110555553-110555575 GTGTGGAGAGCAAGAGCGGAAGG + Intronic
1102458799 12:113087492-113087514 GTGGGGGGAGGAGGGGGAGAAGG + Intronic
1102788310 12:115622112-115622134 GAGGAGTGAGGAAGGTCAGATGG + Intergenic
1102982554 12:117253620-117253642 GTGAGGTGAGCAAGGGGATAAGG - Exonic
1103507112 12:121449089-121449111 CTGTGGTGGGGTGGGGCAGATGG + Intronic
1103947001 12:124532326-124532348 GTGTGGTGGGGCAGGGCATCCGG + Intronic
1103971193 12:124673961-124673983 GGGTGGGGAGGGAGGGCATAGGG - Intergenic
1104289205 12:127453544-127453566 GTGTGAGGAGGGAAGGCAGAAGG + Intergenic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1104971358 12:132532341-132532363 GAGTGGTGAGGGAGGTCTGAGGG - Intronic
1105323485 13:19348435-19348457 GTATGGTATGGAAGGGCATAGGG - Intergenic
1105738675 13:23298961-23298983 GTGTGGTGAGGATGGGAGGTGGG + Intronic
1105742784 13:23345991-23346013 GTGTGCAGAGGAAGGGAAGGTGG - Intronic
1105871307 13:24507882-24507904 ATGGGGTGAGGAAGGGCTGGGGG - Intronic
1105873904 13:24537402-24537424 GTGTAGTATGGAAGGGCATAGGG + Intergenic
1106014595 13:25856747-25856769 GGCTGGGGAGGAAGGGGAGAAGG - Intronic
1106080593 13:26497382-26497404 TTGTTGTGAGGCAGGGCAGGAGG - Intergenic
1106440540 13:29763202-29763224 ATGTGGTAAGGAAGGACATAAGG + Intergenic
1107020383 13:35745070-35745092 CTGTGCTGAGGAAGGGGAGGAGG + Intergenic
1110613379 13:77514020-77514042 GTCTGGTGTCCAAGGGCAGAAGG + Intergenic
1111108854 13:83681259-83681281 GGATGGTGAGGAAGGGAATAAGG + Intergenic
1111331985 13:86771107-86771129 GTGGGCTGCGCAAGGGCAGAAGG - Intergenic
1112592658 13:100778007-100778029 GTGGGGTGGGGAAGGGGGGAGGG - Intergenic
1112773171 13:102814146-102814168 GTAGGGTGAGGAATGGAAGAAGG + Intronic
1113060080 13:106313684-106313706 GTGTGGTGAGGGCTGGCATAGGG - Intergenic
1113673729 13:112194297-112194319 GTCTGGTGAGCAAGGGCAGGGGG + Intergenic
1113831135 13:113296905-113296927 GCGAGGGGAGAAAGGGCAGACGG - Intergenic
1113900428 13:113793844-113793866 CTGTGGTGTGGAGGGTCAGAAGG + Intronic
1115273774 14:31583849-31583871 GAGTGGAGAGGAAGGGCTCAAGG + Intronic
1115447255 14:33505533-33505555 GTGTGATAAGGGAGTGCAGATGG - Intronic
1115449580 14:33530911-33530933 GTGGGGTGAGGAACTGCACATGG + Intronic
1116133054 14:40883999-40884021 ATGTGGTCAGGAAGACCAGAAGG - Intergenic
1118328699 14:64799584-64799606 GAGTGGTGAAGAGGGGCACAAGG + Intronic
1119273161 14:73327896-73327918 GTGTGGTGGGGGAGGGCAGGCGG - Intronic
1119423544 14:74522146-74522168 GTGTGGCAAGGAAGGGGTGAGGG + Intronic
1121256734 14:92536214-92536236 GTGTTGTGTGAAAAGGCAGAGGG - Intronic
1121871073 14:97407999-97408021 GTGTGTTCAGGAAGAGCAGGGGG - Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1121916806 14:97842958-97842980 GTGTGGTGAGGATGAGCAAAAGG - Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122324756 14:100875537-100875559 GAGGGGTGAGGAAGGGGAGATGG - Intergenic
1122324784 14:100875626-100875648 GAGGGGTGAGAAAGGGAAGATGG - Intergenic
1122324816 14:100875717-100875739 CGGGGGTGAGGAAGGGGAGACGG - Intergenic
1122389917 14:101373240-101373262 GCGGGGTGAGCAGGGGCAGAAGG + Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1123424300 15:20156807-20156829 GTTTGGAGAGGAAGGAAAGAAGG + Intergenic
1123533522 15:21163336-21163358 GTTTGGAGAGGAAGGAAAGAAGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124439294 15:29675081-29675103 GTGGGGTGAGCAAGGGAGGAGGG - Intergenic
1124610238 15:31203119-31203141 GTGTGGCTAGGCAGGACAGAAGG + Intergenic
1125761881 15:42102424-42102446 GCCTGGTGAGGAGAGGCAGAGGG - Intergenic
1125794436 15:42394087-42394109 GTGTGCTGGGGAATGGCAGGGGG - Intronic
1125883868 15:43214213-43214235 GAGTGGGGAGGAAGAGAAGATGG + Intronic
1126336029 15:47587213-47587235 GTGGGGTGAGGTAGGGCAGAGGG - Intronic
1126786003 15:52178496-52178518 GTGTGGAGAAGAAAGGCAGAAGG + Intronic
1127221794 15:56887595-56887617 GTGTGGGGAGGAAGGAAAGGTGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1128382076 15:67120554-67120576 GGGTGGTCTAGAAGGGCAGATGG + Intronic
1128598097 15:68972260-68972282 ATGTTGTGAGGAAGGAGAGATGG - Intronic
1128919074 15:71594035-71594057 GGGTGGTGAGGTGGGGCAGCTGG + Intronic
1129131187 15:73497827-73497849 GTATGGAGATGAAAGGCAGAAGG + Intronic
1129298445 15:74612368-74612390 GCTTGGTGAGGAAGGTCAGAGGG + Intronic
1129737290 15:77973414-77973436 GCGTGGAGGGGAAGGGCTGACGG + Intergenic
1129848782 15:78780211-78780233 GCGTGGAGGGGAAGGGCTGACGG - Intronic
1130253157 15:82313859-82313881 GCGTGGAGGGGAAGGGCTGATGG + Intergenic
1130675887 15:85951623-85951645 GTGTGGTGACTTGGGGCAGAGGG + Intergenic
1130710417 15:86275163-86275185 TTTTGGTGCTGAAGGGCAGAGGG + Intronic
1130962512 15:88672059-88672081 GAGTGGGGAGGAAGGAAAGATGG + Intergenic
1131343002 15:91620412-91620434 GAGTGATGAGGAAAGGCAGCAGG + Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1133662012 16:7927535-7927557 GGGTGGTGAGGAAAAGCAGAGGG - Intergenic
1134061159 16:11200476-11200498 GTGGGGTGGGGAAGGGGAAAGGG + Intergenic
1134909502 16:18011758-18011780 GGGCGGTGAAGAAGGGGAGATGG - Intergenic
1135205998 16:20484480-20484502 CTGTGCTGAGGAAAGGCAGGTGG - Intronic
1135212914 16:20539304-20539326 CTGTGCTGAGGAAAGGCAGGTGG + Intronic
1135736199 16:24933704-24933726 GTGTGAAGAGGATGGGGAGAGGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136068730 16:27775657-27775679 TGGTGGAGAGGAAGGGGAGAGGG + Intronic
1136089526 16:27908454-27908476 GTGTAGACAGGACGGGCAGATGG - Intronic
1136396368 16:29994697-29994719 CAGTGATGAGGAACGGCAGAGGG - Exonic
1136518119 16:30780066-30780088 GTGTGGTGTGGGAGGTGAGATGG + Exonic
1137367179 16:47870715-47870737 GAGTGGTGAGGAAGTACAGGTGG + Intergenic
1137679699 16:50329670-50329692 CTGTGGTCAGGAAGGGCAGCCGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1139701922 16:68713070-68713092 GTGGGGAGAGGAGGGACAGAAGG - Intronic
1139852399 16:69959172-69959194 GGGAGGAGAGGAAAGGCAGAGGG + Intronic
1139881370 16:70182080-70182102 GGGAGGAGAGGAAAGGCAGAGGG + Intronic
1139882955 16:70189124-70189146 GGGGAGTGAGGAAGGGCAGTGGG + Intergenic
1140369554 16:74406395-74406417 GGGGAGTGAGGAAGGGCAGTGGG - Intergenic
1140371137 16:74413424-74413446 GGGAGGAGAGGAAAGGCAGAGGG - Intronic
1140435501 16:74943655-74943677 GTGCTGTGAGCAAGGGCAGGAGG - Intronic
1140998641 16:80286703-80286725 TTTTGGTGAGGAAGGGTAGAAGG + Intergenic
1141178284 16:81734900-81734922 GTGTGGTGGGGTGGGGGAGAGGG + Intergenic
1141189153 16:81811102-81811124 GTGTGCTGGGGAAGGTCATATGG + Intronic
1141746298 16:85928773-85928795 GTTTGGAGAGGAGGGGGAGAAGG + Intergenic
1142143482 16:88482971-88482993 GTGTGCTGAGGGAGGGCACTCGG + Intronic
1142977908 17:3656302-3656324 GGGTGGTGGGGCAGGGCAGGGGG - Intronic
1142977942 17:3656380-3656402 GGGTGGAGGGGCAGGGCAGAGGG - Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1144622994 17:16830285-16830307 GTGTGGGGAGGAAAGGCTGTGGG + Intergenic
1144883436 17:18442431-18442453 GTGTGGGGAGGAAAGGCTGTGGG - Intergenic
1144954324 17:19011577-19011599 GTGTGGAGAGGATGGACAGGAGG + Intronic
1145148794 17:20501955-20501977 GTGTGGGGAGGAAAGGCTGTGGG + Intergenic
1145188252 17:20814800-20814822 GTGCAGTGAGGAAAGGCAGGAGG + Intergenic
1145262354 17:21361929-21361951 GAGTGGAGAGTAAGGGCTGAGGG + Intergenic
1145965104 17:28911393-28911415 GTGTGGTGAGGAAGGGCAGATGG + Intronic
1146324451 17:31873625-31873647 GTGGTGTGGGGAATGGCAGAAGG - Intronic
1146694053 17:34895677-34895699 GTGTGGAGAGGAGGGCCAGCGGG + Intergenic
1147249517 17:39144674-39144696 GTGGGGTGAGGAGTGGCTGAGGG - Intronic
1147847113 17:43412272-43412294 ATGTTGTCAGGATGGGCAGAAGG + Intergenic
1148047285 17:44751892-44751914 CAATGGTGAGGAAGGGCAGGGGG - Exonic
1148577099 17:48719885-48719907 GGGTGGAGGGGAAGGGCGGAGGG - Intergenic
1148742177 17:49899056-49899078 GAGGGGTGAGGAAGGGGTGAAGG - Intergenic
1148955160 17:51347579-51347601 CTGTGGTGAGAAAGGACAGGTGG - Intergenic
1149781252 17:59398181-59398203 GTGTGGTGAGGGAGGGGACTGGG + Exonic
1150066344 17:62112731-62112753 ATCTGATGATGAAGGGCAGAGGG - Intergenic
1150343707 17:64388177-64388199 ATGTGGTGTGGAGGGGGAGAGGG + Intronic
1150368520 17:64613738-64613760 GTGTGTGGAGGGGGGGCAGAGGG + Intronic
1150871447 17:68916134-68916156 GGGTGGTGGGGAAGGGGGGATGG + Intronic
1151063842 17:71128179-71128201 GTGGGGTGGGGGAGGGGAGAGGG + Intergenic
1151374973 17:73681967-73681989 TGGTGGTGAGGCTGGGCAGAAGG + Intergenic
1151519585 17:74618625-74618647 GAGTGGGGAGGAAAGGCAGATGG - Intronic
1151527175 17:74678646-74678668 GTGTGGTGGCCAGGGGCAGAAGG - Intronic
1151652861 17:75480931-75480953 CTGTGGCGAGGAAGCTCAGAAGG + Intronic
1151681180 17:75623756-75623778 GTGGGGACAGGAAGGGCAGGTGG - Intergenic
1152270535 17:79322138-79322160 GTGTGATGAGGAGGGGCAAGAGG + Intronic
1152368317 17:79870212-79870234 GTGGGAGGAGGAAGGGCAGGTGG - Intergenic
1152494959 17:80664527-80664549 GTGGGGTGAGGAAGAGAAGAAGG - Intronic
1153434955 18:5059184-5059206 GTGTGGTGAGGCAGGGAAGGAGG - Intergenic
1153533879 18:6079266-6079288 GTGTGTTGGGGAAGTGCAGGTGG - Intronic
1153799353 18:8655937-8655959 GTGGGGTGAGCAGGGGCAGGTGG + Intergenic
1154127413 18:11704176-11704198 GTGTGATCAGGGAGTGCAGAAGG - Intronic
1154220346 18:12447512-12447534 GTGGGGTAAGAAAGGGCACATGG - Exonic
1155228343 18:23749896-23749918 GTGAGGAGAGGAAGGACAGGTGG + Intronic
1155534405 18:26802028-26802050 GTGTGGGGAGGAGGTGGAGATGG + Intergenic
1156350078 18:36296291-36296313 TTTGGGGGAGGAAGGGCAGATGG - Intergenic
1156508084 18:37611600-37611622 TTGGGATGAGGAGGGGCAGAAGG - Intergenic
1156772203 18:40742152-40742174 GAGAGGGGAGGAAGGGCAGAGGG + Intergenic
1156890850 18:42187795-42187817 GTGGGAAGAGGCAGGGCAGATGG + Intergenic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1157043057 18:44062187-44062209 GAGTGGTGGTGAAGGGCAAAAGG + Intergenic
1157278829 18:46332707-46332729 CTGTGTTGAGCAAGGGCATAGGG - Intronic
1157349239 18:46870100-46870122 GTGTGGTTAGGGAGGGCACGGGG - Intronic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1158058715 18:53312965-53312987 GTGGGGAGAGGAAGGGAGGAGGG + Intronic
1159128049 18:64247736-64247758 GTGTGGTAAGGGAAGGTAGATGG - Intergenic
1159766796 18:72501630-72501652 GTGAGCAGAGGTAGGGCAGAGGG - Intergenic
1160051841 18:75440966-75440988 GTGTGGTGAGGGAGGGATGGAGG + Intergenic
1160412974 18:78687605-78687627 GTGTGGTGGGGAGGGACAGGTGG - Intergenic
1160657599 19:281551-281573 GGGTGGTGAGAATGGGCAGGGGG + Intronic
1160978556 19:1806203-1806225 GTGTGGGGAGGGTTGGCAGAGGG - Intronic
1161043330 19:2121594-2121616 GTGTGGTGGGGCAGGGCAGAGGG - Intronic
1161201024 19:3014798-3014820 ATGTGGGGAGGCAGGGCAGGTGG + Intronic
1161241364 19:3225392-3225414 GTGGGGTGAGGGAGGGAGGAAGG - Intronic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161964411 19:7540345-7540367 GGGTGGTGGGGATGGGCAGCAGG + Intronic
1161994953 19:7706293-7706315 GGGTGGGGAGGAAGGGCAGTAGG + Intergenic
1162043446 19:7984064-7984086 GTGTGGTGAGGAAGAGCATGTGG - Intronic
1162070043 19:8147904-8147926 GTGGTGTGGGGAAGGGCAGCAGG + Intronic
1162125596 19:8498196-8498218 GTGTGGGGAGGAAGCGGAGGTGG - Intronic
1162805037 19:13133401-13133423 GTGTGGTGAGGGAAAGCAAAGGG - Intronic
1163597028 19:18226252-18226274 CTGTGGTGAGGCTGGACAGAGGG - Intronic
1164683738 19:30153065-30153087 GTGGGCTGGGGAAGGCCAGAGGG + Intergenic
1165068876 19:33243793-33243815 GTTGGCTGAGGTAGGGCAGAGGG + Intergenic
1165311905 19:35033557-35033579 GCGTGGTGTGGAATGGCAGCCGG + Exonic
1166284268 19:41814164-41814186 GTGTGGGAAGGACTGGCAGATGG - Intergenic
1166326466 19:42053936-42053958 GGGTGGGGAGGTGGGGCAGAGGG + Intronic
1167270439 19:48502874-48502896 GGGGGTTGGGGAAGGGCAGAGGG - Intronic
1167385724 19:49162081-49162103 GGGCGGGGAGGAAGGCCAGAGGG + Intronic
1167972045 19:53193741-53193763 GTGAGGTGAGGCATGGGAGAAGG - Intergenic
1168216304 19:54928439-54928461 CAGTAGTGAGGAAAGGCAGAGGG + Intronic
1168529649 19:57117633-57117655 ATCTCCTGAGGAAGGGCAGAGGG + Intergenic
1168705628 19:58468769-58468791 GTCTGGTCAGGGAGGGCAGAGGG + Intronic
925667578 2:6277084-6277106 GGGGGGTGAGGGAGGGCAGGGGG + Intergenic
925848056 2:8051766-8051788 GTGTGGTGAGGGGGTGCAGGAGG + Intergenic
926244448 2:11112906-11112928 GTATGGTGAGGAAGGAAGGAAGG + Intergenic
926244456 2:11112948-11112970 GTATGGTGAGGAAGGAAGGAAGG + Intergenic
926274995 2:11396827-11396849 GTGTGCTGAGGGAGGGGTGATGG + Intergenic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
927504067 2:23601991-23602013 GGGGGCTGAGGCAGGGCAGAGGG + Intronic
927521032 2:23698247-23698269 GTGGGCTGAGGAAGGGCTCAGGG - Intronic
927812003 2:26185382-26185404 GCGGGGTGGGGAAGGGGAGAAGG + Intronic
927877758 2:26670263-26670285 GACTGGGGAGGAAGGGCAGGGGG + Intergenic
928767360 2:34663228-34663250 GAGTGTTGAGCAAAGGCAGATGG + Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929765867 2:44843717-44843739 GGGTGGTGAGGGAGGACAGTGGG + Intergenic
929918103 2:46153016-46153038 GGGAGGAGAGTAAGGGCAGAGGG - Intronic
929942080 2:46341967-46341989 GTGTGGTGGGGGGAGGCAGATGG - Intronic
929968242 2:46551455-46551477 GTGTAGGGAGGAACGGCAGAGGG + Intronic
930692929 2:54383012-54383034 GAGGGGAGAGGGAGGGCAGAGGG - Intronic
931187285 2:59965584-59965606 GTGTGGTGAGGAAGTGCAGGAGG + Intergenic
931476802 2:62596119-62596141 AGCTGGTGGGGAAGGGCAGAAGG - Intergenic
931626990 2:64265323-64265345 GTGGGGAGAGGAAGGGCAGTGGG + Intergenic
931808950 2:65835311-65835333 GACTGGAAAGGAAGGGCAGATGG + Intergenic
932593739 2:73081610-73081632 AGGTGGTGAGGAAGAGCAGCTGG + Intronic
932756171 2:74411225-74411247 GTGGGTTAAGGAAGGGCAAAAGG + Intergenic
933645826 2:84811963-84811985 GTGTGAGGAGGAGGGGGAGATGG - Intronic
934752059 2:96799804-96799826 GGGTGGTGTGGAAGAGCAGAGGG + Intronic
935056378 2:99570943-99570965 GTGAGCTCAGGAAGGACAGAGGG - Intronic
935362820 2:102262082-102262104 GTGAAGTGAGGAGGGGGAGAAGG + Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
936235927 2:110742544-110742566 GTGTGGTGACGAAGGGCCCCAGG - Intronic
936259752 2:110948618-110948640 GGCTGTAGAGGAAGGGCAGAGGG + Intronic
936542551 2:113363961-113363983 GTGTGGGGAGGAACTGAAGAAGG - Intergenic
936970482 2:118171927-118171949 GTGGGGTGGGGAAGAGGAGATGG - Intergenic
937242447 2:120471045-120471067 GTGTGGAAAGAAAGGGCAGAGGG - Intergenic
937333073 2:121044225-121044247 GGGAAGTGAGGAAGGGAAGAGGG + Intergenic
938090242 2:128426505-128426527 GTGTGGGGAGGATGGGAGGAGGG - Intergenic
938104254 2:128519581-128519603 CTGTGGTGAGGAAGGACTGGTGG - Intergenic
939119486 2:138099661-138099683 GTGTGGGGAGGAAGAGCAACAGG + Intergenic
939557185 2:143689963-143689985 GACTGGTGAGAAGGGGCAGAAGG + Intronic
939648746 2:144735747-144735769 GTGTGTTGGGGAGGGGAAGAGGG + Intergenic
940043136 2:149381075-149381097 GGGTGGTGTGGTGGGGCAGATGG + Intronic
940555451 2:155221155-155221177 GGGTGGGGAGGAAGTGGAGATGG + Intergenic
940639751 2:156333488-156333510 GGGGGGAGAGGAAGGGGAGAGGG + Intronic
940764037 2:157770477-157770499 GTGAGGTGTGGAGGGGCAGCTGG - Exonic
941100737 2:161292154-161292176 GTGGGGTGAGGGAGGGGGGAGGG + Intergenic
944656958 2:201885037-201885059 GATTGGAGAGGAAGGGCATACGG + Intronic
945127405 2:206527844-206527866 GCATGGTGAGGAGGGGCATATGG + Intronic
945853164 2:215034411-215034433 GTGTGGAGAGGAATGGGGGAAGG + Intronic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
946073430 2:217053803-217053825 GGGTGGTGAGGAAGAGGTGAGGG - Intergenic
946142599 2:217704331-217704353 GGGTGGAGAGTTAGGGCAGAGGG - Intronic
946307772 2:218865869-218865891 AGATGGTGAGGAAGGGCAGAGGG + Intronic
946527093 2:220532321-220532343 GTGTGGTTAGGAAGGTGTGATGG - Intergenic
947438964 2:230100635-230100657 GAGTGGTGGGGAAGTGGAGATGG - Intergenic
947996678 2:234533835-234533857 CTTTGGTGAGGAAGGAAAGATGG + Intergenic
948363619 2:237439882-237439904 AGGTGCTGAGGAGGGGCAGAGGG - Intergenic
948584286 2:239009365-239009387 GTCAGGTGAGGAAGGTCAGAGGG - Intergenic
948608409 2:239151376-239151398 GCTTGGTGAGGAAGAGCACAGGG - Intronic
948616840 2:239204634-239204656 GTGTGCTCAGGAAGGGCTTAGGG + Intronic
1169060869 20:2659644-2659666 GTGTCGTGAGGAGGAGCAGGTGG - Intronic
1169091118 20:2861989-2862011 GGGTGTTGAGGCAGGGCTGAGGG + Intronic
1169662974 20:8000663-8000685 GTATGGTGGGGAAGGGAAGCAGG - Intronic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1171255976 20:23689227-23689249 GAGTGGGGAGGAGGGGGAGATGG - Intergenic
1171263324 20:23751124-23751146 GAGTGGGGAGGAGGGGGAGATGG - Intronic
1172116213 20:32574949-32574971 GTGGGGTGAGGGAGGCTAGAGGG - Intronic
1172233582 20:33353900-33353922 GTGTGTTGAGTAAGGGCTGCAGG - Intergenic
1172841303 20:37904058-37904080 GTGTGGAGAGGAAGAGGACAAGG - Intronic
1172940705 20:38652338-38652360 GTGGGATGAGGGAGGGAAGAGGG - Intergenic
1173168588 20:40704108-40704130 GGGTGGAGGGGAAGGGAAGAAGG + Intergenic
1173911663 20:46675143-46675165 GTGGGGAGAGGAACAGCAGAGGG + Intronic
1174029513 20:47611264-47611286 GAGTGGTGAGGAGGGACAGTGGG - Intronic
1174037841 20:47679061-47679083 GTGGGGACAGGAAGGGCAGGAGG - Intronic
1174131516 20:48346826-48346848 GTGGGGAGAGGAATGGGAGATGG - Intergenic
1174554000 20:51381150-51381172 CTGTGATGAGGACAGGCAGAAGG + Intergenic
1175020206 20:55838942-55838964 GAGTATGGAGGAAGGGCAGATGG - Intergenic
1175111532 20:56651799-56651821 GAGTTGTGAGGAGGGGTAGAAGG - Intergenic
1175193039 20:57224158-57224180 GTGTGGTGGGGACAGGCAGGGGG + Intronic
1175289799 20:57868152-57868174 GGGGGGTGAGGAAGGTGAGAGGG - Intergenic
1175766957 20:61598599-61598621 GTGTGGGGAGGATGTGCAGAGGG + Intronic
1175893216 20:62324423-62324445 GTGTGGTGAGTAGGGGCTGGTGG - Exonic
1175951295 20:62584765-62584787 GTGTGCTCAGGGAGGTCAGAGGG + Intergenic
1176012171 20:62903846-62903868 GTGTGGCAAAGAAGGGAAGAGGG + Intronic
1176028575 20:62999068-62999090 GTGGGGAGGGGAAGGGGAGAGGG + Intergenic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1176290828 21:5043733-5043755 ATGCAGTGAGGAAGGGCAGGTGG + Intergenic
1176365285 21:6029107-6029129 GTGTGAGGATGCAGGGCAGATGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178916553 21:36708397-36708419 AGGTGGTGAAGAAGGGCAGGAGG + Intronic
1179343788 21:40537265-40537287 ATGTGGTGAGGAAGGGAGGTAGG + Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179452520 21:41475577-41475599 GTGGGGTGAGGGAGGGATGAGGG + Intronic
1179664773 21:42903539-42903561 GAGTGGTGAGCAAAGGCAGAGGG + Exonic
1179758233 21:43509438-43509460 GTGTGAGGATGCAGGGCAGATGG - Intergenic
1179866427 21:44219908-44219930 ATGCAGTGAGGAAGGGCAGGTGG - Intergenic
1179894752 21:44355203-44355225 CTGTGGGGAGGAGGGGCAAAGGG - Intronic
1180008955 21:45037167-45037189 TGGTGGGGAGGAAGGGCAGGAGG + Intergenic
1180057580 21:45366914-45366936 GTGGGGTGAGAGAGAGCAGAAGG + Intergenic
1180141532 21:45896225-45896247 GTGCTGTGAGGAAGGACAGATGG - Exonic
1180782430 22:18528718-18528740 GTGGGGTGAGGCAGGGCGGGCGG + Intronic
1181466828 22:23114898-23114920 GGGAGGTGAGGAAAGGGAGAGGG + Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181758078 22:25039479-25039501 GTGTGGTTTGGAAGGTCAGGCGG + Exonic
1182216943 22:28726848-28726870 GTGTCATGAGCAAGGGGAGAGGG - Intronic
1182420926 22:30248207-30248229 GTGTGGTGGGGAACGGCAGCAGG - Intergenic
1182591582 22:31384878-31384900 GAGTGGTGAGAAAGGGCACCCGG + Intergenic
1182772116 22:32803320-32803342 TTGTGGTGAGGAGGGGGAGGAGG + Intronic
1183343667 22:37295351-37295373 GTGTGGTGGGGGAGGGGAGGAGG - Intronic
1183346297 22:37310163-37310185 GTGTGGTGTGGAGAGTCAGAGGG - Intronic
1183510700 22:38233013-38233035 GTGTCCTGAGGAAGGCGAGAGGG - Intronic
1183824278 22:40372453-40372475 GTGTGGTCTGGGAGGGGAGAGGG + Intronic
1183905514 22:41037316-41037338 GTGGGGAGAGGATGGGAAGAAGG + Intergenic
1183948817 22:41341294-41341316 GCTTGGTGAGGAAGGGCACGAGG - Intronic
1183951869 22:41356944-41356966 GGGTGGTGGGGAAGGGTGGATGG + Intronic
1184420774 22:44381760-44381782 GTGTGGGGAGGAAGGGGAAGGGG + Intergenic
1185039201 22:48495814-48495836 GTGTGGTGAGCCAGGGGAGAGGG - Intronic
1185090459 22:48765971-48765993 GTGGGGTGAGGAGGGATAGAAGG - Intronic
1185146739 22:49141247-49141269 GTGAGGTGAGGGAGGACACAGGG + Intergenic
1185183276 22:49376413-49376435 GTGGGCTGAGGAGGAGCAGAAGG - Intergenic
949394304 3:3598389-3598411 GGGTGGGGAGGATGGACAGAAGG + Intergenic
949482097 3:4503673-4503695 GTGTGGTGGGGCAGGGGAGTGGG - Intronic
949512083 3:4775198-4775220 GTTCGGTGAGCAAAGGCAGAGGG - Intronic
949895011 3:8762198-8762220 GAGGGGTGAGGAGGGGAAGAGGG - Intronic
950750373 3:15123558-15123580 ATGTGGGCAGGCAGGGCAGATGG + Intergenic
950989344 3:17415841-17415863 GTGAGGTGAGGGTGGGAAGAAGG - Intronic
950998132 3:17526909-17526931 GTCTGTTGAGGAAGGAAAGAAGG + Intronic
953134742 3:40172761-40172783 GTGGGGGAAGGAAGGGGAGAGGG - Intronic
953198954 3:40759855-40759877 GTGGGGTGGGGGAGGGCGGAGGG + Intergenic
953227694 3:41035441-41035463 GAGTGGGGAAGAAGGGGAGAAGG - Intergenic
953241794 3:41155975-41155997 GCAAGGTGAGGAAGGGAAGAGGG + Intergenic
954111149 3:48433893-48433915 GTGTGGAGAGAAGGTGCAGATGG - Intronic
954202281 3:49030847-49030869 TTGTGGGAAGGAGGGGCAGAGGG - Intronic
954284622 3:49610042-49610064 GTGTGTAGAGGAAAGCCAGATGG + Intronic
954948589 3:54448545-54448567 GTGGGGTGAGGGATGCCAGAAGG + Intronic
956625196 3:71259943-71259965 AAGAGGTGAGGAAGGGCAGCAGG + Intronic
956642656 3:71429291-71429313 GTGTGGGGAGGAAGAACAGCAGG + Intronic
956875767 3:73461556-73461578 GTAGGGTGAGGATGGGGAGATGG - Intronic
957040661 3:75333234-75333256 GTCTGGTGTACAAGGGCAGAGGG - Intergenic
957318699 3:78601649-78601671 GAGTGGTGAGGAAAGAAAGAAGG - Intronic
957657811 3:83104156-83104178 GTGTGGTGGGGATCGGTAGATGG - Intergenic
957989882 3:87614441-87614463 GTGTGGTTAGGGAAGGCAGGGGG + Intergenic
958723089 3:97870285-97870307 GAGTGGGGAGGATGGGAAGAGGG - Intronic
960711027 3:120528195-120528217 GTGTGGAGAGGATAGGCTGAAGG - Intergenic
961479757 3:127172123-127172145 GTATGGGGAGGGAGAGCAGAGGG + Intergenic
961703815 3:128768078-128768100 GAGGGGTAAGGAAGGGCAGTAGG - Intronic
962283867 3:134070957-134070979 GTGTGGTGAGGAGGGGCCTGTGG + Intronic
962406042 3:135100944-135100966 GTGTGGTGAGGTCGGGGAGAGGG + Intronic
962814624 3:138987227-138987249 GTCTGCTGAGGATGGGCACATGG - Intergenic
963642618 3:147878259-147878281 TTATGGTGAGGAAGAGAAGAAGG + Intergenic
964315860 3:155443652-155443674 TAGAGGAGAGGAAGGGCAGAGGG + Intronic
964613879 3:158642042-158642064 GTGTGGGAAGGAAGCGCGGACGG + Intergenic
964646173 3:158960451-158960473 GGGAGGTGAGGAAGGGAGGAGGG - Intergenic
964656805 3:159076182-159076204 GTTAGGTGAGGATGAGCAGATGG - Intronic
965160787 3:165130117-165130139 GTGTGGAGAGCATGGGGAGAGGG - Intergenic
965481454 3:169224216-169224238 TGTTGGTGATGAAGGGCAGATGG - Intronic
965697701 3:171426713-171426735 GTGTGGTGAGAAGGGGCTAAAGG - Intronic
967172057 3:186829390-186829412 GTGTTGTTAGGAAGGGCAGTGGG - Intergenic
967172083 3:186829588-186829610 GTGTTGTTAGGAAGGGCAGTGGG - Intergenic
968135409 3:196216659-196216681 CCGGGGTGAGGAAGGGCAGGCGG - Exonic
968478620 4:824455-824477 GTGGGGTGGGGAGGGGCTGAGGG - Intronic
968668431 4:1834347-1834369 GTGAGGTGAGGATGGGGAGACGG - Intronic
968762237 4:2448728-2448750 GTGGAGTGAGGCAGGGAAGAGGG + Intronic
968894392 4:3390191-3390213 AGGTGGTCAGGAAGGGAAGAGGG - Intronic
969059800 4:4425655-4425677 GTCTGGAGAGGAAGGGGAGGTGG + Intronic
969195040 4:5554573-5554595 GTGTGCTGGGGAAGGGGATAAGG - Intronic
969396498 4:6924955-6924977 GTGCTGGGAGGAAGGGCACAGGG + Intronic
969683129 4:8654160-8654182 ATGTGGTGAGGGAGGGCACCAGG - Intergenic
969797430 4:9536944-9536966 ATGTGGTCAGGCAGGGCAGGTGG + Intergenic
970030819 4:11672641-11672663 CAGTGGTGAGGAAGGGCTGGAGG - Intergenic
970614194 4:17752347-17752369 GGGAGGTGAGGCTGGGCAGAAGG + Intronic
970815673 4:20152926-20152948 GTGTGGTGAGGATGGGGACAGGG + Intergenic
972299439 4:37771195-37771217 GTGGGATGAGGAAAGGAAGAGGG - Intergenic
972640021 4:40916894-40916916 CTGTGGTGGGGAAGGTCAGAGGG + Intronic
973139474 4:46748446-46748468 TTGTGGTGGGCAAGAGCAGAGGG + Intronic
973342031 4:49015274-49015296 GAGTGGGGAGGAGGGGCATAAGG - Intronic
973532906 4:51850943-51850965 GAGTTGTGGGGGAGGGCAGAGGG + Intronic
974119064 4:57616273-57616295 GTGTGTTGAGGAAAGGAAAATGG + Intergenic
974806123 4:66882915-66882937 CTCTGGTGGGGCAGGGCAGAAGG + Intergenic
975646191 4:76548328-76548350 GTGTGATGAGGAGGGTCACAGGG + Intronic
975949727 4:79755280-79755302 AGTTGTTGAGGAAGGGCAGAGGG + Intergenic
976034321 4:80796841-80796863 TTGTGGTGGGAAAGGGCAAATGG - Intronic
976770580 4:88647949-88647971 TGGTGGTGAGGAAGAGGAGAGGG - Intronic
976890808 4:90045230-90045252 GGGTTGGTAGGAAGGGCAGAAGG - Intergenic
977090824 4:92673825-92673847 GGGTGGGGAGGAAGGGGGGAGGG + Intronic
977118498 4:93065823-93065845 GTGTATTTAGCAAGGGCAGATGG - Intronic
978133818 4:105233042-105233064 GGCTGGAGGGGAAGGGCAGACGG + Intronic
978222283 4:106291214-106291236 GTGTGGGAAGGAGGTGCAGATGG - Intronic
978462908 4:108977232-108977254 GAGGAGTGAGGAGGGGCAGAGGG + Intronic
979663345 4:123283982-123284004 GTGTGAAGAGGAAGAGAAGAAGG - Intronic
980297987 4:130947540-130947562 GAGTGGTGGGGAAAGGTAGAGGG - Intergenic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
981250846 4:142598818-142598840 GTGCTGTGTGGAGGGGCAGAAGG - Intronic
981534225 4:145782624-145782646 GTGAGGTGAGGAAGGGCTGTTGG - Intronic
981643796 4:146974978-146975000 ATGTGGTGGGGAAGGGAGGAGGG - Intergenic
982126199 4:152185990-152186012 GTGTGCTGGGGTGGGGCAGAGGG - Intergenic
982307336 4:153946485-153946507 ATGTGGTGAGGCAGGAGAGATGG + Intergenic
982678120 4:158399537-158399559 TTGGGGTGAGGAAGAGCAGGAGG - Intronic
985126851 4:186703050-186703072 GTGAGGTCTGGAAGGGGAGAGGG - Intronic
985175810 4:187199459-187199481 GTGTGTTGAAGAAGGTCAAACGG - Intergenic
985472756 5:55702-55724 GTGAGGTGAGTGAGGTCAGAGGG + Intergenic
986357795 5:6945612-6945634 GAGTGATGAGGGAGGGCAGGAGG - Intergenic
987353606 5:17043017-17043039 GTGGTGAGAGGAAGGGAAGAGGG + Intergenic
987653881 5:20780637-20780659 GTGTGTTGAGGAGGGACTGATGG + Intergenic
987929236 5:24382262-24382284 GTATTTTGAGAAAGGGCAGATGG + Intergenic
988400291 5:30752946-30752968 GTAAGGTGAGGAATGGGAGAAGG + Intergenic
988427499 5:31080417-31080439 GTGTGGTGAGAGAAAGCAGAAGG - Intergenic
988741693 5:34080854-34080876 GTGTGTTGAGGAGGGACTGATGG - Intronic
989131349 5:38110248-38110270 GTGTGTTGAGGAAGGTCGGGAGG - Intergenic
989754849 5:44940020-44940042 GTCTGATGACCAAGGGCAGAAGG - Intergenic
990615285 5:57501384-57501406 TTCTGGCGAGGAAGGACAGAGGG + Intergenic
990921109 5:60968833-60968855 GGGTGGTGGGGAAGTGGAGATGG - Intronic
991171100 5:63626737-63626759 GTGGGGTGGGGGAGGGCGGAGGG - Intergenic
992109991 5:73483959-73483981 TTATGGTGAGAAATGGCAGATGG - Intergenic
992355120 5:75973175-75973197 GTGGGGTGGGGAAGGGGGGAGGG + Intergenic
992873346 5:81027613-81027635 ATGTTTTGAGCAAGGGCAGATGG - Intronic
992879954 5:81097952-81097974 CTGTGTTGAGGATGGGCTGAGGG + Intronic
994952776 5:106486107-106486129 GGGAGGTGAGGTGGGGCAGAGGG - Intergenic
995426213 5:112026489-112026511 GTGGGGTGAGGGAGGGGGGAGGG - Intergenic
995795958 5:115941544-115941566 GCAGGGGGAGGAAGGGCAGAAGG + Intergenic
996789426 5:127276868-127276890 GTGTGTTGGGGAAGGGGTGATGG + Intergenic
997445230 5:133935436-133935458 GCGTGGAGAGGAAGCTCAGAGGG + Intergenic
997857229 5:137383305-137383327 GTGGGGAGGGGAAGGGCAAATGG - Intronic
997876764 5:137556554-137556576 GTGTAATGAGGAAGGGAGGAGGG + Intronic
998131890 5:139655544-139655566 GTGTGGGGAGGTAGGTCAGGAGG - Intronic
998943512 5:147311927-147311949 GGGTGCTATGGAAGGGCAGAGGG + Intronic
999279633 5:150356849-150356871 GTGGGGTGAGGTGGGGAAGAGGG - Intergenic
999312371 5:150559742-150559764 GGGGGGTGAGGAGGGGCTGATGG - Intergenic
999585834 5:153088640-153088662 GTGTGGAAATGAAGGGTAGATGG + Intergenic
1000185277 5:158851967-158851989 GGGTGGGGAGGAGGGGGAGAAGG + Intronic
1000191442 5:158914698-158914720 GTGGGGAAAGGAAAGGCAGAAGG + Intronic
1001027463 5:168236310-168236332 ATGTAGTGAGAAGGGGCAGAGGG - Intronic
1001173299 5:169442141-169442163 GTGGTGTGAGGAAGGTGAGAAGG - Intergenic
1001264559 5:170264102-170264124 GATTGGTGAGCAATGGCAGAGGG - Intronic
1001740733 5:174050935-174050957 GTGGGGTGAGGAGATGCAGAAGG - Intronic
1001906252 5:175476024-175476046 GTGTGGTGGGGAAGGGAGGCGGG + Intergenic
1001988957 5:176100143-176100165 GTGTTAAAAGGAAGGGCAGAAGG + Intronic
1002073137 5:176692537-176692559 TTGTGGGGAGGAAGGCCAGGGGG + Intergenic
1002103980 5:176870870-176870892 GTGGGGTGAGCGTGGGCAGATGG - Intronic
1002103988 5:176870904-176870926 GTGGGGTGAGCGTGGGCAGATGG - Intronic
1002104237 5:176872093-176872115 GTGGGGTGAGTGTGGGCAGATGG - Intronic
1002104355 5:176872703-176872725 GTGGGGTGAGTGTGGGCAGATGG - Intronic
1002181242 5:177432159-177432181 GTGTGGGGAGGAGGGGCACATGG - Intronic
1002227912 5:177737993-177738015 GTGTTAAAAGGAAGGGCAGAAGG - Intronic
1002547576 5:179960481-179960503 GCGTGGTGAGGAAGGGATGGGGG + Intronic
1002974824 6:2064381-2064403 GTGGGAGGAGGAAGAGCAGAGGG + Intronic
1002988081 6:2210742-2210764 ATGTGGTGTGATAGGGCAGAGGG - Intronic
1003172246 6:3729060-3729082 GTGTGGTGTGCCAGGGGAGAGGG - Intronic
1003469700 6:6417648-6417670 GTGTGGCGGGGAGGGACAGAGGG + Intergenic
1005477610 6:26223333-26223355 GTGTGGAGAGGAAAAGCACAGGG + Intergenic
1005990588 6:30899465-30899487 GTGTGTCCAGGAAGGGGAGAAGG - Intronic
1006009679 6:31032053-31032075 GTGTGGTGGGGGAGGAGAGATGG - Intronic
1006276652 6:33009573-33009595 GTGTGGTGAGGACAGGAACAAGG + Exonic
1006291719 6:33143021-33143043 GTGTTGTGAGGAAGGACATGAGG + Intergenic
1006471404 6:34231280-34231302 TTGCTGTGAGGAAGTGCAGAGGG - Intergenic
1006533250 6:34675555-34675577 GTGTGGCGGGGAGGGGCAGTGGG - Intronic
1007004017 6:38342907-38342929 GGGTGGTGAGGAAGTTCAGGGGG - Intronic
1007400839 6:41601386-41601408 CTGTGTTGAGGAGGGGCAGCAGG - Exonic
1007582288 6:42966705-42966727 GGGTGGTGAGGAAGGGAGAAGGG - Intronic
1007758406 6:44116315-44116337 GTGTGATGGGGAATGGCATATGG - Intronic
1008076739 6:47153537-47153559 TTGTAGTGAGGAAGGCTAGATGG - Intergenic
1008471454 6:51889632-51889654 GGGTGATGAGGAAGGGATGAGGG + Intronic
1008501170 6:52184765-52184787 GTGTGTAGAGGAGGGGCAGTAGG + Intergenic
1008714810 6:54275572-54275594 GTGGGGTGGGGAAGGGGGGAGGG - Intergenic
1010714082 6:79207968-79207990 GGTTGGTGAGGAAGAGCTGAAGG + Intronic
1011739212 6:90342605-90342627 ATGAGGTTTGGAAGGGCAGAGGG + Intergenic
1011864880 6:91813117-91813139 GTGTGCAGAGGAAGTGCTGAAGG + Intergenic
1012170893 6:96015877-96015899 GGGGGGTGAGCAAGGGAAGAGGG - Intergenic
1012180265 6:96144024-96144046 GTTTGGAGAGGAAGAGCACAGGG - Intronic
1012610452 6:101212440-101212462 CTGAGGTGAGGAAGCTCAGAAGG - Intergenic
1013367842 6:109448444-109448466 CTGAGGGGAGGAAGGGCAGCAGG + Intronic
1014419628 6:121226752-121226774 GTATGGTCACGAAGGGGAGAAGG + Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1016702357 6:147067880-147067902 GTGAGGTGGGGCAGGGGAGAGGG - Intergenic
1017637362 6:156456196-156456218 GAGGGGGGAGGAAGGGGAGAGGG - Intergenic
1017637433 6:156456331-156456353 GGGAGGGGAGGAAGGGGAGAAGG - Intergenic
1017991730 6:159494920-159494942 GTGGGGTAGGGAAGGGCAGTGGG - Intergenic
1018025279 6:159800632-159800654 GTGAGGTCAGGAAGGGAAAATGG - Intronic
1018711154 6:166498980-166499002 GTGGGGTGTTGCAGGGCAGAGGG + Intronic
1018734662 6:166678688-166678710 GTGGGGTGAGAAAGGCCAGGTGG + Intronic
1018850610 6:167587833-167587855 GGGGGGTGAGCAAGTGCAGAGGG - Intergenic
1019039701 6:169093698-169093720 GTGTTGTTGTGAAGGGCAGATGG - Intergenic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019833508 7:3357645-3357667 GACTGGTGAGGAAGGGGAGTGGG - Intronic
1020137871 7:5596559-5596581 GTGTGGTGAGGCATGGCCCAGGG - Intronic
1020152746 7:5696158-5696180 ATGTGGTGACGAAGAGCAGTTGG + Intronic
1020693104 7:11382535-11382557 GTGTGGTGTCAAAGGTCAGATGG - Exonic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1022013383 7:26328538-26328560 GTGTAGAGTGGAAGGGAAGAGGG + Intronic
1022039118 7:26563095-26563117 GTGAGGTAAGGAGGGGCAGGAGG - Intergenic
1022104897 7:27190519-27190541 ATGTGGTGAGCTAGGGGAGATGG + Intergenic
1022239053 7:28491092-28491114 GGGTGGTGAGGAAGCGGAGGTGG + Intronic
1022305029 7:29139051-29139073 GTGTGCTGAGAAAAGGTAGAAGG + Intronic
1023328914 7:39091974-39091996 ATGTGAAGAGGAAGGGTAGAAGG + Intronic
1023348553 7:39296427-39296449 GTGAGGAGAGGAAGAGGAGAAGG - Intronic
1023548582 7:41344770-41344792 GTGTGGTGAGGAGGGGCCAGAGG + Intergenic
1023772026 7:43566536-43566558 GTGTGGGGAGGACTGGGAGAAGG + Intergenic
1024050644 7:45620898-45620920 GGGTCCTGAAGAAGGGCAGAGGG - Intronic
1024349495 7:48349334-48349356 TTGAGGGGATGAAGGGCAGAAGG + Intronic
1024479978 7:49852996-49853018 GTGGGGTGAGGAAGAGGAAAGGG - Intronic
1024796353 7:53026459-53026481 GTGGGGTGGGGGAGGGGAGAGGG - Intergenic
1024994273 7:55260264-55260286 GTGAAGGGAGGAAGAGCAGAAGG + Intergenic
1026189628 7:68112961-68112983 GTGTGGTGTGGGAGGGTTGAAGG + Intergenic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026796073 7:73366920-73366942 CTGTGGGGAGGAGGGGCAGCAGG - Intergenic
1027896904 7:84056387-84056409 GTGTGGTGAGGAGAAACAGAAGG + Intronic
1029371010 7:100150657-100150679 GTGATGTGAAGATGGGCAGAAGG + Intronic
1029641754 7:101825188-101825210 GTGTGAATAGGAAGGGAAGATGG - Intronic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030121201 7:106112281-106112303 CGGTGGCGAGGAAGGGCAGGCGG + Intronic
1031024403 7:116664451-116664473 GGGCAGTGAGGAAGGTCAGATGG - Intergenic
1032085913 7:128883927-128883949 GACTGGTGAGGAAGGGCGGCAGG + Intronic
1032163372 7:129527180-129527202 GTGTGGTGGGCAGAGGCAGAAGG - Intergenic
1032319058 7:130868218-130868240 GAGTGGAGACGAAGGGCAGGAGG - Intergenic
1032403350 7:131638706-131638728 GTGGGAAGAGGAAGGGAAGATGG + Intergenic
1032507530 7:132446929-132446951 GTGGGGAGAGGAAGGGAGGATGG - Intronic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1034079413 7:148262554-148262576 GTGACGTGAGGAAGGGCCCAAGG - Intronic
1034277166 7:149829047-149829069 GTGTGGGGTGGCAGGGGAGAAGG - Intergenic
1034398846 7:150848181-150848203 CTGTGCTGAGGAAGGGCAGGTGG - Intronic
1034671856 7:152865107-152865129 TTGTGATGAGAAAGGGCTGATGG + Intergenic
1035028986 7:155845053-155845075 GGGAGGTGAGGAAGGGAAGCAGG - Intergenic
1035063675 7:156089977-156089999 CTGTGGTGTAGAAGGGCTGATGG - Intergenic
1035177041 7:157058892-157058914 CTGTGCTGAGGAAGCTCAGAGGG - Intergenic
1036654627 8:10670226-10670248 GTGTGTAGAGAAAGGGGAGAAGG + Intronic
1036898507 8:12654737-12654759 ATGTGGGCAGGAAGGGCAGGTGG - Intergenic
1037018071 8:13933186-13933208 GTGGTGGGAGGAAGGTCAGAGGG - Intergenic
1037439088 8:18895957-18895979 GTGTGGAGGGGAAGGGGAGTAGG - Intronic
1037950743 8:23017522-23017544 GGGTGATGCGGAAGAGCAGAGGG - Exonic
1040014721 8:42691133-42691155 GTGTGGGGAGGAAGATCAGGAGG - Intergenic
1041249514 8:55920767-55920789 GGGTGGTGGGGAAGGGCAAGGGG - Intronic
1042616650 8:70656881-70656903 GTGTGGTGGGCAAGGGGAGGGGG + Intronic
1043520736 8:81042650-81042672 GGGGGGTGAGGAAGGGAAGGAGG + Intronic
1043912419 8:85878400-85878422 GGGTATTGAGGAGGGGCAGAGGG - Intergenic
1044436742 8:92172878-92172900 TTGTGGAGAGGAAGGACAAAGGG + Intergenic
1045050676 8:98321307-98321329 GTGTAGGAAGGAATGGCAGAGGG + Intergenic
1045130031 8:99140670-99140692 GGAGGGTGAGGAAGGGGAGAAGG - Intronic
1045244584 8:100431827-100431849 GAGAGGGGAGGAAGGGAAGAAGG - Intergenic
1045658008 8:104406651-104406673 AAGTGGTCAGGAAGGGAAGATGG - Intronic
1047415798 8:124663546-124663568 GTGTGGGGAGAAAGGGGAGGTGG - Intronic
1048613387 8:136048455-136048477 GTGTGCTGAGAAACTGCAGAAGG - Intergenic
1048986405 8:139737399-139737421 GGGTGGTGAGGAGCGGCCGAGGG - Intronic
1049015741 8:139918805-139918827 GTTTGGAGAGGGAGGGCAGCTGG - Intronic
1049753476 8:144296935-144296957 GTGCGGTGAGGAGGGGCCCAGGG + Intronic
1050345353 9:4680174-4680196 GTGCTGTCAGGAAGGGGAGATGG - Intronic
1050742729 9:8841046-8841068 GAGTGGTGAGGATGAGAAGATGG + Intronic
1051822669 9:21186093-21186115 ATGTGGGGAGGAAGTGGAGAGGG - Intergenic
1051827670 9:21238495-21238517 ATGTGGGGAGGAAGTGGAGAGGG - Intronic
1052151906 9:25127424-25127446 GAGTGGGGAGGATGGGAAGAGGG + Intergenic
1052324725 9:27205399-27205421 TTTTGGTAAGGAAGGACAGAGGG + Intronic
1052457454 9:28718524-28718546 ATGTTGTGATGAAGGGGAGAAGG - Intergenic
1052484836 9:29083432-29083454 GTGGGGTGAGGGAGGGGGGATGG + Intergenic
1052825149 9:33168627-33168649 GTGAAGTGAGGAAGATCAGAAGG - Intergenic
1053055998 9:34993431-34993453 GTATGGGGAGGAAGGTAAGAGGG + Exonic
1053540145 9:38965255-38965277 GTGTGGAGAAGAGGGGCACATGG - Intergenic
1053804495 9:41787412-41787434 GTGTGGAGATGAGGGGCACATGG - Intergenic
1054140788 9:61528050-61528072 GTGTGGAGATGAGGGGCACATGG + Intergenic
1054625995 9:67398669-67398691 GTGTGGAGATGAGGGGCACATGG + Intergenic
1055428259 9:76217875-76217897 ATGTGGTGTGGAGGGGCAGGAGG - Intronic
1055610637 9:78020737-78020759 GTGGGGCTTGGAAGGGCAGAGGG - Intronic
1055979536 9:81988605-81988627 GAGTGGCAAGGTAGGGCAGAGGG + Intergenic
1056023204 9:82463457-82463479 GTTGGGTGAGGAAGGGGAGAAGG - Intergenic
1056177651 9:84051112-84051134 GTGGGGTGAGGAAGGACAATGGG - Intergenic
1056447411 9:86679120-86679142 GGGTCCTGAAGAAGGGCAGAGGG - Intergenic
1056551927 9:87659619-87659641 ATGTCGTGGGCAAGGGCAGAGGG - Intronic
1057419016 9:94893391-94893413 GAGGGGTCAGGAAGGGCAGGTGG + Intronic
1057931314 9:99195962-99195984 GTGGGAGGAGGAAGAGCAGAGGG - Intergenic
1058507256 9:105678669-105678691 ATGAGGAGTGGAAGGGCAGAGGG + Intergenic
1058594169 9:106597354-106597376 GAGTGGTGAGGAAGGAAGGAAGG + Intergenic
1058694605 9:107548679-107548701 GTGAGCTGAGGAAGGGCTGAGGG - Intergenic
1058845541 9:108954916-108954938 GTGTGGTGAAGAACAACAGATGG - Intronic
1058995603 9:110296084-110296106 GTGTCTTCAGCAAGGGCAGAAGG - Intergenic
1059762699 9:117354130-117354152 GTGTGGTGGGGAAGGGCGGAAGG + Intronic
1059900905 9:118923752-118923774 GTGGGGTGGGGGAGGGGAGAGGG + Intergenic
1059940040 9:119349770-119349792 CTGTGGAGGGGAAGTGCAGAGGG + Intronic
1059958654 9:119544142-119544164 GTGGGGAGGGGAAGGGCAAAAGG + Intergenic
1060239154 9:121888089-121888111 GTCTGGTGAGGAAGGGGAGGGGG - Intronic
1060745020 9:126125742-126125764 GTGCGGTGAGGGAGGGGTGAGGG + Intergenic
1060849349 9:126861124-126861146 GTACGGGGAGGGAGGGCAGATGG + Intronic
1061418379 9:130460460-130460482 GTGTGATGAGGAATGGGAGTGGG + Intronic
1061664108 9:132150322-132150344 GTGAGGGAAGGAAGGGCAGGTGG + Intergenic
1061797864 9:133098761-133098783 CTCTGGTGGGGAGGGGCAGAGGG + Exonic
1061814995 9:133189193-133189215 GCTTGGTGGGGAAGGGCAGAAGG + Intergenic
1061989794 9:134152674-134152696 GGGTGGTGAGGATGGGGGGATGG + Intronic
1062543117 9:137050266-137050288 TTGTGGTGAGTAGGGGCAGGCGG - Exonic
1062562204 9:137146621-137146643 GAGTGGTAAGGAAGGGGAAAGGG - Intronic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297990 X:8169860-8169882 GTGTGGTGAGGGAGGGAGGGAGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186477350 X:9867831-9867853 GTGTGGTGGGGGAAGGCTGATGG + Intronic
1186785803 X:12955163-12955185 GAGGGGTGAGGAAGGGGTGAGGG - Intergenic
1187225788 X:17374930-17374952 GTGTGGGCAGTAAGCGCAGAGGG - Intergenic
1187434317 X:19253157-19253179 GGGTAGTGAGGAAGGTGAGATGG + Intergenic
1187737143 X:22316644-22316666 TTGTGGTGAGGAGGGCGAGATGG - Intergenic
1188645232 X:32558302-32558324 GTATGTAGAGGAAGGCCAGATGG - Intronic
1189579304 X:42388929-42388951 GTGGGGTTGGGAAGGGAAGATGG + Intergenic
1189904058 X:45739499-45739521 GTGTGGGGAGTAAGGGAAAATGG + Intergenic
1189916227 X:45858333-45858355 GTGTATTAAGGAAGGGCATAGGG - Intergenic
1189930661 X:46005686-46005708 GTGTAGTGGGGAGGGGCAGTGGG - Intergenic
1190035319 X:47018186-47018208 GTGAGGAGAGTAAGGGGAGATGG - Intronic
1190172329 X:48121524-48121546 GTGGGGAGGGGAAGGGCAGAGGG + Intergenic
1190177971 X:48167173-48167195 GTGGGGAAGGGAAGGGCAGAGGG + Intergenic
1190180179 X:48185250-48185272 GTGGGGAAGGGAAGGGCAGAGGG - Intergenic
1190189869 X:48268271-48268293 GTGGGGAAGGGAAGGGCAGAGGG + Intronic
1190193194 X:48294473-48294495 GTGGGGAAGGGAAGGGCAGAGGG - Intergenic
1190199163 X:48345453-48345475 GTGGGGAAGGGAAGGGCAGAGGG - Intergenic
1190417956 X:50199758-50199780 GAGGGGAGGGGAAGGGCAGAAGG - Intronic
1190585483 X:51935964-51935986 GTGTGCTGGGGAAGGACAGAAGG - Intergenic
1190658613 X:52634771-52634793 GTGGGGAAGGGAAGGGCAGAGGG + Intergenic
1190665931 X:52695921-52695943 GTGGGGAAGGGAAGGGCAGAGGG - Intronic
1190673487 X:52762489-52762511 GTGGGGAAGGGAAGGGCAGAGGG + Intronic
1190677032 X:52791260-52791282 GTGGGGAAGGGAAGGGCAGAGGG + Intergenic
1190924235 X:54887517-54887539 GTGGGGTGAGGAAGCACAGAGGG - Intergenic
1190942649 X:55057141-55057163 CTGTGGTGGGAAAGGGGAGAGGG + Intergenic
1190981888 X:55463680-55463702 GTCTACTGAGAAAGGGCAGAGGG - Intergenic
1190986810 X:55509500-55509522 GTCTACTGAGAAAGGGCAGAGGG + Intergenic
1192634560 X:72805294-72805316 ATGTGGTGAGGAAGGTCAAGGGG + Intronic
1192647153 X:72915507-72915529 ATGTGGTGAGGAAGGTCAAGGGG - Intronic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1194801859 X:98283671-98283693 GTGTGTAGAGGAAGGAAAGAAGG - Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195609661 X:106851556-106851578 GTGGGGTGGGGGAGGGGAGAGGG - Intronic
1195884550 X:109625216-109625238 GCGTGGTGGGGAAGGGGAGGAGG - Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196196895 X:112846278-112846300 GTGTGGTTGGGAAGGGTGGAAGG - Intergenic
1199427892 X:147724151-147724173 GTGGGGTGAGGAAGAGCATCGGG - Intergenic
1199716610 X:150511489-150511511 GTGTGGTGAGTGAGTGCAGACGG - Intronic
1200056841 X:153466024-153466046 GTGTGGTGGGAAAGGGCTGGTGG + Intronic
1201291019 Y:12421017-12421039 GCTTGGAGAGGATGGGCAGAAGG - Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic