ID: 1145965529

View in Genome Browser
Species Human (GRCh38)
Location 17:28914043-28914065
Sequence CAGGATAGATAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 768}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145965529 Original CRISPR CAGGATAGATAGAAGGAGGA AGG Intronic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900498762 1:2989441-2989463 GAGTATAGATGGATGGAGGATGG - Intergenic
900863044 1:5246367-5246389 AAGGATAGAGGGAGGGAGGAAGG - Intergenic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
900892318 1:5458402-5458424 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
900966230 1:5960632-5960654 CATGACAGGTAGAAGGAGGCTGG + Intronic
901497809 1:9631988-9632010 AAAGAAAGATAGAAGAAGGAAGG - Intergenic
902113182 1:14099959-14099981 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
902255385 1:15185868-15185890 CAGCATGGATAATAGGAGGATGG - Intronic
903331723 1:22600093-22600115 GAGGAAGGAGAGAAGGAGGAAGG + Intronic
903331732 1:22600124-22600146 AAGGAGAGAAGGAAGGAGGAGGG + Intronic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903572217 1:24314383-24314405 AGGGATAGATAGAAGGGAGATGG - Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904824374 1:33265140-33265162 CAGGAGAAATAGAAGTAGGGAGG + Intronic
904939815 1:34157716-34157738 CAGGATAGATAGAGTGAGACAGG - Intronic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
905529235 1:38663451-38663473 TAGGATGGATAGCAGGGGGAAGG + Intergenic
905715738 1:40148171-40148193 CAAAACAGAAAGAAGGAGGAGGG - Intergenic
905885505 1:41489686-41489708 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905885551 1:41489884-41489906 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
907264693 1:53250467-53250489 GAGGAAGGAAAGAAGGAGGAAGG + Intronic
907505888 1:54918074-54918096 GAGGAGAGAGAGATGGAGGAGGG - Intergenic
907594770 1:55709400-55709422 TGGGAAAGATAAAAGGAGGATGG - Intergenic
907864407 1:58385692-58385714 CAGGATGCAAAGCAGGAGGAAGG + Intronic
907907781 1:58799912-58799934 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
907943663 1:59112788-59112810 AAAGATAGATTAAAGGAGGAGGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
909176872 1:72371872-72371894 CAGGATAAATCAAAGCAGGAGGG - Intergenic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909855342 1:80522582-80522604 GAAGATAGAGAGTAGGAGGATGG + Intergenic
909963159 1:81873641-81873663 CATGTTAGATAGCAGGAGGCTGG + Intronic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
910741041 1:90516846-90516868 CATGATAGAGAAAGGGAGGACGG + Intergenic
910964445 1:92794171-92794193 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
911877288 1:103184097-103184119 CATGAAAGATAGAAGGTTGAAGG - Intergenic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
912614453 1:111084127-111084149 CAGGAGAGAGAGAAGCATGAAGG - Intergenic
913705641 1:121419432-121419454 AAGGAAAGAAAAAAGGAGGAAGG - Intergenic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
917193086 1:172439483-172439505 CGGGATAGATGCAAGGATGAAGG - Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917306076 1:173626936-173626958 AAGGAAAGAAAGAGGGAGGAGGG + Intronic
917390971 1:174536366-174536388 AAGGAAAGATAGAAGAAGGGAGG + Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918057047 1:181031174-181031196 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
918757940 1:188360421-188360443 CAGGAGAGATAGAGAGAGGGGGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919424915 1:197417837-197417859 AAGGATAGAAAGAGGGAAGAAGG + Intronic
919545656 1:198914957-198914979 CAGGGTAGCTAGCAGTAGGAGGG - Intergenic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920603576 1:207355358-207355380 GAGGAAAGAGAGAATGAGGATGG + Intronic
920917568 1:210270352-210270374 AGGGATAGATAGAAGGAAGGAGG - Intergenic
921591325 1:217007714-217007736 AAGAAAAGATGGAAGGAGGAAGG - Intronic
921598744 1:217084155-217084177 CAGGAAAGAAAGAGGAAGGAAGG + Intronic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
922661642 1:227435498-227435520 CACGATAGAAAGAGGGTGGATGG + Intergenic
923026332 1:230207367-230207389 AAGGATAGATACAAGGAATAAGG + Intronic
923165282 1:231355694-231355716 CAGCATAGATAAGAGGGGGAAGG + Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
1062833570 10:622244-622266 CAGGAGAGATGGTAGGGGGAGGG + Intronic
1063025946 10:2178852-2178874 GAGGATTGAAGGAAGGAGGAAGG - Intergenic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1063907041 10:10791947-10791969 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
1064294543 10:14066463-14066485 CTGGATAGAGAGAATGAGTAGGG + Intronic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1064587242 10:16851689-16851711 AAGGAAAGATAGAGGGAGGGAGG - Intronic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1065085590 10:22172449-22172471 AAGGATAGATGGTGGGAGGAGGG - Intergenic
1065263833 10:23954616-23954638 CAGGAAAGAAGGAAGGAGGGAGG + Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066106961 10:32164942-32164964 CAAGATGGAATGAAGGAGGATGG - Intergenic
1066803636 10:39219083-39219105 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1067163020 10:43842965-43842987 GAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1067807867 10:49405758-49405780 GAGGAGAGAGAAAAGGAGGAAGG - Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1067990121 10:51202382-51202404 CAGGATAGAATGGTGGAGGATGG - Intronic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068948602 10:62755104-62755126 CAGGAGAGAAGGAAGGAGGGAGG + Intergenic
1069060968 10:63894139-63894161 AAGGAAAGAGAGGAGGAGGAAGG - Intergenic
1069138390 10:64794018-64794040 CAAGAAAGAGAGAAGGAAGAAGG - Intergenic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069404108 10:68079687-68079709 CAGGATAGATAGAAACATGGGGG + Intergenic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070427719 10:76305415-76305437 CATGAAAGAAAGAAAGAGGAAGG - Intronic
1070628568 10:78068221-78068243 GGGGACAGACAGAAGGAGGATGG + Intergenic
1070661820 10:78312169-78312191 CAGGACAGATTGAAAGAGGAGGG + Intergenic
1071161648 10:82753528-82753550 GAGGAAAGAAAGAAGGAGGGAGG - Intronic
1071468456 10:85961733-85961755 AAGGAAAGATAGAAGGAGGATGG - Intronic
1071468508 10:85962014-85962036 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1071877757 10:89861295-89861317 AAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1072815773 10:98507657-98507679 AAGGATAGAGAGGGGGAGGACGG - Intronic
1073018296 10:100419603-100419625 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1073358081 10:102872852-102872874 CAGGATAGATGGCAGCAAGAAGG - Intronic
1073785687 10:106886599-106886621 CAGGAAAGAAGGAAGAAGGATGG + Intronic
1074135543 10:110623334-110623356 AAGGACAGAGAGTAGGAGGAGGG - Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1075965192 10:126605257-126605279 AAGGAAAGATGGAAGCAGGAAGG + Intronic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076449686 10:130548372-130548394 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
1076676726 10:132150941-132150963 GATGATAGATAGATGGAGGATGG - Intronic
1076985572 11:233583-233605 CAGGATAGCAAGAACGAGCATGG + Intronic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077280623 11:1743527-1743549 AATGATAGATGGATGGAGGATGG + Intronic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1078024228 11:7679546-7679568 CAGGAGAGAGAGAATGAGGGAGG - Intergenic
1078731165 11:13975274-13975296 CAGTAAAGATAAAAGGATGAGGG + Intronic
1079292436 11:19200477-19200499 AAGGAAAGAGAGAAGGAGGGAGG - Intronic
1079736700 11:24006329-24006351 CAGGAAAGAGAGAACAAGGAAGG + Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080153555 11:29080112-29080134 AAGGATAGAGGGTAGGAGGAGGG + Intergenic
1080156617 11:29118704-29118726 AAGGAAGGATGGAAGGAGGAAGG + Intergenic
1080466692 11:32504094-32504116 AAGGAAGGAAAGAAGGAGGAAGG + Intergenic
1080711983 11:34757643-34757665 CAGGATGGGTAGTAGGAGAATGG + Intergenic
1080826923 11:35856311-35856333 TAGGATGGATGGAGGGAGGATGG + Intergenic
1080883568 11:36345201-36345223 CAGGATAGGTAGAGGAAGAAGGG + Intronic
1081282329 11:41225093-41225115 GAGGATAGAGAGTAGAAGGATGG + Intronic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081905885 11:46669605-46669627 CAGGGAAGATAGAAGGTGGTAGG - Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1082147664 11:48689817-48689839 CAGGATAGATAGAAACTAGAAGG + Intergenic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082589788 11:54991827-54991849 CAGGATAGATAGAAACTAGAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083028035 11:59566952-59566974 CAGGATATATAGAAGAGGTAAGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1084363100 11:68681883-68681905 CAAGAAAGAAAGAAGGAGGGAGG - Intergenic
1084475684 11:69387322-69387344 CAGGATAGATAGAAGTTTGAAGG - Intergenic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1084697479 11:70764316-70764338 ATAGATGGATAGAAGGAGGAGGG - Intronic
1084773443 11:71358958-71358980 GATGATAGATAGAAAGATGATGG - Intergenic
1085326604 11:75611132-75611154 AAGGATAGAGGGAAGGAGGGAGG - Intronic
1086031845 11:82368715-82368737 GAGGAGGGATAGAAGAAGGAGGG + Intergenic
1086432608 11:86749698-86749720 CATGATAGAGTGAAGGAGAAGGG + Intergenic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1087817916 11:102679380-102679402 CAAGAGAGAGAGTAGGAGGAGGG + Intergenic
1088649147 11:111942109-111942131 CAGGATAGAAAAAAGAAGGTTGG - Intronic
1089064336 11:115651033-115651055 CAGGATAGAAAAAAGGGGCAGGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089687617 11:120166755-120166777 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1090126538 11:124091911-124091933 AAAGAAAGATGGAAGGAGGAAGG - Intergenic
1090145132 11:124313223-124313245 AAGGAAAGAAAGAAGGAGGGAGG + Intergenic
1090827868 11:130400570-130400592 CAGGAAAGATGGATGGGGGAAGG + Intergenic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1091296417 11:134477008-134477030 TAGGACAGAGAGGAGGAGGAGGG + Intergenic
1091665924 12:2418542-2418564 GAGGAGAGAGAGGAGGAGGAGGG + Intronic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092597903 12:10027562-10027584 AAGGAAAGAAGGAAGGAGGAAGG - Intergenic
1092736696 12:11589485-11589507 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1092778600 12:11965098-11965120 AAGGAAAGATAGAAGAAGAATGG - Intergenic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093734592 12:22606239-22606261 AAGGAGAGAAGGAAGGAGGAAGG - Intergenic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094572728 12:31655561-31655583 CAGGATAGGTAGAAGAATAATGG - Intronic
1094615134 12:32029577-32029599 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1094800261 12:34024845-34024867 GAGGATACAGAGAAGGAGCAGGG + Intronic
1094863129 12:34493860-34493882 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1095288680 12:40448686-40448708 AAGGAAGGAAAGAAGGAGGAAGG - Intronic
1095695481 12:45139013-45139035 CATGAGAGAAAGGAGGAGGAAGG - Intergenic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1096197063 12:49655603-49655625 AAGGAGGGAAAGAAGGAGGAAGG + Intronic
1096449952 12:51730887-51730909 GAGGATAGAAAGTAGAAGGATGG - Intronic
1096754727 12:53789684-53789706 CAGCATTGAAAGATGGAGGAAGG - Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097960927 12:65531420-65531442 CAGAAAAGATAGAAGGAATAGGG + Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099876219 12:88409301-88409323 GAGTATAGAAAGAAGGAGAATGG + Intergenic
1100011657 12:89961229-89961251 GAGGATAGATGGAGGGAGAAAGG - Intergenic
1100225560 12:92552380-92552402 GAGTATAGATAGGTGGAGGAAGG - Intergenic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1102219203 12:111182981-111183003 CCGGGCAGATTGAAGGAGGAAGG - Intronic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102559055 12:113749195-113749217 CAGGAGAGATGGAAAGAGGCAGG + Intergenic
1102603886 12:114053968-114053990 CATGAAAGATAGTAGGAAGAAGG - Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103017346 12:117505782-117505804 CAGCATAGACAGAAGCAAGAAGG - Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103171700 12:118825889-118825911 AAGGAAAGAGAGAAGAAGGAAGG + Intergenic
1103245768 12:119455888-119455910 AAGGAAAGAAAGAAGGAGGGAGG + Intronic
1104064711 12:125297196-125297218 CAGGGTGGATGGGAGGAGGAGGG + Intronic
1104172519 12:126295900-126295922 AAGGAAAGAGAGAAGGAGGGAGG + Intergenic
1104485140 12:129144877-129144899 CAGGATAGATAATAGGTGAATGG - Intronic
1105898572 13:24738845-24738867 CAGGTTAGATAGGAGGAGATTGG + Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106442063 13:29784226-29784248 CGGGAAAGAAAGAGGGAGGATGG + Intronic
1106786009 13:33108686-33108708 CCGGATGGATGGAAGGAGGGAGG + Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107315471 13:39126972-39126994 CAGGATATATAGAAGCCAGATGG + Intergenic
1107892930 13:44930196-44930218 CAGGTTAGAAAGTGGGAGGAGGG - Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1109642862 13:65213098-65213120 AAGGATGGAAAGAGGGAGGAAGG + Intergenic
1109917512 13:69010989-69011011 AAGGATAGAAAGAAGGCAGAGGG - Intergenic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1112099476 13:96171296-96171318 CAGGACAGATGCAAGGATGAGGG - Intronic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1114337616 14:21708340-21708362 AAAGAAAGAAAGAAGGAGGATGG - Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1116408724 14:44598306-44598328 CAAGAGAGAAAGAATGAGGAGGG + Intergenic
1116799220 14:49425802-49425824 CATTATAGAAAGATGGAGGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117243169 14:53856047-53856069 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117983279 14:61363029-61363051 CGGGTGAGAGAGAAGGAGGAAGG + Intronic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118381613 14:65222267-65222289 CAGGATAGTTTGAGGGAGAAAGG + Intergenic
1119931448 14:78551632-78551654 CAGGAAAGAAGGAAGGAGAAAGG - Intronic
1120677908 14:87443410-87443432 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1121059302 14:90889862-90889884 CAGTACAGAAAGAAGGAGCAAGG - Intronic
1121250078 14:92492896-92492918 AAGGAAAGATAGAAGGATCAGGG + Intronic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122779051 14:104136002-104136024 CAGGACAGATTGGAGGGGGAAGG + Intergenic
1123083207 14:105705777-105705799 GAGGATTGGTAGACGGAGGATGG - Intergenic
1123189252 14:106552049-106552071 CAGGAGAGAGAGAAAGAGCAAGG - Intergenic
1123726176 15:23103702-23103724 TAGGATACTTAGAAGTAGGATGG + Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124407392 15:29404635-29404657 CAGGATAGATACTGCGAGGAGGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125856319 15:42953263-42953285 CAGCATAGATGGGAGGAGCATGG - Intronic
1125963040 15:43848518-43848540 CAGGAAAAATAGAAGAAGTAGGG + Intronic
1125969139 15:43897912-43897934 CAGGAAAGAGAGAATGAGGGGGG - Intronic
1126212656 15:46117606-46117628 CAGGATAGATATATGCATGAAGG + Intergenic
1126423198 15:48497748-48497770 CAGGGTAGATGGAAGAAAGAGGG - Intronic
1126841774 15:52724411-52724433 CTGGATTGGTAGAAGGAGAAAGG - Intergenic
1126940511 15:53760355-53760377 GAAGATAGAGAGTAGGAGGATGG - Intronic
1127660941 15:61099471-61099493 CAGGAAAGATACAAGGAGAATGG + Intronic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1128602297 15:69007437-69007459 CAGGATGGCTATAAAGAGGAGGG + Intronic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1129175604 15:73837763-73837785 CAGGATAGAGACCAGAAGGATGG + Intergenic
1129248953 15:74297726-74297748 CAGGAAAGAAAGAAGAGGGAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1133545805 16:6805388-6805410 GAGGATAGAGGGTAGGAGGAGGG + Intronic
1134105872 16:11485707-11485729 AAGAATAGATAGAAGGAGAGGGG - Intronic
1134106162 16:11487037-11487059 GTGGATAGATGGAAGGAGGGAGG + Intronic
1134234655 16:12455824-12455846 CAGGAAAGAAGGAAGGAGGGAGG - Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134845331 16:17435206-17435228 CAGGACAGATCCCAGGAGGAAGG - Intronic
1135491139 16:22910787-22910809 CAGGAAAGGTAGAAGGGGAAGGG + Intronic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135892631 16:26371420-26371442 AAGGAAAGATAAAATGAGGAGGG + Intergenic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137858122 16:51817341-51817363 GAGGATGGAGGGAAGGAGGATGG - Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138802404 16:60049281-60049303 CATGTTAGCTGGAAGGAGGAGGG - Intergenic
1139802589 16:69535620-69535642 TAGGATAGAGGGAAGGAGGAGGG + Intergenic
1140137700 16:72222391-72222413 AATAAGAGATAGAAGGAGGAAGG - Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140694805 16:77522087-77522109 CAGGTGAGATAGAAAAAGGAAGG - Intergenic
1140832803 16:78767073-78767095 AAGGAGAGAGAGAAGGAGGGAGG - Intronic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141391323 16:83667070-83667092 AAGGATGGATAGATGGATGATGG + Intronic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142928344 17:3260422-3260444 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144728573 17:17513992-17514014 GAGGATAGATGGATGGAGGAAGG - Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1145978737 17:28999103-28999125 AAGGATGGATGGATGGAGGATGG + Intronic
1147193362 17:38749396-38749418 CAGGAGGGAGAGAACGAGGAGGG + Exonic
1147305934 17:39564417-39564439 CAGGATTGGTGGTAGGAGGAAGG - Intronic
1148716648 17:49720532-49720554 GAAGATATATACAAGGAGGATGG + Intronic
1148756633 17:49976536-49976558 AAGGATGGATAGAAGGAGAGGGG - Intergenic
1149016017 17:51909151-51909173 CAGGTGAGATAGAAGGTGAAAGG + Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1150269008 17:63850435-63850457 CAAGAAAGAAAGAAGGAGGGAGG + Intergenic
1150541356 17:66103376-66103398 GAGGATAGAAAGAAAGAAGAGGG + Intronic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151133909 17:71926625-71926647 AAGGATAGATAGTAGAAAGAGGG - Intergenic
1151182664 17:72340864-72340886 CAGTTTAGATGGGAGGAGGATGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152006655 17:77686339-77686361 TGGGATAGATAGATGGAGGAAGG - Intergenic
1152037275 17:77881123-77881145 CAGGATAGGAGGATGGAGGATGG + Intergenic
1152181583 17:78825525-78825547 CAGGATTGCTGGAAAGAGGAGGG - Intronic
1152398917 17:80052176-80052198 CAGGATAGATATATAGAGAAAGG + Intronic
1153118185 18:1686656-1686678 CTTGATAGATAGAAGTATGAAGG - Intergenic
1153568203 18:6441863-6441885 AAGGAAAGAAAGAAGAAGGAAGG - Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1155081189 18:22411607-22411629 CAGGAGAGCTAGAAGGAAGCTGG - Intergenic
1155354523 18:24938430-24938452 TACGAAAGATCGAAGGAGGAAGG - Intergenic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1155728962 18:29127916-29127938 CAGGAGAGAGAGAAGGCGAAGGG + Intergenic
1156463801 18:37336221-37336243 CAGGATAGAGAAAAGGAGAGAGG - Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156857826 18:41803026-41803048 AAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1160093060 18:75845287-75845309 GATGATAGATGGAAAGAGGAAGG + Intergenic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162104710 19:8363444-8363466 AAGGAAAGAGAGAAAGAGGAAGG - Intronic
1162180783 19:8867388-8867410 AAGGATAGATGGATGGATGATGG + Intronic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1163188108 19:15653793-15653815 CAGGACAGAAAGGAGGAGAAGGG + Intronic
1163216783 19:15885056-15885078 CAGGACAGAAAGGAGGAGAAGGG - Intronic
1163273404 19:16267623-16267645 CAGGTTGGATGGGAGGAGGAGGG + Intergenic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163442691 19:17329633-17329655 CAGGAGAGAAGGATGGAGGAGGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164718159 19:30408750-30408772 AAGGATAGATGGATGGATGATGG - Intronic
1164724798 19:30458862-30458884 CAGGAGAGATGGGAGGTGGAAGG - Intronic
1164937075 19:32223361-32223383 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1164937087 19:32223404-32223426 AAGGATAGAGGGAAGGAGGGAGG + Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165098359 19:33422781-33422803 ATGGATAGATAGAGGGAGGGAGG - Intronic
1165378158 19:35458605-35458627 GATGATAGATAGATGGGGGAAGG + Intergenic
1165527050 19:36364949-36364971 AAAGAAAGAAAGAAGGAGGAAGG - Intronic
1165991152 19:39814973-39814995 CAGAATAGAGTCAAGGAGGAAGG + Intergenic
1166136033 19:40777911-40777933 CAGGATTGACAGAAAGAGGCTGG - Intronic
1166329581 19:42070216-42070238 CAGGAGAGAGAGAAGAGGGAGGG + Intronic
1166546750 19:43638884-43638906 AGGGATAGAGAGAGGGAGGAAGG + Intronic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1166931433 19:46303841-46303863 CGGGAAAGAGAAAAGGAGGACGG - Intronic
1167126175 19:47550279-47550301 CAGGAAGGAAGGAAGGAGGAAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167608258 19:50493209-50493231 GAGGAGAGGTAGAAGGAGAATGG + Intergenic
1167619225 19:50551870-50551892 AAGGAGAGAAAGAAGGAGGGAGG - Intronic
1167801846 19:51748173-51748195 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1168356953 19:55706615-55706637 CAGGAAAGAGAGAAAAAGGAGGG + Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925683889 2:6451978-6452000 CAGGATAAATAGGAGGACAAAGG + Intergenic
925919994 2:8631879-8631901 CAGGTCAGCTAGAAGGAGGGGGG + Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926818365 2:16824240-16824262 AAGGAGAGATAGAAGAAGGAAGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927461925 2:23306753-23306775 CAGGTTACATACAAGGATGAAGG + Intergenic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928924673 2:36565573-36565595 GAGGTCAGGTAGAAGGAGGAGGG - Intronic
929013223 2:37468629-37468651 CATGATAGATAGATGATGGATGG - Intergenic
929336664 2:40756438-40756460 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
929384965 2:41395662-41395684 CAGGAGAGAAAGAAAGAGCAAGG + Intergenic
929430454 2:41881992-41882014 AAGGAAAGAGAGAAGGATGATGG - Intergenic
929448952 2:42023914-42023936 CAGAAAAGAAAGAATGAGGAAGG + Intergenic
929865684 2:45715494-45715516 CTGGATAGATGGAAGCAAGAGGG - Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930871773 2:56178409-56178431 GAGGAAAGAAAGAAGGGGGAAGG - Intergenic
931854634 2:66289010-66289032 ATGGATAGAGAGTAGGAGGATGG - Intergenic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933313953 2:80693602-80693624 CAAGAAGAATAGAAGGAGGAAGG + Intergenic
934037586 2:88101128-88101150 CAGGACAGCTGGAAGAAGGAGGG + Intronic
934263651 2:91498371-91498393 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935626659 2:105177269-105177291 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
935855343 2:107267338-107267360 TAGGAGAGATAGAAGGGGGAAGG + Intergenic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936461333 2:112715587-112715609 CAGGATAGCAATAAGGAGGCTGG + Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
937372428 2:121309313-121309335 CAGGAAAGAAGGAAGGAGGGAGG + Intergenic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939854236 2:147338331-147338353 CAAGATAGAAAGAAGGTAGAAGG - Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940115484 2:150204076-150204098 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
940537407 2:154962851-154962873 TAGGATAGATAAAATGGGGAAGG + Intergenic
940599125 2:155835213-155835235 AAGGAGAGATTGAAGGAAGAAGG + Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941282283 2:163567922-163567944 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941344613 2:164352203-164352225 CTGGATAGATAGTAGGAGAGAGG - Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942365620 2:175223187-175223209 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
942409896 2:175697964-175697986 AAAGATGGATAGAAGGAAGATGG + Intergenic
942627948 2:177923474-177923496 CAGCTGAGATAAAAGGAGGATGG - Intronic
942831373 2:180240083-180240105 GTGGATTGATAGAAGGAGCATGG + Intergenic
942884242 2:180903007-180903029 CAGGAAAGTTAGGAGAAGGAGGG - Intergenic
943499362 2:188667438-188667460 CATGATAGAAAGAAGCAGGCTGG - Intergenic
944850445 2:203713943-203713965 TAGGAAAGAAAGGAGGAGGAGGG + Intronic
945923064 2:215776139-215776161 CAGGGCAGATTAAAGGAGGAAGG + Intergenic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946510788 2:220353815-220353837 CAGGATAGATCTATGGAGGTGGG + Intergenic
946523985 2:220497801-220497823 CAGGATTGAAAGAACCAGGAAGG + Intergenic
946644257 2:221816319-221816341 CAGGAGAGAGAAAAAGAGGAGGG - Intergenic
946832654 2:223741839-223741861 GAGGAAAGAGAGGAGGAGGAAGG - Intergenic
946906972 2:224426841-224426863 CAGGAAAGAGAGAAAGAGAAGGG - Intergenic
946971627 2:225099290-225099312 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
947219290 2:227777735-227777757 AAGGAAAGAAAGAAGGTGGAAGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948570879 2:238916472-238916494 AGGGAAAGAAAGAAGGAGGAGGG + Intergenic
948784637 2:240346043-240346065 GAGGGTCGATAGAAGAAGGAAGG - Intergenic
1168973174 20:1944933-1944955 GAGGATAGATGGATGGAAGAAGG + Intergenic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169211089 20:3766728-3766750 CAGGATGGATAGAATGTGGGGGG + Intronic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170496348 20:16929062-16929084 CAGGAGAGAGAGAAGAATGAAGG - Intergenic
1171116812 20:22531831-22531853 GAGGAGAGAGAAAAGGAGGAAGG + Intergenic
1172360528 20:34309847-34309869 CAGGACAGAAGGAAGGAGGGAGG + Intronic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175305302 20:57971789-57971811 AAGGATGGATGGATGGAGGATGG + Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175663463 20:60837642-60837664 CAGGATAGAAAGAAGTAAGGAGG + Intergenic
1175717139 20:61262766-61262788 GAGGAGAGAGGGAAGGAGGAAGG - Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175983945 20:62755065-62755087 AAGGATAGATGGAAGGATGGAGG - Intronic
1175983974 20:62755157-62755179 GTGGAGGGATAGAAGGAGGAAGG - Intronic
1177251700 21:18599873-18599895 TAGGATAGAAAGAGGAAGGAAGG - Intergenic
1178163945 21:29950273-29950295 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1178412953 21:32380879-32380901 CAGGATAGAAAGATGTAGAATGG - Intronic
1179136099 21:38681353-38681375 CAGGATCGAGAGAAGGGGGGAGG - Intergenic
1179141139 21:38726530-38726552 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179623673 21:42634925-42634947 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623729 21:42635365-42635387 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623741 21:42635471-42635493 ATGGATGGATAGAAGGATGATGG - Intergenic
1180750497 22:18121218-18121240 CAGGAAAGAAAAAAGGAGGGTGG - Intronic
1181106318 22:20577841-20577863 CAGGATTTATGGAAAGAGGAAGG + Intronic
1182048511 22:27295766-27295788 TAGGAGAGAGGGAAGGAGGAAGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183487583 22:38097701-38097723 CAGGAGAGAGGGGAGGAGGATGG + Intronic
1183539667 22:38422857-38422879 CAGGATGGAGAGAATGAAGAGGG - Intergenic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1184318084 22:43714331-43714353 AAGGAAGGATAGAAGGAGGAAGG + Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
950237672 3:11337719-11337741 GAGGAAAGATTGCAGGAGGAAGG - Intronic
951035161 3:17925046-17925068 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
954276994 3:49548823-49548845 CAGGAAAGATAGAATGGGGTAGG - Intergenic
954354244 3:50071751-50071773 CTGGATAGCTAGGAGGAGAAGGG + Intronic
954670863 3:52290737-52290759 CCAGATAGATAGAGGGAGGCAGG - Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603541 3:60673993-60674015 GAGGATAGAGAGAATGAGGGAGG - Intronic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956241428 3:67134991-67135013 AAGGATGGATAGAGGGAGGCAGG - Intergenic
956643374 3:71435217-71435239 CAGGAAAGAAGGAAGGAAGAAGG + Intronic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956796346 3:72722130-72722152 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
956924284 3:73966978-73967000 CAGAATAGATGAAAGCAGGAGGG - Intergenic
957178286 3:76841500-76841522 CAGGAAAAATAAAAGGGGGAGGG - Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958458309 3:94361175-94361197 CAGCCTACATAGCAGGAGGAAGG + Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959416444 3:106080987-106081009 GAGGATAGAGAGTGGGAGGAGGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959962898 3:112320749-112320771 CAGGAAAGAAAGAAAGAAGAAGG + Intergenic
960080443 3:113534579-113534601 CACGCTAGATAGAAAGAGGCTGG - Intronic
960954536 3:123022615-123022637 CAGGAGAGAAAGCAGAAGGAGGG - Intronic
961027750 3:123574956-123574978 CAGGATAGAATGAAGTGGGAAGG - Intronic
961149446 3:124624688-124624710 GTAGATAGATAGAAGGAGGCAGG + Intronic
961492930 3:127267772-127267794 CAGGATAGCTTGAATGGGGAAGG - Intergenic
962015392 3:131434274-131434296 AAGGATGGATGGAAGGAAGAAGG + Intergenic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962959147 3:140293878-140293900 TAGGAAAGGTGGAAGGAGGATGG - Intronic
963681353 3:148381822-148381844 CAGCAAAGATAGCAGGAGGCAGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964458667 3:156897047-156897069 GAGGATAGAGGGTAGGAGGAAGG + Intronic
964640748 3:158907606-158907628 CATGAAAGATAAAGGGAGGATGG - Intergenic
964738597 3:159942141-159942163 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
964804742 3:160596348-160596370 CAGGATAGGAACAATGAGGAAGG + Intergenic
965726424 3:171721303-171721325 AAGGATAGAAAGAAAGAGCAAGG + Intronic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
967094581 3:186166658-186166680 AAAGACAGAGAGAAGGAGGAGGG + Intronic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969220600 4:5756152-5756174 CAGGTTAGAAAGAAGGATGTTGG - Intronic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
969960841 4:10943547-10943569 CAGGAGGGGTAGAAGGAAGAGGG - Intergenic
969991512 4:11268789-11268811 CAGGATGGAAAGAAGGGGTAGGG - Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971865169 4:32160513-32160535 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
971941779 4:33224773-33224795 CAGGAGAGATAGAGAGAGAAAGG - Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
972648726 4:40994855-40994877 AAGGAGAGAGAGAAGGAGGGAGG + Intronic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974491963 4:62575926-62575948 AAGGAAAGAAGGAAGGAGGAAGG - Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
974858897 4:67495939-67495961 CAGCAGAGATTGAAGGAGAAGGG - Intronic
975382131 4:73713253-73713275 AAGGATAGCTAGAAGGAGAGAGG + Intergenic
975538056 4:75472677-75472699 CAGAATAGCTGGAAGGAGGTGGG + Intergenic
975695416 4:77008074-77008096 CAGGCTAGCTAGAAGGAGGCAGG + Intronic
975759426 4:77604340-77604362 TGCGATAGACAGAAGGAGGAAGG - Intronic
976173332 4:82326888-82326910 CAGTATCCATGGAAGGAGGAGGG - Intergenic
977148789 4:93481875-93481897 CAGGCTTGATGGAGGGAGGAAGG + Intronic
977166703 4:93708765-93708787 CAGGAAAGAAGGAAGGAAGAAGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
977504427 4:97883912-97883934 CAGGATAAATAGGAAAAGGAAGG + Intronic
977700911 4:100021749-100021771 GAGGAAAGAAAGAAGGAAGAGGG - Intergenic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
978693795 4:111550447-111550469 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
978703199 4:111674252-111674274 CAAGATAGCTAGAAGAAGGCTGG + Intergenic
979111253 4:116761085-116761107 CAGGAGAGGTGGAAGGAGTAGGG - Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
984535487 4:180969685-180969707 GAGAATAGATAGAAGGAGTAAGG + Intergenic
984591150 4:181619061-181619083 CAGCAGAGATTGAAGCAGGAAGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984712231 4:182895506-182895528 CAGGTTCGAGAGAGGGAGGAAGG - Intronic
984716106 4:182926729-182926751 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
986225411 5:5807359-5807381 AAGGAAAGATGGCAGGAGGAGGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987129213 5:14845256-14845278 CAGGACAGATGGAAGAAAGACGG - Intronic
987368115 5:17168228-17168250 CAGGCTAGATAGAAGCAGATAGG + Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987549014 5:19353820-19353842 CAGGAAGGAAGGAAGGAGGAAGG + Intergenic
987593591 5:19965705-19965727 CAGGTTACATTTAAGGAGGAAGG + Intronic
987869184 5:23591152-23591174 TAGGATAGATAGATGATGGATGG + Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
988580012 5:32460632-32460654 CAGGACAGAGAGAAAGAGCAGGG + Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
988893354 5:35644683-35644705 CAGGATGGAGAAAAGGAGCAGGG - Intronic
989214271 5:38888027-38888049 CAAGAAAGAAGGAAGGAGGAAGG + Intronic
989747139 5:44842766-44842788 CAGGAGAGATGGAAGGATGAAGG + Intergenic
989967219 5:50478598-50478620 CAGGTTTTATAGAAGGGGGAAGG + Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990755424 5:59064108-59064130 AAGGAAAGAGAGAAGGAGGGAGG + Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991974782 5:72175048-72175070 GAGGAAAGATAGAAGGAAGGAGG - Intronic
992552588 5:77873361-77873383 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
993407526 5:87529882-87529904 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
993430193 5:87823355-87823377 CAAGAGAGAGAGAAAGAGGAAGG + Intergenic
993592197 5:89808050-89808072 CATGAGACATAGAGGGAGGAGGG - Intergenic
993622386 5:90184016-90184038 CATGAAGGAAAGAAGGAGGAAGG + Intergenic
994307645 5:98226380-98226402 TAGGAAAGAAAGAAGAAGGAAGG + Intergenic
994728057 5:103459716-103459738 CAGGACAGATATACTGAGGATGG + Intergenic
994869812 5:105333365-105333387 CAAGATAGAGAGCAGAAGGATGG - Intergenic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
995996318 5:118304811-118304833 AAGGAGAGATGGAAGGAGGAAGG + Intergenic
996438731 5:123465086-123465108 CAAAAAAGATAGAAGGAGGATGG + Intergenic
996479081 5:123952952-123952974 GAGGTGAGATATAAGGAGGAGGG + Intergenic
996700842 5:126448568-126448590 CCATATAGATGGAAGGAGGAGGG + Intronic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997628413 5:135347492-135347514 CAGGACAGGTAGAGGCAGGAGGG - Intronic
997751076 5:136346444-136346466 CAGAACAGATAAAAGGAGGGAGG - Intronic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002563926 5:180099691-180099713 CAGGATGGGTATCAGGAGGATGG - Intergenic
1003031488 6:2605000-2605022 CAGGAAAGATAGAAGCAGAATGG + Intergenic
1003031508 6:2605254-2605276 TAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1003328421 6:5110000-5110022 CAGGAAAGATAGAAGGCAGGAGG - Intronic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1003941777 6:11035434-11035456 AAGGATGGATAGAAGGAGCATGG - Intronic
1004013255 6:11709479-11709501 CAAGAGAGATGGGAGGAGGAGGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004635985 6:17468189-17468211 CAGGATAGATGGAAGGGTGAAGG - Intronic
1005120096 6:22380120-22380142 GGGGATACAGAGAAGGAGGAGGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005395682 6:25379457-25379479 TTGGATAGATGGAAGAAGGAGGG + Intronic
1005885931 6:30097765-30097787 TAAGATGGATAGAAGGATGAAGG + Intergenic
1007039379 6:38707603-38707625 GAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1007054967 6:38874112-38874134 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007054972 6:38874155-38874177 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007130303 6:39466233-39466255 AAGGAGAGAAGGAAGGAGGAAGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007263771 6:40582197-40582219 CAGGAAACATGGAAGGAAGAGGG + Intronic
1007989905 6:46244304-46244326 AAGGAAAGAAAGAGGGAGGAAGG - Intronic
1008326419 6:50187521-50187543 CAGGAGAGAGAAAAGGAGGGAGG - Intergenic
1008362314 6:50635472-50635494 GAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1009261241 6:61491918-61491940 CAGGATAGAAACTAGCAGGAAGG - Intergenic
1009527569 6:64765697-64765719 CAGGAGAGAAAGAAAGAGCAAGG + Intronic
1009864901 6:69385364-69385386 AAGGATAGATGGATGGAGGGAGG + Intronic
1009948359 6:70366066-70366088 AAGGAGGGATAGAGGGAGGAAGG + Intergenic
1010704290 6:79089600-79089622 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
1010974406 6:82296238-82296260 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1011949339 6:92944830-92944852 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012431600 6:99169984-99170006 CAGAGTAGATAGAATAAGGAGGG - Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1013080601 6:106808659-106808681 CAGAAAAGATAGAAGGGGAAAGG - Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1014008911 6:116454116-116454138 TAGGATAGATAGGAGGACCAGGG + Intergenic
1014041295 6:116829488-116829510 CAGGAAAAATAAAAGCAGGATGG - Intergenic
1014505546 6:122249649-122249671 TAGGAAAGAAAGAAGGAAGATGG + Intergenic
1014775493 6:125504350-125504372 TAGGATGGATAGAAGCAAGATGG - Intergenic
1015059936 6:128951017-128951039 CAGGATAGAGAAGGGGAGGAAGG + Intronic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016199625 6:141392837-141392859 GAAGAAAGAGAGAAGGAGGAAGG - Intergenic
1016451971 6:144192607-144192629 TAAGATAGACAGAAGGAGCAGGG - Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017563413 6:155658159-155658181 CAGCCTTGATAGAAGGAGGGTGG + Intergenic
1017747280 6:157458161-157458183 CAGGGTAGGTAGAAGAAGGGAGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1019151738 6:170010972-170010994 AAGGACAGAGGGAAGGAGGAGGG + Intergenic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019517529 7:1446466-1446488 GAGGATAGAGAGGAGAAGGAAGG + Intronic
1019549258 7:1594055-1594077 GAGGATAGATGGAGGGAGGGAGG - Intergenic
1019549614 7:1595416-1595438 GAGGATGGATGGAGGGAGGATGG - Intergenic
1020731139 7:11882442-11882464 AAGGATGGAGAGAAGGAGAAGGG - Intergenic
1021037871 7:15823396-15823418 CAGGACAGATAAAAAGAGCAAGG - Intergenic
1021320292 7:19201572-19201594 CATGATAGATAAAAGGATGTGGG + Intergenic
1021476678 7:21069603-21069625 CAGTCTAGATAGTAGGATGAAGG + Intergenic
1022216061 7:28262787-28262809 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022621251 7:31986728-31986750 CAGGGTCGATGGAAGGAGCATGG + Intronic
1023244656 7:38188354-38188376 CCAGGTAGATACAAGGAGGAAGG - Intronic
1023427093 7:40049213-40049235 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1023447212 7:40244269-40244291 AAAGATAGATAGAATGTGGATGG + Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1025599644 7:62979633-62979655 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1026023738 7:66729467-66729489 GAGGATGGAGAGCAGGAGGAAGG - Intronic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026178210 7:68016312-68016334 AAGGAAAGATGGAGGGAGGAAGG - Intergenic
1026275397 7:68871784-68871806 ATGGATAGATAGACGGATGATGG - Intergenic
1026330471 7:69347915-69347937 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
1026497727 7:70918317-70918339 CAGTATAGATAAGTGGAGGATGG + Intergenic
1026499309 7:70929630-70929652 CGGGATAGAGAGTAGAAGGATGG - Intergenic
1026638887 7:72107031-72107053 AAAGAAAGAAAGAAGGAGGAAGG + Intronic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1027624545 7:80530381-80530403 CAGAATTGATAGGAGGAGAAAGG + Intronic
1028262785 7:88685654-88685676 AAAGAAAGAAAGAAGGAGGATGG - Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1030377810 7:108773696-108773718 AAGGAGAGATGGAAGAAGGAAGG - Intergenic
1030562483 7:111107194-111107216 GAGGAAAGAGAGAAGGAAGAAGG - Intronic
1030677976 7:112404836-112404858 CATGAAAGATAAAGGGAGGAGGG + Intergenic
1030754805 7:113274177-113274199 CAGGAAAGAGAGAATGAGCAAGG + Intergenic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031957066 7:127953421-127953443 CAGGAAAAATAGAAGTAGGTGGG - Intronic
1032089559 7:128904423-128904445 CAGGAGAGAGAGAAAGAGGGAGG - Intronic
1032725206 7:134584528-134584550 AAGGATGGATAGATGGAGGGAGG + Intergenic
1032841768 7:135719865-135719887 ATAGATAGATAGAAAGAGGAAGG + Intronic
1033399948 7:141013203-141013225 CAAGATAGCCAGGAGGAGGAAGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034721555 7:153298855-153298877 CAGGATAAATAGAAGACAGAAGG - Intergenic
1034732767 7:153402197-153402219 CATGATAGAAAGAAAGAGAAAGG - Intergenic
1035279134 7:157766247-157766269 AAGGATGGATGGATGGAGGAAGG - Intronic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038404051 8:27308888-27308910 AAGGGTAGTTAGAATGAGGAGGG - Intronic
1038820907 8:30951169-30951191 AAGGAAGGATGGAAGGAGGAAGG - Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG + Intergenic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1041967202 8:63692719-63692741 CACGATAGTCAGAAGCAGGATGG - Intergenic
1042108842 8:65357357-65357379 CTTGATAGAAAGAAGGAGAAGGG - Intergenic
1042236445 8:66617567-66617589 AAGGAAAGAGGGAAGGAGGAAGG + Intergenic
1042502716 8:69526851-69526873 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1043586449 8:81775487-81775509 AAGGATAGAGGGGAGGAGGAGGG - Intergenic
1043919837 8:85968715-85968737 CAGGCTAGATAGAGGTAGGGAGG + Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044305446 8:90635297-90635319 AAAGATAGATAGGATGAGGAAGG + Intronic
1044428608 8:92082889-92082911 GAGGAGGGAGAGAAGGAGGAGGG + Intronic
1044891762 8:96843391-96843413 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
1045218509 8:100173854-100173876 CAAGATAAATAAAAGTAGGAAGG + Intronic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1048053875 8:130845853-130845875 AAGGATAGAAAGAAGAAGGGAGG + Intronic
1048165928 8:132061386-132061408 AGGGACAGAGAGAAGGAGGAAGG - Intronic
1048232174 8:132653210-132653232 ATGGATAGATGGAAGAAGGAAGG + Intronic
1048250961 8:132866592-132866614 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1048435624 8:134414317-134414339 CAGGATAGGAAGCAGGAGCAAGG - Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048798538 8:138174079-138174101 CAGAATAGATGGTATGAGGAAGG - Intronic
1049346018 8:142139086-142139108 CAGCAAAGATACCAGGAGGAGGG + Intergenic
1049350664 8:142162831-142162853 GAGGATGGATGGATGGAGGATGG + Intergenic
1049356681 8:142192655-142192677 CAGGAAGGAGGGAAGGAGGAGGG + Intergenic
1049370333 8:142261276-142261298 GAGGATAGAGGGAGGGAGGAGGG + Intronic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049371991 8:142272369-142272391 GTGGATGGATGGAAGGAGGAAGG - Intronic
1049372052 8:142272613-142272635 GTGGATGGATGGAAGGAGGAAGG - Intronic
1049464629 8:142745148-142745170 AAGGATGGATGGATGGAGGATGG + Intergenic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1049474778 8:142791782-142791804 GAGGATGGATGGATGGAGGATGG - Intergenic
1049474885 8:142792482-142792504 AAGTGTAGATGGAAGGAGGATGG - Intergenic
1049826551 8:144672457-144672479 CAGGAAAGATGAAAGGAGCATGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050120336 9:2301204-2301226 CAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1051014924 9:12463061-12463083 GAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1052161924 9:25272991-25273013 CAAGATAGATAGAAGGGTGTGGG - Intergenic
1052205689 9:25837160-25837182 CAGGATTGAAGGAAAGAGGAAGG + Intergenic
1052336764 9:27328219-27328241 CAGGTTAGGAAGAAGAAGGAGGG + Exonic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053076993 9:35141660-35141682 GGGGATCGAGAGAAGGAGGATGG + Intergenic
1053103187 9:35388851-35388873 CACGATAGCTGCAAGGAGGAGGG + Intronic
1054364092 9:64213975-64213997 CAGGATAGAAACTAGCAGGAAGG - Intergenic
1055371181 9:75601352-75601374 AAGGAGAGAGAGAAGGAAGAAGG - Intergenic
1056422495 9:86442952-86442974 AAGGAAAGAGAGAAGGAGGGAGG - Intergenic
1056597672 9:88021038-88021060 AAGGAGAGAGAGAAGAAGGAAGG - Intergenic
1056724729 9:89104734-89104756 GAGGATAGATAAACTGAGGAAGG - Intronic
1056851355 9:90087176-90087198 AGGGAGAGATGGAAGGAGGAAGG + Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1058459654 9:105171117-105171139 CAGCATAGAGAGAAAGAAGATGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058594545 9:106601352-106601374 CAGGAGAGATCCAAGGAAGAAGG + Intergenic
1058924410 9:109648115-109648137 CAGGACAGAGAGAAAGAGCAGGG - Intronic
1058935808 9:109768140-109768162 AAGGAAAGAAGGAAGGAGGAAGG + Intronic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059409082 9:114120795-114120817 CTGGATAGATAGATGATGGATGG + Intergenic
1059672293 9:116503016-116503038 AAGGAAAGAAAAAAGGAGGAAGG + Intronic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1060124862 9:121033917-121033939 TAAGATAGAAAGAAGAAGGAAGG - Intronic
1060252162 9:121995188-121995210 CAGGATAGAGAGGAAGAAGAGGG + Intronic
1060298952 9:122362820-122362842 CTGGATGGAGAGAAGGGGGAGGG - Intergenic
1060892167 9:127195815-127195837 TAGGAAAGAAGGAAGGAGGAAGG - Intronic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062257521 9:135635069-135635091 AAGGATAGAAGGAAGGAAGAAGG - Intronic
1203562058 Un_KI270744v1:65511-65533 CAGGTCAGATAGGTGGAGGAGGG - Intergenic
1185513660 X:681852-681874 CAAGAGAGGTAGAAGGAGAAAGG + Intergenic
1185574897 X:1163614-1163636 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1185592522 X:1286968-1286990 GAGAAAGGATAGAAGGAGGAGGG + Intronic
1185694447 X:2184741-2184763 CTGGATAGATAGAAACAGGTGGG - Intergenic
1185726562 X:2426530-2426552 AAGGAAAGAAGGAAGGAGGAAGG - Intronic
1185766903 X:2732922-2732944 AAGGAGAGAGGGAAGGAGGAAGG - Intronic
1185834040 X:3328859-3328881 CAGGAGAGAAGGCAGGAGGAAGG + Intronic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1186958354 X:14708001-14708023 CATGAAAGAAAGAAGGAGGGAGG - Intronic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187866970 X:23731745-23731767 CAGGAAAGAGAGACAGAGGAGGG + Intronic
1188132597 X:26455652-26455674 CAGGAGAGATAGAATAAGGCAGG - Intergenic
1188148236 X:26640718-26640740 GAGGATGGATGGTAGGAGGAGGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189877746 X:45454440-45454462 AAGGACAGATAGAAGAAGCAGGG + Intergenic
1190123401 X:47682646-47682668 AAGGAAAGAAAGAAGGAGGAAGG - Intergenic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1191268452 X:58429515-58429537 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1192430337 X:71107457-71107479 GAGGGTAGATGGAAAGAGGAAGG + Exonic
1195375164 X:104219512-104219534 AAGGATAGAGGGAGGGAGGAAGG + Intergenic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1196996472 X:121389221-121389243 CATTATAGATAAAAGGAAGAGGG - Intergenic
1197777310 X:130126958-130126980 TTGGATAGATAAAGGGAGGAGGG + Intergenic
1198453758 X:136794672-136794694 GAGGATGGAGAGCAGGAGGAGGG - Intergenic
1199000260 X:142628162-142628184 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
1199396167 X:147341192-147341214 AAGGAGAGAGGGAAGGAGGAAGG - Intergenic
1199474348 X:148229296-148229318 CAGGATGAATGGAAGGGGGAGGG - Intergenic
1199555057 X:149098138-149098160 AAGGAGAGAAGGAAGGAGGAAGG + Intergenic
1199595789 X:149504963-149504985 AAGGAAAGAAGGAAGGAGGAAGG + Intronic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1201254278 Y:12091682-12091704 CAGGAATGAGAGAATGAGGAGGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic