ID: 1145968360

View in Genome Browser
Species Human (GRCh38)
Location 17:28937899-28937921
Sequence TGTCCCTTTTCCAAAACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145968360_1145968365 15 Left 1145968360 17:28937899-28937921 CCACCTGTTTTGGAAAAGGGACA 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1145968365 17:28937937-28937959 CGGTAATTTTCTCACACTCTTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1145968360_1145968366 16 Left 1145968360 17:28937899-28937921 CCACCTGTTTTGGAAAAGGGACA 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1145968366 17:28937938-28937960 GGTAATTTTCTCACACTCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 309
1145968360_1145968363 -5 Left 1145968360 17:28937899-28937921 CCACCTGTTTTGGAAAAGGGACA 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1145968363 17:28937917-28937939 GGACAAAATTCTGGCCTCAACGG 0: 1
1: 0
2: 1
3: 19
4: 242
1145968360_1145968367 29 Left 1145968360 17:28937899-28937921 CCACCTGTTTTGGAAAAGGGACA 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1145968367 17:28937951-28937973 CACTCTTGGGAACATTCCATTGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145968360 Original CRISPR TGTCCCTTTTCCAAAACAGG TGG (reversed) Intronic
901087804 1:6622251-6622273 TGTCCCTTTTAACAAACAGAAGG - Exonic
903137833 1:21320957-21320979 TTCCCCTTTTCCAAACCAGGAGG - Intronic
903729758 1:25483874-25483896 TGTCACTATTCATAAACAGGGGG + Intronic
904434311 1:30484344-30484366 CCTTCATTTTCCAAAACAGGTGG - Intergenic
906054647 1:42905848-42905870 AATCCCTTTTCCAGAAGAGGAGG + Intergenic
907378376 1:54063729-54063751 TATCCCTTATCCAAAACGGTTGG - Intronic
911302890 1:96197326-96197348 TGTCCCTTTTCCACTACATGAGG - Intergenic
911767863 1:101700986-101701008 TCTCCATTTTCTAAAAAAGGAGG + Intergenic
912064265 1:105717201-105717223 CTTCCCTTTTCCATACCAGGAGG + Intergenic
913309343 1:117472296-117472318 TTTTCCTTTTCCCTAACAGGTGG - Intronic
915375964 1:155395879-155395901 TGTTCCTTCTCCAAAACTGTTGG - Intronic
917801869 1:178579140-178579162 TGAGCCCTTTCCAAAGCAGGCGG + Intergenic
920034467 1:203056883-203056905 TCTCCTTCTTCCCAAACAGGCGG - Exonic
920524881 1:206659218-206659240 TGCCCCTTTTCCAACCCAGTAGG - Intronic
920695727 1:208180115-208180137 TGTTCCTCCTCCACAACAGGCGG + Intronic
921021972 1:211244136-211244158 TGTCCCTTAGCCCATACAGGGGG - Intergenic
921427649 1:215022717-215022739 TGGCCCTTTCCCAAAACACCAGG + Intronic
924811708 1:247408534-247408556 TGCTCCTTGTCCATAACAGGTGG - Intergenic
924945454 1:248843396-248843418 TGTCCAGTTTCCAAAACAGCAGG + Intronic
1064061550 10:12141838-12141860 TGGCCCTTTCACAGAACAGGGGG - Intronic
1065195714 10:23263588-23263610 TGTCCCATTTCCCACACAGAAGG + Intergenic
1065679832 10:28217768-28217790 TTTCCCTTTTACAAAGCATGAGG - Intronic
1066290927 10:34013810-34013832 TTTCCCCATTCTAAAACAGGGGG + Intergenic
1066820261 10:39477880-39477902 ATTTCCTTTTCCAAAATAGGGGG + Intergenic
1067098171 10:43315850-43315872 TCTCACTTTTTCAAAACTGGTGG + Intergenic
1067393513 10:45888309-45888331 TGTCACATTTCCCCAACAGGTGG - Intergenic
1067861837 10:49857450-49857472 TGTCACATTTCCCCAACAGGTGG - Exonic
1069246579 10:66214705-66214727 TGTCCCTTTACGAAACCAGAAGG - Intronic
1069892129 10:71658565-71658587 TGCCCCTTTGCCAAAACAAGAGG + Intronic
1070176183 10:73971772-73971794 TTTCCATTTTACAAATCAGGAGG - Intergenic
1072465830 10:95661604-95661626 TTGCCCTTTTCCAAAACACTTGG - Intergenic
1074152340 10:110768411-110768433 TATCCCTTTCCCAAAATGGGTGG - Intronic
1074888470 10:117714278-117714300 TGTCTCCTTTTAAAAACAGGAGG - Intergenic
1075976726 10:126702507-126702529 ACTCCCTTTTCCAAAATAAGTGG + Intergenic
1076142371 10:128089875-128089897 TGAGCCTTTTCCTTAACAGGTGG - Intergenic
1076873176 10:133203407-133203429 TGTGTCTCTTTCAAAACAGGAGG + Intronic
1080608213 11:33882211-33882233 TGTCCCTTTTCCAAATGAACAGG + Intronic
1081032283 11:38099003-38099025 TGTCCCTCCTCTAACACAGGGGG + Intergenic
1084509700 11:69595536-69595558 GGTCCCGCTGCCAAAACAGGCGG - Intergenic
1086720270 11:90112011-90112033 TTTCCTTCTTCCAAAACAGTTGG + Intergenic
1087530092 11:99369711-99369733 TTTCCATTATCCAAAATAGGTGG + Intronic
1093194137 12:16110340-16110362 TTTCCCTTTTCCAATAGAGTAGG + Intergenic
1096002471 12:48141190-48141212 TGTACCTTTTCCAACCAAGGGGG + Intronic
1097503647 12:60437927-60437949 TGTCCCTTCCCCAATACATGGGG - Intergenic
1099273819 12:80549908-80549930 TGACCCTTCTCCAAAACATTGGG + Intronic
1100196074 12:92246475-92246497 TGTGTGTTTTCAAAAACAGGTGG + Intergenic
1100813781 12:98366003-98366025 TGTGCCTTTTACGAAACATGAGG - Intergenic
1100892087 12:99136929-99136951 TCACCTTCTTCCAAAACAGGTGG - Intronic
1102503440 12:113368699-113368721 TGTCCCTCTTGCAGAAGAGGAGG - Intronic
1102652541 12:114452244-114452266 GGTCCCTTTTACAATACTGGAGG + Intergenic
1105356986 13:19667574-19667596 TTTGCCCTTTCCAGAACAGGTGG + Intronic
1106183483 13:27387688-27387710 TATCCCTTTTCAAAAACAAGAGG - Intergenic
1108348611 13:49569962-49569984 TGTGCCTCTTACAAAACAGATGG + Intronic
1108726257 13:53184711-53184733 GGTCCCTCTTCCAACACATGGGG + Intergenic
1109367561 13:61376332-61376354 TGTAACTGTTCAAAAACAGGAGG - Intergenic
1110505644 13:76283022-76283044 TATCCCTTATCCAAAATAGTTGG + Intergenic
1110938491 13:81320692-81320714 TGTCCCTGTCCCTACACAGGGGG + Intergenic
1111370914 13:87315098-87315120 GTTCCCTTTTCCAAAAAAGGAGG - Intergenic
1112387860 13:98956959-98956981 TGTCTCCTTTCCAATACAGGTGG + Intronic
1112550630 13:100417396-100417418 TTACACTTTTCAAAAACAGGCGG + Intronic
1112752066 13:102593237-102593259 TGTTCCTTTTCCCTAAAAGGTGG - Intergenic
1114038274 14:18650106-18650128 TGTCCCTTCCATAAAACAGGAGG + Intergenic
1114120347 14:19664936-19664958 TGTCCCTTCCATAAAACAGGAGG - Intergenic
1114718310 14:24852236-24852258 TGTACCTTTCTCAAAAGAGGAGG + Intronic
1115496654 14:34011573-34011595 GGTCCCTTTTCCCCAAAAGGAGG + Intronic
1116781629 14:49243588-49243610 TTTCCCTCTTCCACCACAGGAGG + Intergenic
1117283103 14:54259762-54259784 TGTCTCTATTCCAAAACATACGG + Intergenic
1118094027 14:62516382-62516404 TGTCCCTTTGTTAAAAAAGGTGG + Intergenic
1121008668 14:90507006-90507028 TGTCCTTTTTCTAAACCAGGGGG - Intergenic
1122567066 14:102666934-102666956 TGACCTCTTTCCAAAAAAGGGGG - Intronic
1124697583 15:31878366-31878388 TGTTCCTTTTCAAAAAAATGTGG + Intergenic
1127450376 15:59110673-59110695 TATCCTTTTTGCAAAACTGGAGG + Intronic
1130141255 15:81228182-81228204 TGTACCTATTCCACAGCAGGAGG + Intronic
1132302658 15:100785702-100785724 TGTCCCTGTTCCAGACCAGGCGG + Intergenic
1132406300 15:101543417-101543439 GGTACCTTTACCAAACCAGGTGG + Intergenic
1133320434 16:4910223-4910245 TCTCTCTTCTCCAAAAAAGGTGG + Intronic
1133464521 16:6017849-6017871 TGTAAGCTTTCCAAAACAGGGGG - Intergenic
1137010279 16:35314405-35314427 TGTCCCTTTTCCACCACAGCTGG + Intergenic
1138222858 16:55267688-55267710 TTTCCCCTTTCCAAAAAATGGGG - Intergenic
1138294001 16:55871510-55871532 TTTCCCTTTTACCCAACAGGGGG + Intronic
1144098558 17:11923655-11923677 TGACCCTTTTCCTTCACAGGGGG - Intronic
1145968360 17:28937899-28937921 TGTCCCTTTTCCAAAACAGGTGG - Intronic
1146995005 17:37312428-37312450 TCTCCATTTTCCAGAAGAGGAGG - Intronic
1147103923 17:38195265-38195287 TGTCCCTTATCCAAAATGCGTGG + Intergenic
1147431114 17:40371393-40371415 TGGCCCTTTTCTGAGACAGGGGG - Intergenic
1147543397 17:41379728-41379750 TTTCCCTTTTCTCCAACAGGAGG - Exonic
1149290104 17:55209638-55209660 TCGCCCTTATCCAGAACAGGTGG - Intergenic
1149704080 17:58679435-58679457 TCTCGCTATTCCAAAACAGGAGG + Intronic
1153017582 18:597362-597384 ATTCTCTTTTTCAAAACAGGAGG + Intronic
1153734852 18:8055941-8055963 TGTCCCTTATCCAAAACAAAGGG - Intronic
1153809329 18:8738086-8738108 TCTCACATTTCCAAACCAGGAGG + Intronic
1155572301 18:27208806-27208828 TTTCCCTTTTCCAACAGAAGAGG + Intergenic
1156473601 18:37392333-37392355 TGCCCCTTATGCAAAACAGATGG - Intronic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1157733995 18:50030424-50030446 TGTCCCTCTTGGTAAACAGGAGG - Intronic
1158118708 18:54025436-54025458 TGTCCCTTTTCTGAGACGGGTGG + Intergenic
1158677179 18:59530617-59530639 TGTGCCTTTTTCAGAACAGTTGG - Intronic
1160525416 18:79532880-79532902 TTGCCCTTTTCCCAAAAAGGAGG + Intergenic
1161684446 19:5696007-5696029 TGTCCCCTTCCCAGAGCAGGGGG - Intronic
1162842296 19:13365318-13365340 TGTCCCCTCTTCAAAGCAGGTGG + Exonic
1163130147 19:15267348-15267370 TGTCCCTTTTCCAAGTTTGGTGG - Intronic
1163138952 19:15333059-15333081 TGTCCCTTTTTTTAAAAAGGTGG - Intergenic
1164387409 19:27786016-27786038 TGGCCTTTATCCAAAAGAGGTGG + Intergenic
1165304907 19:34997748-34997770 TGTCCTTTTTCTACATCAGGAGG - Intronic
1166213331 19:41320952-41320974 GGGTCCTTTTCCAAAGCAGGTGG - Intronic
925360316 2:3275632-3275654 AGTCTCTTTTCCATAAAAGGGGG - Intronic
926102905 2:10131956-10131978 TTTCCCGTTTGCAAAACAGGTGG + Intergenic
926471633 2:13267149-13267171 AGTCCCTTCCCCAATACAGGGGG - Intergenic
926966144 2:18413990-18414012 TCTCTCTTTTCCTAAACTGGAGG - Intergenic
927193343 2:20531896-20531918 TCTCCCGTCTCCAGAACAGGAGG + Intergenic
931804720 2:65793120-65793142 TGTCCCTTTTCCAAAATGCTTGG - Intergenic
932072209 2:68632141-68632163 TGTCTCTTTTCAAGTACAGGCGG + Intergenic
932565641 2:72906549-72906571 TGGTCCTTTTCCAAATCAGCTGG + Intergenic
934526278 2:95053707-95053729 GGTCCCCTTTCACAAACAGGAGG - Exonic
937368160 2:121280064-121280086 GTTCCCTTTTCCAGAACACGTGG - Intronic
938443549 2:131357121-131357143 TGTCCCTTCCATAAAACAGGAGG + Intergenic
938974464 2:136462355-136462377 GGTCCCTTCTCCAACACATGGGG + Intergenic
939234246 2:139470533-139470555 TGTCCCCTTTCAAAAAAAAGTGG - Intergenic
941082913 2:161082512-161082534 TGACCTTTTTTAAAAACAGGAGG + Intergenic
947794708 2:232886985-232887007 TGTCCCTTTCCCAGACCAGTTGG - Intronic
1173120727 20:40286932-40286954 TGCTCCTTTGCCAAGACAGGAGG - Intergenic
1176198929 20:63851159-63851181 CCTCCTTTCTCCAAAACAGGCGG + Intergenic
1177216695 21:18139341-18139363 TATCACTTTTTCAAAACATGAGG - Intronic
1180462396 22:15577147-15577169 TGTCCCTTCCATAAAACAGGAGG + Intergenic
1181588952 22:23871101-23871123 TGTCCCTTTTTCAAAAGATTTGG - Intronic
1182214612 22:28705529-28705551 TGTCCCTTATCCAAAACGCCTGG - Intronic
1183095352 22:35548709-35548731 TGCCCCTTCTCCAAAACTCGGGG - Intronic
1185265747 22:49903122-49903144 TGTCCCTTTACCATAACACCTGG + Exonic
949322100 3:2823031-2823053 TTTCCCTTGTCCAAAACTGATGG - Intronic
949500946 3:4679502-4679524 TGTCCCAGCTCCAGAACAGGTGG + Intronic
951386085 3:22044559-22044581 TCTCCCTTCTCCAAAACATAAGG - Intronic
951669745 3:25167387-25167409 TGTCCATCTTCCAAAAAAGTTGG - Intergenic
954111944 3:48438765-48438787 TGTTCCTTTCCAAACACAGGTGG + Intronic
954165437 3:48753601-48753623 AGTCCCTTCTCTAAAACAGAAGG + Intronic
954388106 3:50254960-50254982 TCTCCCTTTTCCCCAACAGGTGG - Intronic
954804973 3:53213173-53213195 TATCCCTTATCCAAAACACTTGG + Intergenic
960512221 3:118564373-118564395 TGGACAATTTCCAAAACAGGTGG + Intergenic
961099841 3:124189403-124189425 TGTCCCTTTTTCAAAACTCCTGG - Intronic
961141304 3:124558928-124558950 TGTGTCTTTTCCATAACATGAGG + Intronic
964418303 3:156473077-156473099 ATGCCCCTTTCCAAAACAGGGGG + Intronic
966223239 3:177570969-177570991 TCTTCCTTCCCCAAAACAGGTGG - Intergenic
968283451 3:197494351-197494373 TGTCCCTTTTCCAGGAAAGTGGG + Intergenic
969066985 4:4493249-4493271 TGTGCCTTTTCCAAAAATTGGGG - Intronic
969701226 4:8768852-8768874 TGTCCCCTTTCCCAGAGAGGGGG - Intergenic
970204591 4:13643433-13643455 AGTCCCTATTCCAAAACCAGTGG + Intergenic
973194458 4:47423657-47423679 TGAGCCTTGGCCAAAACAGGTGG + Intronic
973590934 4:52440871-52440893 TGTCACTTCTCCAATACAGTGGG + Intergenic
980666034 4:135936836-135936858 TGTCTCAGTTCCAAAACAGAGGG - Intergenic
982834017 4:160100076-160100098 TGTCCCTTTAGAAAGACAGGTGG - Intergenic
984601333 4:181730243-181730265 TGGCTCTTTTCCACAAAAGGTGG + Intergenic
984823986 4:183907348-183907370 TGTTCCTTTTGGAGAACAGGGGG - Intronic
986015532 5:3754213-3754235 TTTACCTTTTGCAATACAGGTGG + Intergenic
986130009 5:4921009-4921031 TGTCTCATTTCCCAAACAGGAGG - Intergenic
989723092 5:44553255-44553277 TCTCCCTTTTCCAAAGGCGGAGG + Intergenic
990085035 5:51965816-51965838 TGTACTTTTCCCAAAAAAGGTGG + Intergenic
992424491 5:76642475-76642497 TGACAATTTTCCAAAACAGAGGG + Intronic
993139744 5:84016802-84016824 TATCCCTTATCCAAAACACTTGG - Intronic
995729802 5:115226367-115226389 TGTCCCTTATCCAAAATACTTGG - Intronic
997257038 5:132437061-132437083 GGTCCCTATTCCCATACAGGGGG - Intronic
997657507 5:135566471-135566493 TGTAACTTTTCAAAAACAGGAGG + Intergenic
998070573 5:139194892-139194914 TGTACCTTTTTCGAAATAGGTGG - Intronic
998441773 5:142168681-142168703 TGTCACTTTTCTGATACAGGTGG - Intergenic
998815477 5:146009706-146009728 TGTCCATTTTAAAAATCAGGAGG - Intronic
999517597 5:152316609-152316631 GGTCCCTTCTCCAACACATGGGG + Intergenic
1003017285 6:2478353-2478375 TGTCCAGTTAGCAAAACAGGAGG - Intergenic
1003488432 6:6599754-6599776 TGTTCCTTTTCTAAACAAGGAGG - Intronic
1003641643 6:7880176-7880198 TGAACCTGTTCCAAAACAGAAGG - Exonic
1005330517 6:24745479-24745501 TGACCCTTTACCAAAAAAGTTGG - Intergenic
1007891698 6:45300495-45300517 TGGCCCTTTTGGAAAACAGCTGG + Intronic
1008804316 6:55409353-55409375 TTTCCTTTTTTCATAACAGGAGG + Intergenic
1008979894 6:57471161-57471183 TGTACCTTTTCCAAACCAGATGG - Intronic
1009167998 6:60364083-60364105 TGTACCTTTTCCAAACCAGATGG - Intergenic
1013048387 6:106510085-106510107 TGTTCCTTTTCCAGGAAAGGTGG + Intergenic
1014525173 6:122494326-122494348 TTACCCTTTTCTAAAACAGTAGG + Intronic
1016494295 6:144642522-144642544 TGTCACTAGTACAAAACAGGAGG - Intronic
1017218573 6:151938905-151938927 GATCCCTTATACAAAACAGGTGG + Intronic
1019348400 7:541649-541671 TGCCGCTTTTCCAAAACTGGGGG + Intergenic
1019564685 7:1673510-1673532 TGTCCCTTTCCCAAGGCTGGTGG + Intergenic
1020784155 7:12553765-12553787 TATTCCTTTTCCAAAACAATGGG - Intergenic
1020939543 7:14514751-14514773 TGTCCCATTTTAAAAAAAGGAGG + Intronic
1022683405 7:32571684-32571706 AGTACATTTTCCAAGACAGGAGG + Intronic
1022683477 7:32572323-32572345 TATACATTTTCCAAGACAGGAGG + Intronic
1023640148 7:42249426-42249448 TGTCACCTTACAAAAACAGGTGG + Intergenic
1027830160 7:83166778-83166800 TTTCCCTTTTCAAAAATAAGTGG - Intergenic
1030950208 7:115781387-115781409 TACCCCTATTCCAACACAGGTGG + Intergenic
1030991307 7:116304128-116304150 TGTCACTATTTCAAAACATGAGG + Intronic
1031496396 7:122454283-122454305 TGTCTCCTTTCCAAAAGAGAAGG + Intronic
1032006093 7:128303128-128303150 TTTCTCTTTTCCAAATTAGGTGG - Exonic
1033849297 7:145475396-145475418 GGTCCCTCTTCCAATACATGGGG - Intergenic
1034994174 7:155567765-155567787 TGACCCTTCACAAAAACAGGTGG + Intergenic
1035909468 8:3549602-3549624 TGTGGCTTTTTAAAAACAGGAGG + Intronic
1037175955 8:15945854-15945876 TCTCCCATTTCAAAATCAGGAGG + Intergenic
1037609057 8:20461130-20461152 TGTCCCTTCTCCCAATCAGAAGG + Intergenic
1038600533 8:28937683-28937705 TCTTCCTTTTCTAACACAGGGGG - Intronic
1040079447 8:43272459-43272481 TGCCCCTCTTCCAACACTGGGGG + Intergenic
1042706879 8:71672993-71673015 TATCACTTTTCCAAGACAGATGG - Intergenic
1046439829 8:114242504-114242526 TGCCCCTTTCCCAAAAAAGCAGG - Intergenic
1049293033 8:141813923-141813945 CGTCCCTTTTCCAGAACTGCTGG - Intergenic
1051996819 9:23227351-23227373 TTTTCCTTTTCCACTACAGGGGG - Intergenic
1055235208 9:74113647-74113669 TCTCCCCTTTCCGAAACAAGCGG - Intergenic
1056115284 9:83435309-83435331 CCTCCCTTTTCCAAACTAGGAGG - Intronic
1057285223 9:93748315-93748337 GGTCCCTTTTCCAACACATGGGG + Intergenic
1059085758 9:111301070-111301092 TATCCCATTTTCAAAACAGGAGG + Intergenic
1060159197 9:121344696-121344718 TGTCCCTTCTGCAGACCAGGTGG + Intronic
1060451567 9:123746451-123746473 TATCCCTTATCCAAAACATATGG + Intronic
1187529836 X:20086267-20086289 TGTCCCCTATCCCACACAGGTGG + Intronic
1188573597 X:31618923-31618945 TATCCCTTATCCAAAACACTTGG - Intronic
1193800145 X:85925233-85925255 TGGCCCTTGTACAAACCAGGTGG - Intronic
1194219619 X:91175180-91175202 TGTTCATTTTCCCAAACAGAAGG + Intergenic
1194941321 X:100014931-100014953 TTGCCCTTTACCAAACCAGGAGG + Intergenic
1197793853 X:130280754-130280776 GGTCCCTTACCCAAACCAGGCGG - Intergenic
1200556130 Y:4638944-4638966 TGTTCATTTTCCCAAACAGAAGG + Intergenic