ID: 1145969053

View in Genome Browser
Species Human (GRCh38)
Location 17:28944502-28944524
Sequence CCGTATCTTCCATATTTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145969050_1145969053 -1 Left 1145969050 17:28944480-28944502 CCTGAGTTAAAATTGAACATTAC 0: 1
1: 0
2: 3
3: 7
4: 176
Right 1145969053 17:28944502-28944524 CCGTATCTTCCATATTTAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 60
1145969049_1145969053 25 Left 1145969049 17:28944454-28944476 CCTACATTAAGAAGCATGCATCT 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1145969053 17:28944502-28944524 CCGTATCTTCCATATTTAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 60
1145969048_1145969053 26 Left 1145969048 17:28944453-28944475 CCCTACATTAAGAAGCATGCATC 0: 1
1: 0
2: 0
3: 10
4: 110
Right 1145969053 17:28944502-28944524 CCGTATCTTCCATATTTAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145969053 Original CRISPR CCGTATCTTCCATATTTAGG TGG Intronic
909743641 1:79065321-79065343 CCTTACCTTCCTTATTTAAGAGG + Intergenic
912853487 1:113147146-113147168 CCCTAGCTGCCAGATTTAGGAGG - Intergenic
920877744 1:209853132-209853154 CCATTTATTCCATATTTAGATGG + Exonic
1065670610 10:28113034-28113056 CCGTATGTCCCATAGTGAGGTGG - Intronic
1071393114 10:85195335-85195357 CCGCATCTTCCCTGTTAAGGTGG - Intergenic
1072428545 10:95351232-95351254 CAGTATCGTCTATATTGAGGAGG + Exonic
1074230474 10:111529605-111529627 CCCCATCTTCCATATTTATGGGG - Intergenic
1083666116 11:64275658-64275680 CCGTTTCCTGCGTATTTAGGTGG - Intronic
1090511214 11:127377143-127377165 ACGTACCTTCCATATTCAGCTGG + Intergenic
1093420895 12:18973455-18973477 CCACAATTTCCATATTTAGGTGG + Intergenic
1098618908 12:72566769-72566791 ACATATCTTCCATATTGAGTTGG - Intronic
1100429824 12:94521361-94521383 ATGAATCTTTCATATTTAGGTGG + Intergenic
1106914084 13:34493734-34493756 ACGTATCTTCAATATTTATTTGG + Intergenic
1202890725 14_KI270722v1_random:154655-154677 GTGAATCTTCCATATTTAGGAGG + Intergenic
1137483954 16:48876304-48876326 CTGTATCCTCCACATTTTGGAGG + Intergenic
1137984096 16:53093170-53093192 CCCTATGTTCCATTTTTAGGTGG + Intronic
1145969053 17:28944502-28944524 CCGTATCTTCCATATTTAGGTGG + Intronic
1158519530 18:58159718-58159740 ACGTAACTTACATATTTATGTGG + Intronic
1159721972 18:71902072-71902094 CCTTATCTGCGATTTTTAGGAGG - Intergenic
1160263154 18:77314730-77314752 CAGTTGCTTCCATGTTTAGGTGG + Intergenic
1163732915 19:18960405-18960427 CTGTGTCTTACATTTTTAGGGGG + Intergenic
1163743411 19:19030822-19030844 CCTTAGTTTCCTTATTTAGGAGG - Intronic
1202666148 1_KI270708v1_random:121493-121515 GTGAATCTTCCATATTTAGGAGG + Intergenic
924987313 2:283981-284003 CAATATATGCCATATTTAGGAGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
927632194 2:24784265-24784287 CTGTATCTTCCATTTTTAATTGG - Intergenic
939064259 2:137463706-137463728 CAGTATCATCCATATTTAGCAGG + Intronic
943266305 2:185737566-185737588 CCTTATCTCCCATGTTTAGTTGG - Intergenic
948599508 2:239100344-239100366 CCGTATCTTCCAGTCTGAGGAGG + Intronic
1171119528 20:22556615-22556637 CCATCTCTTCCCTATTTAAGAGG + Intergenic
1175417479 20:58811345-58811367 CGCAATCTTCCATATTCAGGTGG + Intergenic
1177245812 21:18521501-18521523 CCTTTTCTTTCATATTTAGAGGG + Intergenic
1178261152 21:31100844-31100866 CCGGATCTGCCATATATGGGTGG + Intergenic
952691098 3:36207425-36207447 CCGTATTTTGCATATGTAAGAGG + Intergenic
957089729 3:75717875-75717897 GTGAATCATCCATATTTAGGAGG - Intronic
959524054 3:107356133-107356155 CCTTGTCTCCAATATTTAGGAGG + Intergenic
960957613 3:123045234-123045256 CTGTGCCTTCTATATTTAGGAGG - Intergenic
972154611 4:36144024-36144046 CCATATCTTCCATATATGAGGGG + Intronic
981528240 4:145729208-145729230 CAGTATTTTCCATAATTTGGAGG - Exonic
981577797 4:146223227-146223249 CAGTCTCCTTCATATTTAGGAGG - Intergenic
982185731 4:152796331-152796353 ATGAATCTTTCATATTTAGGTGG + Intronic
984395064 4:179187418-179187440 CCATTTCTTCCATTTTTATGGGG - Intergenic
992241105 5:74770778-74770800 ATGAATCTTTCATATTTAGGTGG - Exonic
994998854 5:107101663-107101685 CCATATTTTCCATATTAAGGGGG + Intergenic
996834770 5:127778627-127778649 CCTTATCTTCTGTATTTTGGAGG + Intergenic
1009465537 6:63963940-63963962 ACTTATCTTCCATCTGTAGGTGG + Intronic
1009814645 6:68716465-68716487 CTGTATTTTCCATATTTATTTGG + Intronic
1010732990 6:79410828-79410850 TGGGATCTTCCATGTTTAGGGGG - Intergenic
1012571516 6:100735861-100735883 CCTGAGCTTACATATTTAGGTGG + Intronic
1027610556 7:80354972-80354994 CTGTATCTTCTATATATATGTGG - Intergenic
1031843007 7:126769787-126769809 GGGTATCTTCTATATATAGGAGG + Intronic
1032587351 7:133159347-133159369 TAGTATTTTCCATATTTATGGGG - Intergenic
1033377564 7:140777588-140777610 TAGAATCTTCCCTATTTAGGTGG + Intronic
1035437587 7:158870696-158870718 CTTTATTTTCCATATTTTGGGGG + Intronic
1036154819 8:6331680-6331702 CTGTCTCTTCCTTCTTTAGGTGG - Intergenic
1039823376 8:41153392-41153414 CCTTAGCTTCCATCTTTTGGGGG + Intergenic
1045201296 8:99984334-99984356 CCTTATATTCCATAGTTAGGAGG - Intronic
1048414205 8:134208199-134208221 CTGTATCTTTCATATTTCCGTGG - Intergenic
1050944810 9:11503162-11503184 CCGTATTTTCCAAAATTTGGAGG - Intergenic
1051202219 9:14639612-14639634 CAGTATCTTACGTATTTATGGGG - Intronic
1057594942 9:96407767-96407789 ATGAATCTTTCATATTTAGGTGG - Intronic
1058599334 9:106652608-106652630 CATTCTCTTCCATGTTTAGGGGG + Intergenic
1061688399 9:132303685-132303707 ATGTATCTTCCATTTTTAGTTGG - Intronic
1203487836 Un_GL000224v1:73851-73873 GTGAATCTTCCATATTAAGGAGG + Intergenic
1203500457 Un_KI270741v1:15746-15768 GTGAATCTTCCATATTAAGGAGG + Intergenic
1186256467 X:7726937-7726959 CTTTATTTTCCATATTTATGAGG + Intergenic
1198735949 X:139785543-139785565 CTTTATCTTCCATTTTTATGTGG - Intronic
1200803843 Y:7411765-7411787 CCTAATCTTACAAATTTAGGTGG + Intergenic