ID: 1145969664

View in Genome Browser
Species Human (GRCh38)
Location 17:28949697-28949719
Sequence GCCCGCGCGCCCGCTGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145969664_1145969669 -1 Left 1145969664 17:28949697-28949719 CCGAGGGCAGCGGGCGCGCGGGC 0: 1
1: 0
2: 2
3: 18
4: 253
Right 1145969669 17:28949719-28949741 CAGGCAAGCGGCACTGGGCCCGG 0: 1
1: 0
2: 11
3: 732
4: 18644
1145969664_1145969667 -7 Left 1145969664 17:28949697-28949719 CCGAGGGCAGCGGGCGCGCGGGC 0: 1
1: 0
2: 2
3: 18
4: 253
Right 1145969667 17:28949713-28949735 CGCGGGCAGGCAAGCGGCACTGG 0: 1
1: 0
2: 0
3: 11
4: 108
1145969664_1145969668 -6 Left 1145969664 17:28949697-28949719 CCGAGGGCAGCGGGCGCGCGGGC 0: 1
1: 0
2: 2
3: 18
4: 253
Right 1145969668 17:28949714-28949736 GCGGGCAGGCAAGCGGCACTGGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145969664 Original CRISPR GCCCGCGCGCCCGCTGCCCT CGG (reversed) Intronic
900103812 1:973868-973890 GCCCTCGAGCCCACTCCCCTCGG + Exonic
900333857 1:2151008-2151030 GCCCGGGAACGCGCTGCCCTGGG + Intronic
900346800 1:2214066-2214088 CCCCGTGCTCCCCCTGCCCTGGG - Intergenic
900349595 1:2228307-2228329 GCCCGCGCCCCCGCTCCTCCCGG + Intergenic
900414007 1:2526777-2526799 GCCCGCCCGCCCGCAGCCCCGGG - Intergenic
901086732 1:6615195-6615217 TCCCGCGCGCCCCCGGCCCGAGG + Intronic
901641519 1:10695218-10695240 CCCCGCGCGTCCCCGGCCCTGGG + Intronic
903115582 1:21176451-21176473 TCCCGCCCCCCCGCTGCCCCCGG - Intronic
903522210 1:23959503-23959525 GCGCGCGGGCTCGCCGCCCTTGG - Intronic
905734565 1:40316649-40316671 ACCCGCGCGCCCGCAGCCCCCGG + Intronic
906627141 1:47334262-47334284 CGCCGCGCGCCGGCGGCCCTCGG - Intronic
907489604 1:54800647-54800669 GCCCCCGCGCACGCTCCTCTGGG + Exonic
908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG + Intergenic
908527516 1:65002264-65002286 GCAAGCGCCCCCGCTGCCCCTGG + Intergenic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
918480729 1:184974275-184974297 GCCCGCCCGCCCGGGGGCCTGGG - Intronic
919830853 1:201539260-201539282 CCCCGCACCCGCGCTGCCCTTGG + Intergenic
920924484 1:210328883-210328905 GCCCGCGCGCCCTCCGCGCCCGG - Intronic
921172041 1:212558800-212558822 GCCCGCGGGCCCCCACCCCTCGG + Intergenic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
923286974 1:232505672-232505694 GCCCGTGCGACCACAGCCCTTGG + Intronic
924172542 1:241357110-241357132 CCACTCGCGCCCGCTCCCCTGGG + Exonic
1064179276 10:13100451-13100473 TCCCGCGAGACGGCTGCCCTGGG + Intronic
1065188703 10:23192335-23192357 GCCCGCGCTCGCGCTGCGCTGGG - Exonic
1065390076 10:25174574-25174596 TCCCGCGCCCCCGCCGCCCGCGG + Intergenic
1067078742 10:43202478-43202500 GCCCGCGCGGCCTCTGCCCCCGG + Intronic
1069222629 10:65903497-65903519 GACCGGGCTCCCACTGCCCTTGG - Intergenic
1070609994 10:77926568-77926590 GCCTGCCCGCCCGCCGGCCTCGG - Intergenic
1071299799 10:84247856-84247878 GCCTGCCCACCCTCTGCCCTTGG - Intronic
1072454204 10:95561627-95561649 GCCCGCGCGCCCGTTACCGGCGG - Intergenic
1072661955 10:97368744-97368766 GCATGCCCTCCCGCTGCCCTCGG - Intronic
1072695816 10:97601996-97602018 GGCCGCGCCCCCGCTGCCACTGG - Intronic
1073101089 10:101007088-101007110 GCCCGGGAGCTCGCTGACCTGGG + Exonic
1074182733 10:111077972-111077994 ACGCGGGCGCCCGCTGGCCTGGG - Exonic
1075040584 10:119104269-119104291 GCCCGGGCTCCCGCGGCCCCCGG + Intronic
1075466800 10:122657554-122657576 GCCCCCGAGCCCTCTGTCCTGGG + Intergenic
1075522196 10:123149576-123149598 GCCCGAGCCTCCGCTGCCCTTGG - Exonic
1076300062 10:129419076-129419098 GTCCACTTGCCCGCTGCCCTGGG - Intergenic
1076554275 10:131311787-131311809 GCCCGCGCCGCCGCCGCCCCCGG + Intergenic
1077718921 11:4607951-4607973 CCCCACCCGCCCGCTGTCCTGGG - Intronic
1078179988 11:9003647-9003669 GCCCGGCCCGCCGCTGCCCTTGG - Intronic
1078729566 11:13963053-13963075 GCCCTCGCGCCGCGTGCCCTGGG - Exonic
1079095799 11:17509496-17509518 TCCCACCCGCCCACTGCCCTCGG - Exonic
1080012443 11:27472377-27472399 GCCCGCAGGCCGGCTGCCCGGGG - Exonic
1080384827 11:31805147-31805169 GCCCGCGACCCCGCGCCCCTCGG + Intronic
1083272897 11:61580928-61580950 GCCCGCTCGGCCCCCGCCCTCGG - Intronic
1084174369 11:67415839-67415861 CCCCGGGCGCCCGCTCCCCGCGG + Intronic
1084284044 11:68120622-68120644 GGCCGCGAACCCGCTTCCCTTGG + Intronic
1084946665 11:72642399-72642421 GCCGGCCCGGCCGCTGCGCTCGG + Intronic
1085396067 11:76207787-76207809 CCCCGCCCGCCCGCAGCCCGCGG + Intronic
1089712415 11:120325317-120325339 GCCCGGGCGCCCGCAGCTCCCGG - Exonic
1090780628 11:130003252-130003274 GCACGGGCGCAGGCTGCCCTCGG - Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1096771595 12:53939141-53939163 GGCCGCCCGCCGGCTCCCCTGGG + Exonic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1097141741 12:56908325-56908347 TCCCTGGAGCCCGCTGCCCTCGG + Intergenic
1097872102 12:64610409-64610431 GCCCGCGACCCCGCCTCCCTGGG - Intergenic
1099443823 12:82728867-82728889 GCCAGCCAGCCCGCTGCACTGGG + Intronic
1100315473 12:93441485-93441507 TCCCGCGCGCCCGCGGCCTCCGG + Intronic
1100539955 12:95548597-95548619 TTCCGCGCGCCCGCAGCCCCAGG + Intronic
1101037193 12:100717342-100717364 CCCCGCGCGCCGGCAGCTCTAGG + Intergenic
1101371945 12:104138306-104138328 GCCCGCGCGCCCGCCCGCCGCGG + Intergenic
1103722050 12:122980445-122980467 ACCCACGCCCCCGGTGCCCTGGG - Exonic
1103764650 12:123271621-123271643 CCCGGCGCGCCCGCCGCCCGGGG - Exonic
1104011428 12:124933218-124933240 TCCCGCCCGCCCGCTGCCTACGG + Intergenic
1104444876 12:128824606-128824628 GCCCCCGTGCTCCCTGCCCTGGG + Intergenic
1104865333 12:131950134-131950156 GCCCGCTCGCCGGCCGGCCTCGG + Intronic
1108727791 13:53201119-53201141 GCCGCCGCCGCCGCTGCCCTCGG + Intergenic
1111672749 13:91348958-91348980 GCCCGCGTCCCCGCCGCACTCGG + Intergenic
1112290892 13:98143361-98143383 GCCCGCGCCGCCGCCGCCCGCGG + Intronic
1112494772 13:99896072-99896094 GCCCGCGCCCCCGGTGCGCGCGG + Exonic
1112567614 13:100564814-100564836 GCCCCCCCGCCCCCTGCCCGGGG - Intronic
1113473217 13:110561541-110561563 GCCCCCGCGCCCTCTCCCCGAGG + Exonic
1115203122 14:30874600-30874622 GCACCCGCGCCCGCCGCCCGGGG - Intronic
1115754227 14:36517458-36517480 GCCGGCGCCACCGCTGCCCACGG + Exonic
1117092856 14:52267970-52267992 TCCACTGCGCCCGCTGCCCTCGG + Exonic
1119323351 14:73744458-73744480 ACCCGAGGGCCCCCTGCCCTTGG + Intronic
1122792590 14:104190595-104190617 TCCCGCACGCCCCCTTCCCTGGG - Intergenic
1123630638 15:22257889-22257911 GACGCCGCGCCCGCGGCCCTGGG + Intergenic
1123689345 15:22823866-22823888 GGCCGCCAGCCCGATGCCCTTGG - Exonic
1127103175 15:55588010-55588032 GCCCGCGTCCCCACCGCCCTCGG - Intronic
1128733012 15:70033693-70033715 GCCCGCCCGCCCGCTGGGGTAGG - Intergenic
1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG + Intergenic
1129933692 15:79432180-79432202 GCCCGCGCTCCAGCGGCCCCGGG - Intergenic
1130296293 15:82648633-82648655 GCCCCTGCGCCAGGTGCCCTAGG - Intronic
1132525093 16:410513-410535 GGCCGCCCGCTCCCTGCCCTGGG + Intronic
1132525107 16:410548-410570 GGCCGCCCGCTCCCTGCCCTGGG + Intronic
1132663817 16:1072853-1072875 GCGCGGGCACCCCCTGCCCTCGG + Intergenic
1132934778 16:2474877-2474899 GTCCGGGCCCCCGATGCCCTCGG + Intergenic
1134131027 16:11650369-11650391 GCGCGCGCGCGCGCTGTCCATGG - Intergenic
1135323411 16:21511742-21511764 GCCCGCCCCTCCCCTGCCCTAGG - Intergenic
1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG + Exonic
1136778918 16:32885385-32885407 GCCCGCGGGGCCGTCGCCCTTGG + Intergenic
1136891700 16:33976133-33976155 GCCCGCGGGGCCGTCGCCCTTGG - Intergenic
1137268084 16:46884831-46884853 GCGCTCGCGCCGGCTGCGCTCGG - Exonic
1137926685 16:52547230-52547252 GGCGGCGCGCCAGCTGCCCGCGG - Intronic
1139806074 16:69566258-69566280 TCCCCCCCTCCCGCTGCCCTCGG + Exonic
1139853787 16:69965468-69965490 ACCCGGGCGCGCGCTGCCCGAGG + Intergenic
1139890686 16:70251664-70251686 GCCGCCGCGCTCGCCGCCCTCGG + Exonic
1142035615 16:87860826-87860848 GCCCGCCCCTCCCCTGCCCTAGG - Intronic
1142209886 16:88803982-88804004 GCCCGCCCGCCCGCCGCCCCCGG + Exonic
1142275508 16:89116658-89116680 CCCCACCCGCCCACTGCCCTGGG - Intronic
1203081330 16_KI270728v1_random:1147474-1147496 GCCCGCGGGGCCGTCGCCCTTGG + Intergenic
1143205191 17:5136245-5136267 GCCTGGGCTCCTGCTGCCCTTGG + Intronic
1144519580 17:15945031-15945053 GCCCGCGCGCCCGCCCGTCTCGG - Exonic
1144871861 17:18376851-18376873 GCCCGGGAGCCCGATGCACTTGG - Intergenic
1144876240 17:18398937-18398959 GCCCAGGCTCCTGCTGCCCTTGG + Intergenic
1145155988 17:20545483-20545505 GCCCAGGCTCCTGCTGCCCTTGG - Intergenic
1145286650 17:21511441-21511463 GCCCGGGACCCCGCTGCGCTGGG + Intergenic
1145390963 17:22454900-22454922 GCCCGCGACCCCGCTGCACTGGG - Intergenic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1146053008 17:29567465-29567487 CCGCGCGCGCGCTCTGCCCTCGG + Intronic
1146053296 17:29568634-29568656 GCCCGCGCGTCCGTTGGCCCTGG - Exonic
1146058597 17:29593212-29593234 GGACGCGCGCCCGCAGCCCCCGG - Intronic
1146143511 17:30389135-30389157 CCCCCAGAGCCCGCTGCCCTGGG - Intronic
1146843452 17:36169551-36169573 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146864860 17:36330886-36330908 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1146871667 17:36381400-36381422 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146879026 17:36432482-36432504 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1146882967 17:36453628-36453650 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1147067719 17:37931480-37931502 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147074553 17:37982024-37982046 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147079250 17:38011035-38011057 GCCCGGGCTCCTGCTGCCATCGG + Intronic
1147086076 17:38061563-38061585 GCCCGGGCTCCTGCTGCCATCGG - Intronic
1147095189 17:38134977-38134999 GCCCGGGCTCCTGCTGCCATCGG + Intergenic
1147102021 17:38185528-38185550 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1147150427 17:38510787-38510809 GCCCGCGCGCCCGCAGGCTCCGG - Exonic
1147888644 17:43701550-43701572 ACCCGCTCGCCCGCTGCCCTCGG - Intergenic
1147971519 17:44220921-44220943 GCCCGCCCGCCCGCCCGCCTCGG + Intronic
1148386569 17:47238554-47238576 GCCCCAGAGCCCGCCGCCCTGGG - Intergenic
1148406959 17:47424024-47424046 GCCCGAGGGCCCGCTGCTCCGGG + Intronic
1148894311 17:50831197-50831219 GCCCGCGCGGCCTCGGGCCTGGG - Intergenic
1149846612 17:60012038-60012060 GCCCGGGCTCCTGCTGCCATCGG - Intergenic
1150490816 17:65573188-65573210 GCCCCAGTGCCCGCTGCCTTGGG - Intronic
1152426349 17:80220567-80220589 GCCCCCGCGTCGGCTGCCCCCGG - Intronic
1152654990 17:81515114-81515136 GCCCGCCCGCCCGCATCCCAGGG - Intronic
1152743178 17:82027432-82027454 GCCCGCTCACCTGCTGCTCTTGG - Exonic
1154241344 18:12657218-12657240 GCCCGCGGGACAGCTGCCCGCGG - Intronic
1159021231 18:63144871-63144893 ACCCCCGCCCCCGCCGCCCTGGG + Intronic
1159578277 18:70206009-70206031 GCCGCGGCGCCCGCTGGCCTGGG + Intergenic
1160859358 19:1231104-1231126 GCCAGCCCGCCCCCTGCTCTCGG - Exonic
1160930594 19:1568014-1568036 GCCCCCGCCCCCGCCGCCGTCGG + Exonic
1160987918 19:1848174-1848196 GCCCGCCCGCCTGCTTGCCTTGG - Intronic
1160993802 19:1872718-1872740 GCCCGCGCTCCCTCGGCACTCGG - Intergenic
1161124129 19:2546425-2546447 GCCCTCCCGCCCGCAGCCCTGGG - Intronic
1161975354 19:7605428-7605450 GCCCGAGCGCCCGGTGCGCGAGG + Exonic
1162486012 19:10961019-10961041 GCGCGCGCGCCCGCCCGCCTCGG - Exonic
1162771039 19:12949417-12949439 GCCCTAGCTCCCTCTGCCCTTGG - Intronic
1163105354 19:15120008-15120030 GCCCGAGGGACCGCTGCCCCTGG - Exonic
1163243211 19:16076776-16076798 GCCCGCCCGCGCGCAGTCCTCGG + Intronic
1163559386 19:18009937-18009959 GCCACAGCGCCCGCTGCCCGGGG - Exonic
1163612773 19:18309730-18309752 GCCTCCGCGGCCGCGGCCCTTGG + Exonic
1165459482 19:35936378-35936400 GCCGGTGCGCGCGCTGCCCTGGG + Intronic
1167049722 19:47070992-47071014 GCGCCCCCACCCGCTGCCCTCGG + Intronic
1167293189 19:48635603-48635625 GCCCCCGCCCGGGCTGCCCTCGG - Exonic
1168076311 19:53982512-53982534 CCCCGCGGCCACGCTGCCCTTGG - Exonic
1168307219 19:55442324-55442346 GCCCTCGCCCCCGCGGCCCCCGG + Exonic
1168495012 19:56840540-56840562 CCCCGCGCGCCTCCTGCCCGCGG - Intronic
927567226 2:24123639-24123661 GGCCGCGGGCCTGCTGGCCTTGG + Intronic
928093769 2:28392165-28392187 CCCGGGGCGCCCGCTGCACTCGG + Intergenic
931253778 2:60553844-60553866 GCCCCAGCGCCCCCTCCCCTCGG - Intergenic
931711000 2:64989165-64989187 GCCCGCGCCCCCGCGGCCTCGGG + Intronic
934857733 2:97739493-97739515 GCCTGAGCTCCCGCTGCCCAGGG + Exonic
935137843 2:100322569-100322591 GCCGGCGCGCCAGCAGCCCGCGG - Exonic
937904102 2:127043620-127043642 TTCCGCCCTCCCGCTGCCCTAGG + Intergenic
937904828 2:127047919-127047941 CCCCGAAGGCCCGCTGCCCTGGG - Intergenic
940971973 2:159904797-159904819 GGCCCCGCCCCCGCCGCCCTCGG + Intergenic
942034730 2:171999848-171999870 GCGCGCACGCGCGCTCCCCTCGG + Exonic
942278554 2:174340374-174340396 GCCCGGGCGCCCGCGTTCCTGGG - Intergenic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
945969424 2:216221421-216221443 GCCAGCACGCCTGCAGCCCTGGG - Intergenic
946397038 2:219448418-219448440 GCCGGCGCCCCTGCGGCCCTGGG + Exonic
946683271 2:222240118-222240140 CCCCGAGTGCCTGCTGCCCTGGG + Intronic
948665997 2:239535321-239535343 GCCCGCCTGCTTGCTGCCCTTGG - Intergenic
948856868 2:240734319-240734341 GCTGGCTGGCCCGCTGCCCTTGG - Intronic
1169191459 20:3661138-3661160 GTCCCCGCGCCCGCTGCCGCCGG - Exonic
1170524691 20:17226596-17226618 GCCGGCGCCCCTGCTCCCCTCGG + Intronic
1170629944 20:18057517-18057539 GCCCCCGCGCGCGCTCACCTGGG + Exonic
1170999285 20:21396880-21396902 TCCCGCGCCCCCGCGCCCCTCGG + Intronic
1172764928 20:37346234-37346256 GCCCGCCCGCCCGCCGGCCCAGG + Exonic
1173548101 20:43914688-43914710 GCCCCCGGGCCCCCGGCCCTAGG + Intergenic
1175259450 20:57665380-57665402 GTCCGCCCGCCCCCTGCCCCGGG + Intronic
1175958000 20:62621242-62621264 TCCCGTGCCTCCGCTGCCCTGGG + Intergenic
1176062030 20:63176649-63176671 GCCCCTGCGCCATCTGCCCTCGG - Intergenic
1176111876 20:63414571-63414593 GCCCCAGCACCCGCTGCTCTTGG - Intronic
1181026967 22:20132146-20132168 CCCCGCCCGCCCACTGCCCGGGG - Intronic
1181570925 22:23767544-23767566 GCCCGCGCACCCACCGCCCTCGG - Exonic
1181610081 22:24006345-24006367 GCCCGTGTGGCGGCTGCCCTTGG - Intergenic
1183546151 22:38455628-38455650 CCCCGCTCGCCCTCTGCCCGCGG + Intergenic
1183546222 22:38455850-38455872 GCCCGAGCTCCCGCCGCCCGCGG + Intergenic
1183560790 22:38570711-38570733 CCCCCCGCCCCCGCTGCCCATGG + Intergenic
1183665721 22:39244691-39244713 GCCCGCCCGCTCGCCGCTCTGGG + Exonic
1183689211 22:39378805-39378827 GCCTGGGCCCCCGCTGGCCTGGG - Intronic
1183831115 22:40418723-40418745 GCCCCCGCCCCCGCCCCCCTCGG - Exonic
1184663452 22:45976056-45976078 CCCCGCCCGCCCGGGGCCCTGGG - Intronic
1185313809 22:50170416-50170438 GCCCGCCCGCCCCCTGACCCCGG + Intergenic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
950798668 3:15531759-15531781 GCCCTCAAGCCCGCTGCCCAAGG - Intergenic
953369613 3:42376314-42376336 GCCCCCCCACCCTCTGCCCTGGG + Intergenic
954004108 3:47578530-47578552 GCCAGCGGGACCCCTGCCCTGGG + Intronic
954147311 3:48640774-48640796 GCCCGCCCTCCCCCTGCCCCGGG - Intronic
960338322 3:116445413-116445435 GCCCGCCCGCCCGCCAGCCTGGG - Exonic
960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG + Intronic
961545237 3:127628949-127628971 GCCCGGCCGCCCGCAGACCTGGG - Intergenic
963163767 3:142180166-142180188 TCCCGTGCGCCCACTCCCCTTGG + Intronic
966378835 3:179323335-179323357 GCCCGCACGCCCGCGTCCCCTGG - Intronic
966595157 3:181719431-181719453 GGCCTCCCGCCGGCTGCCCTGGG + Intergenic
967981791 3:195070157-195070179 GCCTGCCGGCCTGCTGCCCTGGG + Intronic
968093231 3:195910442-195910464 CTCCACGCGCCCGCTGCCCAGGG - Intronic
968104257 3:195990070-195990092 GTCCCCGCGCCCCCTGCCCGGGG - Intergenic
968161781 3:196432552-196432574 GCCCGCGCGCTCCCAGCTCTCGG + Intergenic
968302558 3:197627660-197627682 GTCCCCGCGCCCCCTGCCCGGGG - Intergenic
968479098 4:826012-826034 GGCCGGGCGCGCGCTGCGCTCGG + Intronic
968740792 4:2330823-2330845 CCCCACGCACCCGCTGCCCTGGG - Intronic
969240332 4:5893003-5893025 GCCTGCCCGCCCGCGGCCCTGGG + Exonic
969714582 4:8862065-8862087 GCCCCGGCGCCAGGTGCCCTGGG + Intronic
969788127 4:9474291-9474313 GGCCGGGCGCCCCCCGCCCTGGG + Intergenic
972629133 4:40828457-40828479 GCCCTCTTGCTCGCTGCCCTGGG - Intronic
973754878 4:54064664-54064686 GCCCGCCCGCCCGTTGGCCCGGG - Exonic
978532592 4:109730028-109730050 ACCAGCGCGCCCGCTCACCTGGG + Exonic
984928282 4:184825724-184825746 GCCCGCGGCCCCGCTTCCCTCGG - Intronic
987082808 5:14440993-14441015 GCGCGCGCGCGCGCTGCAGTTGG - Intronic
992487478 5:77210531-77210553 GCTCCCGCACCCGCGGCCCTGGG - Intronic
998138697 5:139688103-139688125 CCCCGCCCACCCGCAGCCCTGGG + Intergenic
999399561 5:151253782-151253804 GCCTGTGACCCCGCTGCCCTTGG + Intronic
1002591045 5:180291868-180291890 GCCCGCCCGCCCTCTCCCCGTGG - Exonic
1002645257 5:180649605-180649627 GCGCGGGCGCCGGCTGGCCTGGG + Exonic
1003290552 6:4775899-4775921 GACGGCGCGGCCGCTGCCGTCGG + Intronic
1003870384 6:10398270-10398292 GCCGCCGCCGCCGCTGCCCTTGG - Exonic
1004216654 6:13710822-13710844 GCCCTCGCGGGCTCTGCCCTCGG - Intronic
1006161867 6:32043929-32043951 GCCCACCCTCCAGCTGCCCTGGG - Intronic
1007161097 6:39792426-39792448 GCCCGCGCTCCCGCAGCCCGAGG - Intronic
1008673224 6:53794510-53794532 GCCCGTGTGCCCGCTGCTCACGG - Intronic
1008816921 6:55579245-55579267 CCCCGTGCACCCGCTGCCCCAGG - Intergenic
1015503129 6:133953442-133953464 GCCCGCGCTCCCTGTGCCCAGGG - Intronic
1015526007 6:134175658-134175680 GCCCCGCCGCCCGCTGCCCATGG - Intronic
1016447669 6:144150220-144150242 TCCAGCGCGCTCCCTGCCCTGGG + Intergenic
1018433965 6:163744605-163744627 GCCTGCCCGCCCGCCTCCCTGGG - Intergenic
1019381617 7:727107-727129 GCCCGCGCGCCGCCCGCCCGAGG + Exonic
1021106787 7:16646528-16646550 GCCCGCCCGCCCGCGGTCCCAGG - Intronic
1022094440 7:27130196-27130218 CCCCGCGTGCCCGCTGCTCTTGG - Exonic
1026941392 7:74289754-74289776 GCCCGCGCGACCCCCTCCCTCGG - Intronic
1028364703 7:90013912-90013934 GCCCCCGCTCCCCCTGCCCAGGG - Intergenic
1028417669 7:90596743-90596765 CCCCCAGCGCCCGCTCCCCTCGG + Intronic
1029424872 7:100489018-100489040 GCCGGCGCCCCCGCCGCCTTAGG - Exonic
1033253096 7:139777510-139777532 GGCCCCGCGCCCGCAGCCCCCGG - Intronic
1035267716 7:157700795-157700817 GCCCTCGCGGCCGCTGACCAGGG - Intronic
1037348316 8:17923194-17923216 GCCTGCGCGTCCCCAGCCCTTGG + Intronic
1038540376 8:28385917-28385939 CCCCGCGCGCCCGCGGCTGTCGG - Intronic
1041449919 8:57995058-57995080 CCCCGCGCCCCCTCTGCGCTCGG + Intronic
1044820759 8:96154269-96154291 GCCGCCGCGCGCGCTTCCCTAGG + Intronic
1045215652 8:100145904-100145926 GCCCGGCCGCCCGCAGGCCTGGG + Intergenic
1048981170 8:139703915-139703937 GCCGCCGCGCCCGCCGCCCCCGG - Intergenic
1049755748 8:144310658-144310680 GACCGCGCTCCTGCTGCTCTGGG - Intronic
1049803196 8:144527548-144527570 GCCGGCGCGCCTGCTGCCCCTGG - Exonic
1049804601 8:144533190-144533212 CCCCGAGCGCCAGCTGCCCTGGG - Exonic
1050343354 9:4662618-4662640 GCCCGCGCCTCCGCTGCCCGAGG + Exonic
1053022057 9:34701686-34701708 GCCCGCGCATCCGATGACCTGGG + Intergenic
1054870546 9:70044278-70044300 GCCCCCGCTCCTGCTGCCCCCGG + Intronic
1056475052 9:86945720-86945742 GCCCTCGCGCCCCCCGCCGTTGG - Exonic
1057024591 9:91725442-91725464 GCCCAGGCACCAGCTGCCCTGGG + Intronic
1057361220 9:94374992-94375014 GCCCGCGAGCCCGCCGCTCCGGG + Intronic
1057662143 9:97013172-97013194 GCCCGCGAGCCCGCCGCTCCGGG - Intronic
1059387613 9:113977023-113977045 GCCTGGACGCACGCTGCCCTTGG - Intronic
1059942137 9:119369010-119369032 CCCCGCAGCCCCGCTGCCCTTGG - Intronic
1060855862 9:126914839-126914861 GCCCGCGCTCCAGCTGCGCCTGG + Exonic
1061754331 9:132802308-132802330 CCCCTCCCGCCCCCTGCCCTGGG - Intronic
1061889339 9:133609370-133609392 GCCAGCGCGCGCCCTGCGCTCGG - Intergenic
1062644562 9:137540798-137540820 GCCCGTGGCCCCACTGCCCTGGG - Intronic
1187904650 X:24054639-24054661 CCCGGCGCGCGCGCTGGCCTGGG - Intergenic
1190024904 X:46913318-46913340 GCCCGCGCTCCCGCTCCCGCCGG - Intronic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1198100014 X:133415219-133415241 GCCCGCGCCTCTGCTTCCCTGGG - Exonic
1199772638 X:150984151-150984173 GCCCCGGCGCCCGCGGCCCGGGG + Intronic