ID: 1145971882

View in Genome Browser
Species Human (GRCh38)
Location 17:28960970-28960992
Sequence GCAGCTGTTAAGACCAGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145971874_1145971882 28 Left 1145971874 17:28960919-28960941 CCTGGAGAGACGATGCGGCCGGT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1145971882 17:28960970-28960992 GCAGCTGTTAAGACCAGGACAGG 0: 1
1: 0
2: 1
3: 7
4: 136
1145971878_1145971882 10 Left 1145971878 17:28960937-28960959 CCGGTGGTGGCATTGCGGATCAC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1145971882 17:28960970-28960992 GCAGCTGTTAAGACCAGGACAGG 0: 1
1: 0
2: 1
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145971882 Original CRISPR GCAGCTGTTAAGACCAGGAC AGG Exonic
901203004 1:7477188-7477210 GCGGCTTCTAAGACCAGGGCTGG - Intronic
901531949 1:9859242-9859264 GCAGCTTTCTAAACCAGGACAGG + Intronic
901783748 1:11610980-11611002 GCAGCTCTGAAGACCAGGGAGGG + Intergenic
901897514 1:12327167-12327189 GCAGCTGGTAAGGGCAGAACAGG + Intronic
902839206 1:19064830-19064852 GGTGCTGTTCAGACCAGGGCTGG - Intergenic
904093666 1:27961520-27961542 GCAGTTGTTAAGTCCTGGGCAGG + Intronic
905161290 1:36037017-36037039 GCAGATGTTAAAAACAGGAGTGG - Intronic
905687352 1:39918071-39918093 GCAGCTTTCAAGAACAGGCCAGG + Intergenic
905818845 1:40973753-40973775 GCAGGTGTTCAGACCAGCCCAGG - Intergenic
906205464 1:43984216-43984238 GCAGCCTCTGAGACCAGGACAGG - Intronic
906749317 1:48244656-48244678 GCAACTGATAAGACCAGGCAGGG - Intronic
909350632 1:74649221-74649243 TCATCTCTTAAGATCAGGACTGG - Exonic
911157440 1:94651468-94651490 GCAGCTGTTCAGCCCAGTCCTGG + Intergenic
912988131 1:114455507-114455529 GCATCTGTTAAGACCTGTAAAGG - Intronic
919276785 1:195428552-195428574 CCAGCTGTTGCCACCAGGACAGG - Intergenic
924464972 1:244291489-244291511 GCAGCTGTTCAGACCATTAATGG - Intergenic
1063672375 10:8109670-8109692 GTGTGTGTTAAGACCAGGACAGG - Intergenic
1066076916 10:31888069-31888091 GCTGCTGTGAAGACCAGGGAGGG - Intronic
1072045735 10:91652882-91652904 GGAGCAGTGAAGAGCAGGACTGG - Intergenic
1072741218 10:97911114-97911136 GAAGCTGGTAAGACCAGGGCAGG - Intronic
1073490595 10:103850654-103850676 GCAGCTGTTCAGACCTGGAGGGG - Intronic
1074697095 10:116059407-116059429 GCAGCTGCCAAGCCCAGCACCGG - Intronic
1074872440 10:117587742-117587764 GCAGGTGAGAAGACCAAGACAGG - Intergenic
1076587052 10:131556401-131556423 GGAGCTGGTCAGACCAGGAGAGG + Intergenic
1076795054 10:132794289-132794311 GCCTCTGTGAAGACCTGGACGGG - Intergenic
1076942508 10:133619138-133619160 GCAGCTGTGAACACCTGGCCTGG - Intergenic
1077905508 11:6529865-6529887 GCAAATGTTAAGACAAGGACAGG - Intronic
1077962274 11:7088838-7088860 GAAGCCGTTAAGACCGGGTCAGG + Intergenic
1078755310 11:14203375-14203397 GCTGCTTTTAATACCAGGGCAGG + Intronic
1080486986 11:32718799-32718821 GCAGCTGGGAAGAGGAGGACTGG + Intronic
1084534981 11:69751251-69751273 GCAGCTCGTACCACCAGGACTGG + Intergenic
1084837307 11:71812404-71812426 GCAGCTTCTAAGACCAGGGAGGG + Intergenic
1084866083 11:72058833-72058855 GCAGCTGCTGAGACCAGAACAGG - Intronic
1085413289 11:76304446-76304468 ACAGCTAATAAGACCAGAACTGG + Intergenic
1090939489 11:131374476-131374498 GCAGCTGATAAGACGAGATCTGG - Intronic
1091239965 11:134045792-134045814 GCTGGTGTTAAGACCATGGCAGG - Intergenic
1092401392 12:8181675-8181697 GCAGCTTCTAAGACCAGGGAGGG - Intronic
1095418976 12:42005733-42005755 GCAACCTTTAAGACCTGGACAGG - Intergenic
1095841932 12:46702737-46702759 TCAGCTGTAAAGAGCAGTACTGG + Intergenic
1099438677 12:82673705-82673727 GCAGGTGTTATGAAAAGGACTGG + Intergenic
1102583918 12:113910056-113910078 GCAGCTCTGAAGTCCAGGCCAGG - Intronic
1102831580 12:116006687-116006709 GCAGCTTTTAACACCATGGCAGG - Intronic
1105883754 13:24625028-24625050 GAAGCTGTTCAGCCCAGGAGGGG + Intergenic
1109179190 13:59192699-59192721 GCAGCTCTCAAAACCAGGAGAGG - Intergenic
1110552565 13:76825522-76825544 GCATCTGGTAAGTGCAGGACTGG - Intergenic
1113228481 13:108185080-108185102 GCAGCTGTTACTACCAAGGCAGG + Intergenic
1113835037 13:113323112-113323134 TCAGCTTTAAAGGCCAGGACGGG + Exonic
1121019981 14:90573865-90573887 GGAGCTGATAAGGCCAGGATGGG - Intronic
1122637138 14:103135420-103135442 GGAGCTGTTAAGAGCAGCGCTGG + Exonic
1123124968 14:105940025-105940047 GCAGCAGTCAGGTCCAGGACTGG - Intergenic
1125410193 15:39398125-39398147 TCAGGTGTTAAGACCAGGTTGGG - Intergenic
1127714620 15:61637588-61637610 GAAGCTGGTAAGACCAGAACAGG + Intergenic
1128644971 15:69370357-69370379 GCATCTGTTAAGGGCAGGTCTGG - Intronic
1130808214 15:87349587-87349609 AAGGCTGTGAAGACCAGGACTGG - Intergenic
1131174764 15:90202439-90202461 GCAGATGTGAGGACCAGGAAAGG - Intronic
1132587205 16:710749-710771 GCAGCTGTCACGGCCAGGGCAGG - Intronic
1134408203 16:13981380-13981402 GCAGCCCTTTAGACCAGGCCAGG + Intergenic
1145740599 17:27270927-27270949 GCAGCTTTTAAAACCAGGTTGGG + Intergenic
1145971882 17:28960970-28960992 GCAGCTGTTAAGACCAGGACAGG + Exonic
1148133202 17:45274610-45274632 GCAGCTGTTAAGACAGGGTGAGG + Intronic
1149557020 17:57580518-57580540 GCAGCTAGCAAGACCAGCACTGG - Intronic
1151877889 17:76877614-76877636 GCAGCAGAGAAGACAAGGACAGG - Intronic
1152841972 17:82575631-82575653 GCAAATGTTAAGACTAGGAGTGG + Intronic
1153892417 18:9530378-9530400 GCAGCGATGGAGACCAGGACGGG + Intronic
1154949799 18:21198639-21198661 GCATCTGTTAAGACCCAGAGAGG + Intergenic
1157198774 18:45641477-45641499 CCAGCTGTTAAGGGCAGCACTGG - Intronic
1157729779 18:49993584-49993606 GAAGCTGCTGAGCCCAGGACTGG + Intronic
1158671716 18:59480700-59480722 TCAACTATTAAGACCAAGACTGG + Intronic
1159020990 18:63142991-63143013 GCAGCTGTTAGTACCAGGACAGG + Intronic
1163889837 19:20000966-20000988 GAACCTGAGAAGACCAGGACAGG + Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1166534647 19:43564981-43565003 GCAGCTTTGAAGACGAGGAAGGG - Intronic
925409073 2:3628419-3628441 GGTGCTGTTAAGACCAGTGCAGG - Intronic
930738821 2:54808225-54808247 GCATCTCTTGGGACCAGGACTGG + Intronic
932475776 2:72004942-72004964 GCAGCTGTGGGAACCAGGACTGG + Intergenic
934915207 2:98295865-98295887 GCAGCTGTAGGGCCCAGGACTGG - Intronic
936622844 2:114118252-114118274 GCATCTGTAAAGAGCAGGAGTGG - Intergenic
938193605 2:129304677-129304699 GTAGCTGTAAAGACCAGGTGGGG + Intergenic
942169681 2:173277537-173277559 ACAGCTGACAAGACCAGGAATGG - Intergenic
946013204 2:216583132-216583154 GCAGCTATTAATACATGGACTGG - Intergenic
1171141934 20:22750914-22750936 ACAACTGAGAAGACCAGGACAGG + Intergenic
1173905675 20:46626841-46626863 GCAGGTGCAAAGACCTGGACGGG - Intronic
1178468557 21:32871180-32871202 TCAGCTCCTAAGACCAGGCCTGG + Intergenic
1179649870 21:42801110-42801132 TCATCAGTTAAGACAAGGACTGG + Intergenic
1183541085 22:38429772-38429794 GCAGCTGGCAGGGCCAGGACTGG + Intronic
1185095993 22:48806387-48806409 GCAGTGGCTCAGACCAGGACTGG - Intronic
1185181169 22:49364250-49364272 GAAGATGTGAAGACCAGGTCAGG - Intergenic
952033839 3:29176125-29176147 GCAGATTTTAAGACAAAGACTGG - Intergenic
958737132 3:98022589-98022611 GAAGCTGTTCTGACCAAGACAGG + Intronic
960118243 3:113919686-113919708 ACAGTTGTTAACATCAGGACAGG - Intronic
960439901 3:117674243-117674265 GCAGCTGTCAAAGCCAAGACAGG + Intergenic
960965428 3:123101075-123101097 GAAGCTGTTGAGAACAGGTCAGG + Intronic
961834307 3:129644028-129644050 GCAGCCCCTAAGACCAGGACAGG + Intergenic
962465116 3:135650412-135650434 GCAGCTGAGAACAACAGGACTGG - Intergenic
962854298 3:139330132-139330154 GCAGCTGTTAGGGCTTGGACAGG + Intronic
962959607 3:140298591-140298613 GAAGCTGTGAAGCCCAGGAGGGG + Intronic
964743547 3:159990426-159990448 GCAGCTGTCAACAGCAGGAGAGG + Intronic
969778717 4:9379895-9379917 GCAGCTTCTAAGACCAGGGAGGG + Intergenic
971367721 4:25991105-25991127 GCAGCTGTGAGGATCAGGGCAGG - Intergenic
972728096 4:41764157-41764179 GAGGCTGCTAAGAGCAGGACAGG - Intergenic
973980192 4:56302153-56302175 GCAGATCTTAAGAGCAGGAGGGG - Intronic
974858470 4:67490283-67490305 GCAGCTTTTAAGACAGAGACAGG - Intronic
979183024 4:117754457-117754479 GCAGCAGTAAAAACCAGGAGAGG - Intergenic
979678543 4:123435342-123435364 GCAGGTGTGCAGCCCAGGACTGG - Intergenic
982476338 4:155856076-155856098 GCAGGTTTTAACACCAAGACAGG - Intronic
984703423 4:182832914-182832936 GCTGCTGTTGTGCCCAGGACAGG + Intergenic
985665935 5:1181546-1181568 GCAGCCTTCAAGGCCAGGACTGG - Intergenic
987114857 5:14718184-14718206 GAAGCTGTAAACACCAGGATGGG - Intronic
991412752 5:66361165-66361187 GCAGCTTTCAAAACCAGAACAGG + Intergenic
993909266 5:93661489-93661511 ACAGCTGTTGAAACCAGGAAGGG + Intronic
994147824 5:96414158-96414180 ACAGCTGGTAAGAGCAGAACTGG - Intronic
996950394 5:129119105-129119127 GAAGCTCTTAAGAGCAGAACTGG - Intergenic
997693773 5:135845562-135845584 GTAGGTGATAAGGCCAGGACTGG - Intronic
998897332 5:146813899-146813921 GCAACAGTTTAGACCAGGACAGG + Intronic
999438886 5:151585971-151585993 GAAAGTGTTAAGGCCAGGACTGG + Intergenic
1002192352 5:177484890-177484912 GCCGGTGTCAAGCCCAGGACAGG - Intronic
1002839959 6:896912-896934 GCTGCTGTTCAGAGCAGGGCAGG + Intergenic
1005345735 6:24888278-24888300 GGAGCTGATAATACCAGGAATGG - Intronic
1011711943 6:90064287-90064309 GCATCTGTCAAGGCCAGGCCAGG - Intronic
1013137342 6:107295232-107295254 ACAGATGTTAAGAACAGAACTGG - Intronic
1017585596 6:155919171-155919193 GCAGCAGTTCTGACCAGGAAGGG - Intergenic
1019075692 6:169386574-169386596 GCATCCGTGAAGCCCAGGACAGG + Intergenic
1019640685 7:2101935-2101957 GCAGCTGGGAAGACCCTGACTGG + Intronic
1020816312 7:12910023-12910045 ACAGCTGGTAACCCCAGGACTGG + Intergenic
1022803294 7:33796080-33796102 GCAGCTATTATAACCAGGAGAGG - Intergenic
1026660840 7:72301206-72301228 GCAGTTGCTAAGATCTGGACTGG + Intronic
1027558609 7:79697876-79697898 GCCACTGTTAAGGTCAGGACTGG + Intergenic
1030327514 7:108236398-108236420 GCAGCTGGAAAGACAAGGAGGGG - Intronic
1033424699 7:141233544-141233566 GCACCTGTTAAGAGCTAGACTGG + Intronic
1033435616 7:141330997-141331019 GCAGCTGCTAAGACCAAAAAAGG - Intronic
1034625942 7:152492819-152492841 GCAGCTCTCAGAACCAGGACAGG + Intergenic
1034852453 7:154507640-154507662 GCAGCAGGCAAGAGCAGGACTGG + Intronic
1034982861 7:155489741-155489763 GGAGCTGGTAAGGCCAGGAAGGG + Intronic
1036276164 8:7353868-7353890 GCAGCTTCTAAGACCAGGGAGGG + Intergenic
1036840516 8:12117246-12117268 GCAGCTTCTAAGACCAGGGAGGG - Intergenic
1037538801 8:19852690-19852712 GCTGCTGAAAAGCCCAGGACAGG + Intergenic
1040899387 8:52402819-52402841 GCAGCTGTTCAGCCCAGGGGTGG + Intronic
1042611797 8:70608236-70608258 GCAGCTGGGAAGAGCAGAACCGG - Exonic
1045358565 8:101411419-101411441 TAAGATGTTAAGAGCAGGACTGG + Intergenic
1050339892 9:4626198-4626220 GCAGCTGTTAAGGCGAAGAATGG - Intronic
1056548965 9:87635805-87635827 GCAGAAGTTAAGACTTGGACTGG + Intronic
1056697524 9:88872418-88872440 GCAGCTTTAATGACAAGGACTGG - Intergenic
1188231702 X:27671714-27671736 GAAGCTGTGAAGACCAGGTATGG - Intronic
1193041056 X:77004237-77004259 GCAGCTGGTACCACTAGGACAGG + Intergenic
1199511815 X:148630815-148630837 GCAGCTATGAAGAACAGGTCAGG - Intronic