ID: 1145972935

View in Genome Browser
Species Human (GRCh38)
Location 17:28967593-28967615
Sequence CCAGAGTGGAGGAGGTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145972920_1145972935 21 Left 1145972920 17:28967549-28967571 CCCAGTCCAGGATGGGATGGAGA 0: 1
1: 0
2: 0
3: 26
4: 178
Right 1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG 0: 1
1: 0
2: 1
3: 26
4: 299
1145972921_1145972935 20 Left 1145972921 17:28967550-28967572 CCAGTCCAGGATGGGATGGAGAA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG 0: 1
1: 0
2: 1
3: 26
4: 299
1145972924_1145972935 15 Left 1145972924 17:28967555-28967577 CCAGGATGGGATGGAGAAAGGGG 0: 1
1: 1
2: 3
3: 43
4: 411
Right 1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG 0: 1
1: 0
2: 1
3: 26
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145972935 Original CRISPR CCAGAGTGGAGGAGGTTAAG AGG Intronic
900576361 1:3384357-3384379 CCAGAGTGGGGGAGGCTGGGGGG + Intronic
901909044 1:12439468-12439490 CAAGAGGGGAGGAGGAGAAGAGG - Intronic
902044007 1:13512251-13512273 CCAGGGCGGAGGGAGTTAAGGGG - Intronic
902806866 1:18866391-18866413 CCAGGGCTCAGGAGGTTAAGTGG + Intronic
903279398 1:22242008-22242030 CCAGGGCTGAGGAGGGTAAGGGG + Intergenic
903680124 1:25090899-25090921 GCAGGGTGGAGGAGGCAAAGGGG + Intergenic
904575118 1:31500425-31500447 CCAGGGTGGCCGAGGTTTAGAGG + Intergenic
905284376 1:36869747-36869769 CCAGAGTGGTGAAGATGAAGTGG + Exonic
905917338 1:41694953-41694975 CCAGAGTCTGGGAGGTTGAGGGG + Intronic
909729515 1:78874959-78874981 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
912975225 1:114323673-114323695 CCTGAGAGGAGTAGGTGAAGAGG + Intergenic
914294580 1:146307924-146307946 CCAGAGTGTAAGGGGTTGAGAGG + Intergenic
914555624 1:148758707-148758729 CCAGAGTGTAAGGGGTTGAGAGG + Intergenic
915435983 1:155906814-155906836 CCAGAGTGGGTGAGGTACAGTGG + Intronic
915834253 1:159162220-159162242 CTAATGTAGAGGAGGTTAAGGGG + Intergenic
917171361 1:172178829-172178851 CTAGATTGCAGGGGGTTAAGGGG + Intronic
917846593 1:179025733-179025755 CCGGTATGGAAGAGGTTAAGGGG + Intergenic
918508939 1:185289080-185289102 GCAGACTGGAGGATATTAAGAGG - Intronic
919750152 1:201032616-201032638 CCAGATTAGTGGAGGTTGAGTGG + Intergenic
920267736 1:204736963-204736985 CCAGACTGTAGCAGGTTAATTGG + Intergenic
920309709 1:205041905-205041927 CCTGAGTGGAGGAGGTCCTGGGG - Intergenic
920791758 1:209099452-209099474 CCAGAATGGAGAAGCTTGAGAGG + Intergenic
920922224 1:210307513-210307535 ACAGAAGGGAGGAGGTTTAGTGG - Intergenic
921349379 1:214219977-214219999 CCAGAATGGAGCAGGTCAGGAGG + Intergenic
923379573 1:233402219-233402241 CCAGAGGGGAGGAGGAAATGGGG + Intergenic
923540896 1:234887402-234887424 AAAGAGTGGTGGAGGCTAAGGGG - Intergenic
923620846 1:235577862-235577884 CCAGAGAGGAGGAAGGAAAGAGG - Intronic
923772286 1:236948085-236948107 CCAGAGAGGGGGAGGCTCAGAGG + Intergenic
924768607 1:247057839-247057861 CAATAGTGGAGGAGGTGGAGGGG + Intronic
1064337974 10:14460746-14460768 CCAGAGTTGAGTGGGTTAGGAGG + Intronic
1064656090 10:17557729-17557751 CTAGTGTGGAGGAGGATGAGAGG - Intergenic
1066103314 10:32136703-32136725 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1066981718 10:42422745-42422767 GCAGAGTGGAGGCAGTGAAGAGG - Intergenic
1067360482 10:45573871-45573893 CCAGAGTTGGGGAGTGTAAGAGG - Intronic
1069614597 10:69798941-69798963 CCACAGTGGAGGAAGAGAAGTGG + Intergenic
1069656881 10:70096559-70096581 CCAGGGTGGAGGAGCTTGGGAGG + Intronic
1070023656 10:72610803-72610825 GCTGAGTGGAGGAGGTTAGAGGG + Intronic
1070305906 10:75238960-75238982 CCGGAGCGGTGGAGGTTGAGGGG + Intergenic
1070749331 10:78954706-78954728 CCCGTGTGGAGGAGGACAAGAGG + Intergenic
1072433630 10:95396018-95396040 CCAGACTGGATGTGGGTAAGGGG + Intronic
1073352769 10:102831617-102831639 CCAGAGTGGAAGAGGAAAAGTGG + Intronic
1073394703 10:103208237-103208259 CCAGAGTGGGGGAGTTTCAAGGG - Intergenic
1074402272 10:113151933-113151955 CCAGAGTGCAGCAGGTCAGGTGG + Intronic
1075013570 10:118894615-118894637 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1075324970 10:121524262-121524284 GGGGAGTGGAGGTGGTTAAGAGG - Intronic
1076020633 10:127069822-127069844 CCAGAGTCGAGGAGGTGAGTAGG + Intronic
1076677756 10:132156271-132156293 GCAGGATGGAGGAGGATAAGGGG - Intronic
1077178681 11:1202779-1202801 CCAGAGTGGAGGCGGTGACGTGG + Intergenic
1077353950 11:2106101-2106123 CCAGAGTGCAAGAGGAGAAGTGG - Intergenic
1078083369 11:8219352-8219374 CCAGAGAGGAGCTGGTTCAGGGG + Intergenic
1078789070 11:14525128-14525150 CCAGAGTGGGGGAGTTTTAAGGG - Intronic
1079542296 11:21591171-21591193 ACATAGAGGAGGAGGGTAAGAGG + Intergenic
1080227442 11:29976071-29976093 CCACAGTTGGGGAGTTTAAGAGG - Intergenic
1081741940 11:45447042-45447064 CCAGTGTGGTGGAGGTGAGGCGG + Intergenic
1084000376 11:66292492-66292514 CTAGAGGGGAGGAGGGGAAGAGG + Intronic
1084607074 11:70178637-70178659 CCAGGGAGGCGGAGGTTATGGGG - Intronic
1085411117 11:76291327-76291349 CCAGAGGGGAGCAGGGGAAGGGG - Intergenic
1085478814 11:76805262-76805284 TCAGAGGGGAGGAGGTGGAGGGG + Intergenic
1088235638 11:107719915-107719937 CCAGAGAAGAGGAGTTTAATTGG - Intergenic
1089637147 11:119822333-119822355 CCAGAGTGGAGGAGCAGAAGTGG + Intergenic
1090999975 11:131902353-131902375 CCAGTGAGGAGCAGGTGAAGTGG - Intronic
1091156114 11:133375282-133375304 CCAGCGTGGAGGTGGTGGAGTGG - Intronic
1091656375 12:2349550-2349572 CCAGAGGGGAGGAGGGCAGGGGG - Intronic
1093519731 12:20034440-20034462 ACAGAAGGGAGGAGGTCAAGTGG - Intergenic
1096257487 12:50072326-50072348 CCCGAGGGGAGGAGGGGAAGCGG - Intronic
1096489054 12:52003733-52003755 CCAGAGCGGTGGAGGTTTTGTGG + Intergenic
1096836387 12:54353813-54353835 ACAGAGTGGAGGAGGTGAATGGG + Intergenic
1096876813 12:54635844-54635866 GCATAGTGGTGGAGATTAAGTGG + Intergenic
1097023694 12:56038210-56038232 GAAGAGAGGAGGAGGTGAAGGGG - Exonic
1099762668 12:86941470-86941492 CCAGAGTTGGGGATTTTAAGAGG - Intergenic
1101126215 12:101636666-101636688 CGACAGTGGAGAAGGTCAAGAGG + Exonic
1101247322 12:102896304-102896326 TGAGAGTGGATGAGGTCAAGGGG + Intronic
1102038290 12:109784419-109784441 CCAGGGTGGATGAGGTGAACTGG - Exonic
1102604556 12:114058509-114058531 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1103171216 12:118821634-118821656 CCAGAGGAGAGGAGGGCAAGGGG - Intergenic
1104250392 12:127088130-127088152 CCTGAGTGGAGGAGGCTCATGGG - Intergenic
1104868717 12:131978384-131978406 GCAGAGGGGAGGAGGTGAATAGG - Intronic
1105486251 13:20835786-20835808 CAGAAGTGGAGGAGGTGAAGGGG - Intronic
1105962676 13:25356194-25356216 CCAGAGTGGGGCAGGAGAAGGGG + Intergenic
1106479130 13:30123776-30123798 CCAAAGTGGATGAGGCTGAGAGG - Intergenic
1106927351 13:34627147-34627169 CCAGAATGGAAGAGACTAAGAGG + Intergenic
1108466863 13:50725365-50725387 CCAGATTGTAGGAGGATGAGAGG + Intronic
1109352991 13:61207471-61207493 CCAGAGTTGGGGAGTTTAAGAGG - Intergenic
1114265687 14:21071361-21071383 GCAGAGTGGAGGAGGGGGAGAGG + Intronic
1114270321 14:21097166-21097188 GCAGAGTGGAGCGGGTTAGGAGG - Intronic
1116681413 14:47974487-47974509 TCAGGGTGGAGGAGGTTGGGGGG + Intergenic
1117251763 14:53946541-53946563 CCGGGGTGGAGGGGCTTAAGAGG - Intergenic
1118762366 14:68888415-68888437 GCAGAGTGGAGGAGGCACAGTGG - Intronic
1119248260 14:73131366-73131388 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1119433286 14:74582222-74582244 CTAGGGAAGAGGAGGTTAAGGGG - Intronic
1119738212 14:76997496-76997518 TCAGAGTGGGGGAGGGTGAGAGG + Intergenic
1119749971 14:77070279-77070301 CCAGAATGGAGGAGTTTCTGTGG - Intergenic
1119773894 14:77236941-77236963 GCAGCGTGGAGGAGGGTGAGAGG - Intronic
1119773905 14:77236987-77237009 GCAGCGTGGAGGAGGGTGAGAGG - Intronic
1120982623 14:90303992-90304014 CCAAGGTGGAGGAGTTTAACAGG - Exonic
1121193214 14:92047753-92047775 CCAGAGTGGGGGAGTTTTAAGGG + Exonic
1121248536 14:92482683-92482705 CCAGAGGGGACAAGGTCAAGTGG + Exonic
1121437756 14:93930176-93930198 CCAGAGAGAACGAGGTTTAGGGG - Intergenic
1121513743 14:94535045-94535067 CTAGAGTGGAGCAAGTGAAGGGG + Intergenic
1122206954 14:100152420-100152442 CCAGACTGGCAGAGGGTAAGTGG + Intronic
1123467384 15:20527051-20527073 CCAGAGTGTAGGAGCTAGAGGGG - Intergenic
1123650730 15:22473991-22474013 CCAGAGTGTAGGAGCTAGAGGGG + Intergenic
1123741139 15:23282833-23282855 CCAGAGTGTAGGAGCTAGAGGGG + Intergenic
1123745859 15:23319725-23319747 CCAGAGTGTAGGAGCTAGAGGGG - Intergenic
1124278130 15:28343042-28343064 CCAGAGTGTAGGAGCTAGAGGGG - Intergenic
1124304570 15:28568566-28568588 CCAGAGTGTAGGAGCTAGAGGGG + Intergenic
1126400712 15:48266905-48266927 GAAGAGTGGAAGAGATTAAGAGG - Intronic
1128878909 15:71225080-71225102 CCAGAGTGGATGGGGGAAAGTGG - Intronic
1128931011 15:71705002-71705024 CAAGGGTGGAGGAGGTGTAGAGG + Intronic
1129062210 15:72869132-72869154 CCAGAGAGCAGGAGGTCAAGGGG - Intergenic
1129953579 15:79613162-79613184 ACAGAGTAGAGGAGGATTAGTGG - Intergenic
1130113863 15:80989464-80989486 CATGAGTAGAGGAGGTTAGGGGG + Intronic
1132635047 16:940044-940066 CCAAAGGGGAGGAGGCAAAGCGG + Intronic
1134098263 16:11433976-11433998 CAAGATGGGAGGAGGTTATGGGG + Intronic
1134395410 16:13858112-13858134 CCAGAGTGGGAGAGGCTAAGAGG - Intergenic
1134614220 16:15637602-15637624 GCAGAATGGAGTAGGTTCAGGGG - Intronic
1135567635 16:23524149-23524171 CCAGAGTCCAGGAGGTTAGATGG + Exonic
1135806503 16:25547503-25547525 CGTTAGTGGAGGAGGATAAGAGG - Intergenic
1138422260 16:56906868-56906890 ACAGAATGAAGGAAGTTAAGGGG + Intronic
1139148517 16:64351713-64351735 CCTGAATAGAGAAGGTTAAGAGG - Intergenic
1139235211 16:65330967-65330989 GCTGAGTGGAGGAGGTTAGCAGG + Intergenic
1139534434 16:67562735-67562757 CCGGGGTGGAGGAGGTTTCGCGG + Intronic
1140327291 16:74017185-74017207 CCAGGGTGGCAGAGGCTAAGTGG - Intergenic
1141371688 16:83492792-83492814 CCAGAGTGGAGGAGCAAATGAGG - Intronic
1142202979 16:88769972-88769994 CCAGGTTGGAGTAGGTTAGGAGG - Intronic
1143764822 17:9130556-9130578 TCTGAGTGGATGAGTTTAAGGGG - Intronic
1143778079 17:9212592-9212614 CCAGGGTGAAAGAGTTTAAGGGG - Intronic
1144576834 17:16434886-16434908 TCAGGGTGGAGGAGGTGAACTGG + Exonic
1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG + Intronic
1147961569 17:44170807-44170829 GCAGCATGGAGGAGGTGAAGGGG - Exonic
1147980025 17:44268471-44268493 CCAGAGTGGAGGATGGACAGAGG - Intergenic
1148382590 17:47210450-47210472 CCAGAGTGGAAAAGGTCAAGTGG + Intronic
1149818085 17:59746733-59746755 CCAGAAAGGAGGAGATGAAGGGG + Intronic
1151971908 17:77461958-77461980 CCAGGTTGAAGGCGGTTAAGCGG + Intronic
1152330246 17:79668672-79668694 TCAGAGGGGAGGAGGTGGAGGGG - Intergenic
1152356039 17:79807924-79807946 CAAGAGTTGAGGAGCCTAAGGGG + Intergenic
1152454038 17:80402569-80402591 CCAGAGTTGGGGAATTTAAGAGG - Intergenic
1152631694 17:81413459-81413481 CCAGAGTGGAGGCGGTGGTGTGG - Intronic
1155199336 18:23503555-23503577 CCAGAGTGGAGCAGGATGCGCGG - Exonic
1155757979 18:29525756-29525778 CCAAAGAGGAAGAGGTTATGAGG + Intergenic
1155994326 18:32313772-32313794 CCAAAGTAGAGGAGTATAAGTGG - Intronic
1156468588 18:37363189-37363211 CGAGGGTGGGGGAGGTTAGGAGG + Intronic
1156645995 18:39162827-39162849 CCTGAGTGCAGGAGCTTTAGTGG + Intergenic
1159929769 18:74298519-74298541 CTAGAGTGGGAGAGATTAAGAGG - Intergenic
1161467116 19:4437196-4437218 CCAAACTGCAGGAGGTTCAGGGG - Intronic
1161486199 19:4537133-4537155 CCAGGGTGAAGGAGGAAAAGAGG - Exonic
1161712182 19:5855087-5855109 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1161807337 19:6452271-6452293 CCAGAGGGGAGCAGGGAAAGAGG + Intronic
1163557815 19:18002284-18002306 CCAGAGGGGAAGAGATGAAGTGG + Intronic
1163702409 19:18792671-18792693 ACTGATTGCAGGAGGTTAAGGGG - Intergenic
1164459148 19:28432901-28432923 CCAGAGTTGGGGAGTTTAAGAGG + Intergenic
1165249320 19:34516653-34516675 CCAGAGTGGGGGAGATTTAAGGG - Intergenic
1165793896 19:38507483-38507505 CCAAAGGGGAGGAGGCTGAGAGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1166905712 19:46107095-46107117 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1166949923 19:46420207-46420229 ACAGAGTGGAGGAGGCGATGTGG + Intergenic
1167791972 19:51688880-51688902 GCAGAGAGGAGGAGGGAAAGAGG + Intergenic
1168152507 19:54456496-54456518 CCAGGGTGGAGGAGGGTACTGGG + Intronic
925611469 2:5706059-5706081 CCAGGGTGGAGGAGTTGAGGAGG + Intergenic
925611517 2:5706214-5706236 CCAGGGTGGAGGAGTTGAGGAGG + Intergenic
927116649 2:19910129-19910151 CCAGAGTGGAGAAGGGGAAAAGG - Intergenic
927664029 2:25017241-25017263 CCAGACTGGAGCAGGTGAACAGG + Intergenic
928272985 2:29873843-29873865 CCAGAGTGGAGGTGATTATCAGG - Intronic
931356102 2:61538515-61538537 GCAGAGTGGGGGAGGGGAAGTGG + Intronic
932159372 2:69446693-69446715 CCAGAGTTGGGGAGTTTAAGAGG + Intergenic
933574584 2:84053086-84053108 CCAGGCTGGAGGTGGCTAAGAGG - Intergenic
933768172 2:85725241-85725263 CCTGAATGGAGGAGGGTGAGGGG - Intergenic
933800353 2:85955475-85955497 CCAGAGAGGAGGAGGAGGAGCGG - Intergenic
934698214 2:96415837-96415859 CCAGGGTGGATGGGGTTCAGTGG - Intergenic
938992670 2:136645368-136645390 ACAGAATGGAGTGGGTTAAGAGG - Intergenic
939988937 2:148859244-148859266 CAAGTGTGCAGGAGGTCAAGTGG - Intergenic
940183766 2:150960976-150960998 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
940974490 2:159927774-159927796 CAAGAAAGGAGGAGGTTAAGAGG - Intergenic
942064258 2:172255324-172255346 GTGGGGTGGAGGAGGTTAAGAGG - Intergenic
942092605 2:172508476-172508498 CCAGAGTTGAGGGAGTCAAGTGG + Intergenic
943420025 2:187658466-187658488 CAAGAATGGAGGAGGGAAAGAGG + Intergenic
943688381 2:190843205-190843227 TCATAGGGGAAGAGGTTAAGTGG + Intergenic
1168761058 20:349687-349709 CCAGCGTGGAGGATGGCAAGTGG + Exonic
1168906511 20:1408233-1408255 CCTGAGGGGAGGAGGGGAAGTGG + Intergenic
1168956245 20:1836461-1836483 GCAGAGTGAAGGAGGTGGAGAGG - Intergenic
1170671613 20:18439572-18439594 CCAGAGTAGCAGAAGTTAAGTGG - Intronic
1171225074 20:23436031-23436053 CCAGAGTGGAGGGGCTTGTGGGG - Intergenic
1171533401 20:25866658-25866680 CCAGGGTGGTGGAGGGTTAGAGG - Intronic
1172520782 20:35564230-35564252 ACAGACTTGAAGAGGTTAAGTGG + Intergenic
1173044978 20:39501273-39501295 CCAGAATATAGGAGGTTCAGGGG - Intergenic
1173652118 20:44673028-44673050 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1173781809 20:45762467-45762489 CCAGAGTGGGGGAGTTTTAAGGG - Intronic
1175389027 20:58614761-58614783 CCAGGGTGGAGGAGGATGAAGGG - Intergenic
1175888551 20:62305867-62305889 CCAGAGGGCAGGAGGGTGAGAGG + Intronic
1176728574 21:10465967-10465989 CCTGAGTGGTGGGGGTTGAGGGG + Intergenic
1178425294 21:32474252-32474274 GCAGAGTGGAGGGCTTTAAGCGG - Intronic
1178517586 21:33261914-33261936 CCAAAGGAGAGGAAGTTAAGAGG + Intronic
1178871502 21:36380835-36380857 CCACACTTTAGGAGGTTAAGAGG - Intronic
1180999001 22:19979266-19979288 CCAAAGGGGAGGAGGTGCAGAGG + Intronic
1182067820 22:27442924-27442946 CCAGAGGGGAGGTGGCTTAGAGG + Intergenic
1182424223 22:30263708-30263730 CCAGCCTGGAGGAGGTAGAGGGG + Exonic
1183273831 22:36878754-36878776 CCAGAGTGGAGGATCTGGAGTGG - Intergenic
1184462764 22:44648673-44648695 CCAGTCAGGAGGATGTTAAGTGG - Intergenic
1184877949 22:47287223-47287245 ACAGAATGGGGGAGGTTGAGTGG - Intergenic
1185285377 22:49997566-49997588 CCAGTGTGGGGGAGGTACAGTGG - Intronic
950102323 3:10365466-10365488 CCAGAGTGGGGGAGGGCAGGAGG + Intronic
951305303 3:21053158-21053180 CCAGGGTGGAGGAAGTGAGGAGG + Intergenic
951663988 3:25101828-25101850 CCAGGGTGGAAGAGGATATGGGG - Intergenic
952055781 3:29443763-29443785 CAATGGTAGAGGAGGTTAAGTGG + Intronic
952861518 3:37816662-37816684 GCAGAGGGGAGAAGGTGAAGAGG + Intronic
953884869 3:46709480-46709502 GCAGAGTGTAGGAGGTTCTGGGG + Intronic
954161689 3:48727366-48727388 CCAGAGTGGGGGAGTTTAAGGGG + Intronic
955228225 3:57078583-57078605 CCAGGGTGGAGGACGCCAAGGGG - Intronic
955644974 3:61127242-61127264 CCATAGTGGTGGAGGTGATGAGG + Intronic
956746063 3:72311705-72311727 CCAGAATGGAGGAGGGGACGAGG + Intergenic
957527949 3:81401394-81401416 ACAGAGTTGAAGAGCTTAAGAGG - Intergenic
959369289 3:105503776-105503798 CCAGTGTGGCTGAGGTTTAGGGG - Intronic
960121415 3:113951366-113951388 CCAGAGTGTAGGAGCTGTAGAGG - Intronic
961517380 3:127446365-127446387 CCAGAGTGAAGGAGCAGAAGTGG + Intergenic
963886457 3:150588193-150588215 GTAGAGTCGATGAGGTTAAGTGG + Intronic
964060669 3:152518424-152518446 CCAGAGAGGTGGAGGTCAAGGGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
964940888 3:162157174-162157196 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
966910685 3:184558226-184558248 CCAGAGTTGAGGCTGTTTAGAGG + Intronic
968705639 4:2076143-2076165 CCCAAGTGGAGGAGATTCAGGGG + Intronic
969238557 4:5885218-5885240 CTAGAGTGGGGGAGGTGAAGGGG - Intronic
969394573 4:6911666-6911688 CCAGAGTAGAGGAGGGAAGGTGG - Intronic
969441072 4:7217123-7217145 CCAGCATGGAGTAGGTGAAGGGG - Intronic
969930699 4:10628068-10628090 ACAGATTGGAGGAGGCCAAGAGG - Intronic
970423486 4:15926256-15926278 CCCGAGAGGTGGAGTTTAAGTGG - Intergenic
970450139 4:16158206-16158228 AAAGGGTGGAGGAGCTTAAGTGG - Intergenic
972071061 4:35019821-35019843 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
978826194 4:113026915-113026937 CCAGACTGGAGAAGGTTAAAGGG + Intronic
979041508 4:115803193-115803215 ACTCAGTGGAGGTGGTTAAGGGG + Intergenic
979175939 4:117664063-117664085 CCAGAATGGAGTGGGTGAAGGGG + Intergenic
980129101 4:128802280-128802302 CCAGAGTGGATGAGATCAATAGG - Intergenic
980462859 4:133139411-133139433 CCAGAATGCAAGAGTTTAAGTGG - Intergenic
982206836 4:153002954-153002976 CCAGAGTAGAAGAGGGTAAGGGG + Intergenic
982851249 4:160318723-160318745 CCAGGGTGCCAGAGGTTAAGCGG - Intergenic
984090868 4:175374000-175374022 CAAGAGTGGAGGAGGTAATCAGG - Intergenic
984244870 4:177263182-177263204 CCAGAGTGGAGAAGACTAAATGG + Intergenic
985259003 4:188097651-188097673 CCAGAGTTCAGCAGGTGAAGGGG + Intronic
986193606 5:5518212-5518234 CCAGAGTTGGGGAGTTTAAGAGG - Intergenic
989660000 5:43788775-43788797 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
990413899 5:55567707-55567729 CCAGAGAGAAGTTGGTTAAGGGG - Intergenic
992491265 5:77247135-77247157 CCAGAGTGGCTGAGGTTTAGGGG - Intronic
992533211 5:77671950-77671972 CCAGAGTCCTGGAGGTAAAGTGG - Intergenic
994072037 5:95613318-95613340 CCAGAGTGGGGGAGGGGACGGGG - Intergenic
995544841 5:113219755-113219777 CCACAGTGGACAAGGTTTAGAGG + Intronic
997244332 5:132333635-132333657 CCAGTGAAGAGGAGGTTAAAAGG + Intronic
997663340 5:135606562-135606584 CAAGACTGGAGAAGGTTAAGTGG + Intergenic
997678737 5:135734409-135734431 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
998816254 5:146017242-146017264 CTGCAGTGGAGGAAGTTAAGTGG + Intronic
999121561 5:149213534-149213556 CCAGAGTGTAGTAGGTTGAAGGG + Intronic
1000693472 5:164350899-164350921 GCAAAGTGCAGCAGGTTAAGGGG + Intergenic
1000913643 5:167052966-167052988 CCAGACTGGAGAATTTTAAGTGG - Intergenic
1001095682 5:168773775-168773797 GCAGGGTGGAGGGGGTTAAGCGG + Intronic
1001125898 5:169019009-169019031 CCAGAGTGGGGGAGGCAAATTGG - Intronic
1001816739 5:174675649-174675671 CCAGGGTCCAGAAGGTTAAGGGG - Intergenic
1002160258 5:177310707-177310729 CCAGAGAGGATGAGGTGAAGGGG + Intronic
1003099814 6:3168533-3168555 CCAGAGTGGGGGAGTTTTAGGGG - Intergenic
1004630081 6:17412647-17412669 CCAGAGTGGAGGGGGCAAATGGG + Intronic
1005463675 6:26091628-26091650 GCAGAGTGGAGGAGGTTGCAGGG + Intronic
1006093257 6:31640617-31640639 CTAGAGAGGGGGAGGTTGAGGGG - Intronic
1007482147 6:42157305-42157327 ACAGGGAGGAGGAGGTTACGGGG - Intronic
1007681326 6:43635737-43635759 GCAGTGTGGGGGAGGTTAAGTGG - Intronic
1009894338 6:69728477-69728499 CTAGATTGGAGGTGGTTGAGGGG - Intronic
1010017047 6:71116966-71116988 CCAGAGTGGGGGAGGTGTGGGGG + Intergenic
1010288008 6:74101890-74101912 CCAGACTGGATGAGGTTAGCTGG - Intergenic
1010624296 6:78117996-78118018 CCAGAGAGGAGGTAGTGAAGGGG - Intergenic
1011910471 6:92430537-92430559 TCAGAGTGGAGGATTTTAACAGG + Intergenic
1012703839 6:102496494-102496516 ACAGAGTGGAAGAGGCTCAGTGG + Intergenic
1014486244 6:122002760-122002782 CGAGAGTGGAGGAAGTAAGGGGG - Intergenic
1015797832 6:137030925-137030947 TAATAGTGGAGGAGGTGAAGGGG - Intronic
1015917286 6:138230115-138230137 CCTGGGTGGAGCAGGGTAAGGGG - Intronic
1016478960 6:144460773-144460795 CCAGAGTGGAGGAGATTATATGG - Intronic
1017269891 6:152492878-152492900 CCAGAGTGGGGGAGTTTTAAAGG - Intronic
1018884056 6:167917463-167917485 CTAGAGGAGAGGAGGTTAGGAGG + Intronic
1019166538 6:170101247-170101269 CCAGCGTGAAGGAGGTTGAAAGG + Intergenic
1020350785 7:7216260-7216282 CCAGAGTGGAGGAGAAGACGGGG + Intronic
1021157265 7:17226075-17226097 TCAGAGTGGCAGAGGTTATGGGG - Intergenic
1021172746 7:17416508-17416530 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1022781316 7:33587240-33587262 CCAGAGGGAATGAGGGTAAGTGG - Intronic
1022865783 7:34418312-34418334 ACAGAGTGCAGGATGTTAACTGG - Intergenic
1023798492 7:43813363-43813385 TCAGGGTGGAGTAGGTTAATTGG - Intergenic
1024014387 7:45297694-45297716 CCAGACTGGCAGAGGTTATGAGG + Intergenic
1024567003 7:50689451-50689473 CCAAAGTTGAAGGGGTTAAGTGG + Intronic
1025888899 7:65627054-65627076 ATAGAGTGGAGGAGTTGAAGAGG + Intergenic
1028589829 7:92482829-92482851 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1028883370 7:95905261-95905283 TCAGAGTGGATGAAGTAAAGAGG + Intronic
1030193557 7:106832310-106832332 CCAGAGTGGGGGAGTTTTAAGGG - Intergenic
1030264132 7:107599935-107599957 TCAGAGTGGAGATGGGTAAGTGG - Intronic
1030944354 7:115697945-115697967 CAAGAGAGGAGAAGGTTGAGAGG + Intergenic
1031767320 7:125797671-125797693 CCAGAATGAAGGAGATTAAAGGG - Intergenic
1031853550 7:126894914-126894936 ATAGAGTGGAGGAGTTGAAGAGG - Intronic
1033324331 7:140364934-140364956 CCAGAGTGCAGATGGCTAAGAGG - Intronic
1033648563 7:143323085-143323107 CCAGGGTGGAGGAGGGTGGGAGG - Intronic
1034601518 7:152261994-152262016 CCTGAGTGGTGGGGGTTGAGGGG - Intronic
1034877826 7:154741094-154741116 CCAGAGTGGAAGAGGATGCGAGG + Intronic
1037933079 8:22895362-22895384 ACAGAGTGAAGGAGGGTATGTGG - Intronic
1038418233 8:27413440-27413462 CCAGATTGGAGGAGACTAAAGGG - Intronic
1038574793 8:28695722-28695744 CCAGAGGGAAGGAGGTCATGCGG + Intronic
1039113475 8:34065739-34065761 ACAAAGTGCAGGAGGTCAAGGGG + Intergenic
1039175457 8:34799251-34799273 CTAGAGAGGAGGAGGTAGAGGGG - Intergenic
1039938131 8:42065942-42065964 GCAGAGGGGAGGAGGTTATGAGG + Intergenic
1043499548 8:80838829-80838851 GCAGAGTGGAGGAGGAAGAGGGG + Intronic
1045636505 8:104197743-104197765 ACAGAGAGTTGGAGGTTAAGGGG + Intronic
1047684473 8:127290863-127290885 GCAGAGTGTAGGAGGATAGGTGG - Intergenic
1047695107 8:127395632-127395654 CAGTGGTGGAGGAGGTTAAGGGG - Intergenic
1048068704 8:130999496-130999518 CCAGAGTGGAGGTGGGAAAGGGG + Intronic
1049033971 8:140060470-140060492 GCAGAGTGCAGGAGGCCAAGGGG - Intronic
1049594253 8:143476187-143476209 ACAGGGTGGAGGAGGAGAAGAGG - Intronic
1051480193 9:17551207-17551229 CCAGGTTGGAGGAGGTTGAAGGG - Intergenic
1053170177 9:35872959-35872981 TAAGACTGGAGGAGGTTGAGGGG - Intergenic
1059574692 9:115476014-115476036 CGAGAGTTGGGGAGTTTAAGAGG - Intergenic
1061197056 9:129112108-129112130 CCAGAGAGTAGGAGGATGAGGGG - Intronic
1061253044 9:129437637-129437659 GCAGAGGGGGGAAGGTTAAGCGG + Intergenic
1185771443 X:2768192-2768214 ACAGATTGGAGGAGATTAAGTGG + Intronic
1187210213 X:17222802-17222824 CCAGAGGGGATCAGGTTAAAAGG + Intergenic
1187387566 X:18862393-18862415 GCAAAATGGAGGAGTTTAAGTGG + Intergenic
1188300977 X:28505467-28505489 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1188902490 X:35751046-35751068 CCAGAGTGGCAGAGATCAAGTGG - Intergenic
1189534832 X:41924752-41924774 CCAAAGTGGAGGGGGTGATGTGG + Intergenic
1189928085 X:45978258-45978280 ACATGGTGGAGGAGGTAAAGAGG + Intergenic
1190484825 X:50913804-50913826 CCAGGGTGGAGCAGGTTTAAGGG + Intronic
1192491532 X:71579980-71580002 CCAGAGTGGCGGGAGGTAAGGGG + Intronic
1192736282 X:73852191-73852213 CCAGAGTGTTGGGGGTTCAGAGG + Intergenic
1196830609 X:119772778-119772800 GCAGAGTGAGGGAGGGTAAGTGG - Intergenic
1196992611 X:121346036-121346058 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic
1198119090 X:133574150-133574172 CTAGAGTTGAGGGGGTTAGGAGG + Intronic
1199242790 X:145567820-145567842 CCAAAAATGAGGAGGTTAAGAGG + Intergenic
1200007749 X:153099047-153099069 CCAGAGTGGGGGAGTTTTAAGGG + Intergenic