ID: 1145976736

View in Genome Browser
Species Human (GRCh38)
Location 17:28988267-28988289
Sequence CACTAGGAAGTGCCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1189
Summary {0: 1, 1: 0, 2: 15, 3: 97, 4: 1076}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145976736_1145976748 28 Left 1145976736 17:28988267-28988289 CCTCCTGGGGGCACTTCCTAGTG 0: 1
1: 0
2: 15
3: 97
4: 1076
Right 1145976748 17:28988318-28988340 CCTGGGCAAGGATCCAGCAGTGG 0: 1
1: 0
2: 0
3: 19
4: 278
1145976736_1145976749 29 Left 1145976736 17:28988267-28988289 CCTCCTGGGGGCACTTCCTAGTG 0: 1
1: 0
2: 15
3: 97
4: 1076
Right 1145976749 17:28988319-28988341 CTGGGCAAGGATCCAGCAGTGGG 0: 1
1: 0
2: 2
3: 10
4: 214
1145976736_1145976743 10 Left 1145976736 17:28988267-28988289 CCTCCTGGGGGCACTTCCTAGTG 0: 1
1: 0
2: 15
3: 97
4: 1076
Right 1145976743 17:28988300-28988322 ACATGAATGGCTTGTGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1145976736_1145976741 -3 Left 1145976736 17:28988267-28988289 CCTCCTGGGGGCACTTCCTAGTG 0: 1
1: 0
2: 15
3: 97
4: 1076
Right 1145976741 17:28988287-28988309 GTGGGCTCCTAACACATGAATGG 0: 1
1: 0
2: 0
3: 6
4: 124
1145976736_1145976745 16 Left 1145976736 17:28988267-28988289 CCTCCTGGGGGCACTTCCTAGTG 0: 1
1: 0
2: 15
3: 97
4: 1076
Right 1145976745 17:28988306-28988328 ATGGCTTGTGTCCCTGGGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 218
1145976736_1145976744 11 Left 1145976736 17:28988267-28988289 CCTCCTGGGGGCACTTCCTAGTG 0: 1
1: 0
2: 15
3: 97
4: 1076
Right 1145976744 17:28988301-28988323 CATGAATGGCTTGTGTCCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145976736 Original CRISPR CACTAGGAAGTGCCCCCAGG AGG (reversed) Intronic
900492106 1:2955512-2955534 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
900591570 1:3462590-3462612 CACGAGGAAGTGGTTCCAGGAGG + Intronic
900592638 1:3466867-3466889 CCCTGGGAAGTGTCCCCAGGAGG + Intronic
900738294 1:4314115-4314137 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
900908098 1:5575019-5575041 CACATGCAAGTGCCCCCAGCTGG - Intergenic
900908568 1:5577874-5577896 CACTAGGCAGTGCCCCATTGGGG + Intergenic
900939671 1:5790504-5790526 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
901303595 1:8217108-8217130 CAGAAGGAGGAGCCCCCAGGTGG + Intergenic
901885858 1:12222542-12222564 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
903648426 1:24908808-24908830 CAATGGGAGGTGGCCCCAGGAGG + Intronic
904035191 1:27555263-27555285 CACTAGAAAGTGTCCCCACTGGG - Intronic
904959045 1:34316509-34316531 CACTAGGCAGTGCCCCAGGGGGG - Intergenic
906017092 1:42591674-42591696 CACTAGGCAGTGCCCCAGTGGGG - Intronic
906372965 1:45270032-45270054 CACTAGGCAGTGCCCCCAGTAGG - Intronic
906872875 1:49503418-49503440 CACTAGGCAGTGCCCCATTGAGG - Intronic
906990365 1:50731009-50731031 AACTAGGAACTGCCCCAAGCTGG + Intronic
907392168 1:54165344-54165366 CACTAGGCGGTACCCCCAGTAGG + Intronic
907808091 1:57841399-57841421 CACTAGGCAGTGCCCCAGTGAGG + Intronic
907863014 1:58372027-58372049 CACTAGGCAGTGCCCCAGTGGGG - Intronic
908091051 1:60685996-60686018 CACCAGGCAGTGCCCCAATGGGG - Intergenic
908210555 1:61895741-61895763 CACAAGGCAGTGCCCCCATGGGG - Intronic
908601597 1:65745272-65745294 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
909086187 1:71172430-71172452 CACTAGGCAGTGCCCCAGAGGGG + Intergenic
909257891 1:73448029-73448051 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
909298654 1:73983353-73983375 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
909368949 1:74861859-74861881 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
909376797 1:74950551-74950573 CACTAGGCAGTGCCCCACTGGGG - Intergenic
909710821 1:78647348-78647370 CACTAGGCAGTGCCCCAGAGGGG + Intergenic
909719843 1:78754865-78754887 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
909867004 1:80686181-80686203 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
910512417 1:88021875-88021897 CACTAGGAAGTGCCCTGTGAGGG + Intergenic
910563521 1:88618409-88618431 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
910726963 1:90349666-90349688 CACTAGGCAGTGCCCCAATGGGG - Intergenic
911023162 1:93408747-93408769 CACTAGGAAGTGCCCCAGTGGGG - Intergenic
911376413 1:97056923-97056945 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
911511186 1:98809233-98809255 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
911565768 1:99461756-99461778 CACTAGGCATTGCCCTCTGGTGG + Intergenic
911738514 1:101362754-101362776 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
911798991 1:102110140-102110162 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
911812133 1:102296153-102296175 CACTAGGTAGTGCCCCAGTGAGG - Intergenic
912112774 1:106363707-106363729 CACTAGGCAGTGCCCCAGGGGGG - Intergenic
912192066 1:107352210-107352232 CACTAGGCAGTGCTCCAATGGGG + Intronic
912405486 1:109434231-109434253 CACTAGGCAGTGCCCCGCTGGGG + Intergenic
913352345 1:117875510-117875532 CACTAGGCAGTGCCCCAGTGAGG - Intronic
913490632 1:119376529-119376551 CACTAGGCAGTGCCCCAGTGGGG + Intronic
914905140 1:151737768-151737790 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
915694111 1:157721844-157721866 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
915885699 1:159718566-159718588 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
916302761 1:163294140-163294162 CACTAGGCAGTGCCCCAGTGGGG + Intronic
916400999 1:164448484-164448506 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
916618760 1:166472946-166472968 CACTAGGCAGTGCCCCAGGAGGG + Intergenic
916688926 1:167172411-167172433 CACTAGGAAGTGCCCCAGTGGGG - Intergenic
916982557 1:170154323-170154345 CACTAGGCAGTGCCCCCAGTGGG - Intronic
916987555 1:170207790-170207812 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
917051694 1:170931943-170931965 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
917140103 1:171827069-171827091 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
917460555 1:175225581-175225603 AACGATGAAGTGACCCCAGGAGG + Intergenic
917777431 1:178352615-178352637 CACTAGGTAGTGCCCCAGTGGGG + Intronic
918119915 1:181529424-181529446 CACTAGGCAGTGCCCCCGTAGGG - Intronic
918400977 1:184162638-184162660 CACTTGGAAGAGGCCCAAGGGGG - Intergenic
918619279 1:186583888-186583910 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
918784656 1:188750180-188750202 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
919179198 1:194059466-194059488 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
919209057 1:194455748-194455770 CACTAGGCAGTGCCCCAATAGGG + Intergenic
919277453 1:195439559-195439581 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
920200176 1:204255338-204255360 CAGATGGAACTGCCCCCAGGGGG - Intronic
921496853 1:215853012-215853034 CACTAGGCAGTGCCCCAATGAGG + Intronic
922597508 1:226825259-226825281 CAAGAGGAAGGGGCCCCAGGTGG - Intergenic
922666157 1:227471237-227471259 CACTAGGCAGTGCCCCAATGGGG - Intergenic
922667756 1:227487448-227487470 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
922709108 1:227813825-227813847 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
923179142 1:231499235-231499257 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
923205279 1:231753141-231753163 CACTAGGCAGTGCCCCAGTGGGG + Intronic
923233098 1:232007206-232007228 CACTAGGCAGTGCCCCAGTGGGG - Intronic
923932863 1:238722278-238722300 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
924394789 1:243607154-243607176 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1062881306 10:980338-980360 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1063484742 10:6409151-6409173 CACTAGTAACTGGCCCAAGGAGG + Intergenic
1064793700 10:18988184-18988206 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1065159871 10:22908676-22908698 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1065408166 10:25391244-25391266 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1066635602 10:37496121-37496143 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1067183278 10:44006266-44006288 CCCAGGGAAGTGCCCCCAGGGGG - Intergenic
1067273181 10:44810204-44810226 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1067351570 10:45480837-45480859 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1068128454 10:52868859-52868881 CACTAGGAAGTGCCACAATGGGG - Intergenic
1068221570 10:54052175-54052197 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1068285027 10:54922907-54922929 CACTAGGGAGTGCCCCTGTGGGG + Intronic
1068314544 10:55323309-55323331 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1068352210 10:55862309-55862331 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1068400283 10:56519011-56519033 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1068972478 10:62974359-62974381 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1069040837 10:63694037-63694059 CACTAGGCAGTGCCCCAGGAGGG - Intergenic
1069112473 10:64464491-64464513 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1069189315 10:65467242-65467264 CACTAGGCAGTGCCCCAAGAGGG - Intergenic
1069381021 10:67843339-67843361 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1069424535 10:68278095-68278117 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1070576214 10:77680986-77681008 CACCAGGTGGTGGCCCCAGGCGG - Intergenic
1070789549 10:79181191-79181213 CACTGGGAAGGGCCATCAGGAGG - Intronic
1071818255 10:89254128-89254150 CACTAGGCAGTGCCCCATTGGGG + Intronic
1071859354 10:89656491-89656513 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1071980990 10:91004246-91004268 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1072487987 10:95874619-95874641 CACTAGGCAGTGCCCCAACAGGG + Exonic
1072647369 10:97267485-97267507 CACTAGGCAGTGCCCCAATGGGG + Intronic
1072769352 10:98124726-98124748 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1072883246 10:99249111-99249133 CACTAGGAAGTGCCCTAGTGGGG - Intergenic
1072909271 10:99485372-99485394 CACTAGAAAAGGCCTCCAGGTGG + Intergenic
1073326184 10:102645000-102645022 CACCAGGAGGTGCCCGCGGGCGG - Exonic
1073328443 10:102656157-102656179 CCCCAGGATGTGCCCCCGGGAGG - Intronic
1073880330 10:107973491-107973513 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1074260521 10:111848771-111848793 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
1074657992 10:115616952-115616974 CACTAGGCAGTGCCCCAGTGAGG - Intronic
1075342649 10:121659906-121659928 CCATAGGAACTGCCTCCAGGTGG - Intergenic
1075591082 10:123692232-123692254 CCCAAGCAAGTGCCCCCAAGGGG - Exonic
1077426184 11:2479250-2479272 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1078516079 11:12023562-12023584 CACTTGGCAGTGCCCCCATGGGG - Intergenic
1078989898 11:16636049-16636071 CACTAGGCAGTGCCCCATTGGGG - Intronic
1079005420 11:16788546-16788568 CGCCAGGAAGCGCCACCAGGGGG + Exonic
1079546854 11:21643341-21643363 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1079554234 11:21739749-21739771 CACTAGGCAGTTCCCCAATGGGG + Intergenic
1079652090 11:22942505-22942527 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1079785365 11:24664928-24664950 CACCAGGCAGTGACCCCATGGGG - Intronic
1080707703 11:34713509-34713531 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1080946289 11:36978863-36978885 CACTAGGAAGTGTCCCAGTGGGG + Intergenic
1080946709 11:36981948-36981970 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1080990528 11:37529233-37529255 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1080997283 11:37619265-37619287 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1081051756 11:38350116-38350138 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1081122640 11:39285652-39285674 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1081136895 11:39450160-39450182 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1081316516 11:41637411-41637433 CACTAGGAAGTGCCCCAGTGGGG + Intergenic
1081325405 11:41738289-41738311 CACTAGGCAGTGCCCCAAGAGGG + Intergenic
1081349090 11:42026818-42026840 CACTAGGCAGTGCCCCAATGAGG + Intergenic
1081386654 11:42480387-42480409 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1082229397 11:49745094-49745116 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1084422781 11:69068753-69068775 TCCTAGGAAGTGACCACAGGGGG + Intronic
1084422836 11:69069065-69069087 TCCTAGGAAGTGACCACAGGGGG + Intronic
1084838785 11:71827932-71827954 CACTAGGCAGTGCCCCAGTGTGG - Intergenic
1084925332 11:72506848-72506870 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1085215498 11:74827014-74827036 CTCTAGGCAGTGCCCCAATGGGG + Intronic
1085593927 11:77791005-77791027 CACTAGGCAGTGCCCCAGGTAGG + Intronic
1086176796 11:83900773-83900795 CACTAGGTAGTGCCCCAAGGTGG - Intronic
1086309769 11:85522445-85522467 CACTAGGCAGTGCCCTAGGGGGG - Intronic
1086323232 11:85671911-85671933 CACTAGGCAGTGCCCCAGTGTGG + Intronic
1086334046 11:85781995-85782017 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1086669757 11:89532137-89532159 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1086888314 11:92227023-92227045 GACTAGGGAGGGCGCCCAGGGGG + Intergenic
1086954877 11:92925592-92925614 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1087336622 11:96852039-96852061 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1087474293 11:98617872-98617894 CACTAGGAAGTGCCCCAGTGGGG + Intergenic
1087690649 11:101317370-101317392 CACTAGGCAGTGCCCCATTGGGG + Intergenic
1087731138 11:101779715-101779737 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1087763699 11:102127648-102127670 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1087793673 11:102433107-102433129 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1087908255 11:103724389-103724411 CACTAGGCAGTGCCCTAATGGGG + Intergenic
1088014058 11:105037791-105037813 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
1088101869 11:106165162-106165184 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1088111517 11:106267204-106267226 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1088143666 11:106649171-106649193 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1088178508 11:107082067-107082089 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1088500240 11:110475634-110475656 CATGATGAAGTGCCCCAAGGAGG + Intergenic
1088953821 11:114598390-114598412 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1089011035 11:115131999-115132021 CAATAAGAAGTCTCCCCAGGGGG - Intergenic
1089296755 11:117473858-117473880 CACAAGCAAGTGCCCACAGCAGG - Intronic
1090595328 11:128314966-128314988 TACTAGGAAGTGCCCCAGTGAGG + Intergenic
1090692618 11:129199733-129199755 CACTAGGCAGTGCCCAGTGGGGG - Intronic
1090756320 11:129794914-129794936 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1091539713 12:1448783-1448805 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1091834508 12:3576177-3576199 CATTAGGAACTACCCCCAAGTGG - Intronic
1091875351 12:3929114-3929136 AAAGAGGAAGTGGCCCCAGGTGG + Intergenic
1091927968 12:4370846-4370868 CACAAGCATGTGGCCCCAGGAGG - Intronic
1092399891 12:8166157-8166179 CACTAGGCAGTGCCCCAGTGTGG + Intronic
1092574556 12:9765780-9765802 ACCTAGGAAATGCCTCCAGGTGG + Intergenic
1092670561 12:10856327-10856349 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1093038027 12:14351632-14351654 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1093076187 12:14761071-14761093 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1093123365 12:15299796-15299818 CACTAGGCAGTGCCCCTGTGGGG + Intronic
1093185443 12:16014667-16014689 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1093426299 12:19032647-19032669 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1093585781 12:20834854-20834876 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1093604942 12:21078135-21078157 CACTAGGGAGTGCCCCAGTGGGG + Intronic
1094777373 12:33746032-33746054 CACTAGGCAGTGCCCCAATGGGG - Intergenic
1095039729 12:37427637-37427659 CACTAGGAAGTGCCCCAGTAGGG - Intergenic
1095374019 12:41504865-41504887 CACTAGTAAGAAACCCCAGGTGG - Intronic
1095530575 12:43182178-43182200 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1095919704 12:47516948-47516970 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1096886859 12:54726930-54726952 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1097599200 12:61670739-61670761 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1097735448 12:63176739-63176761 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1097735834 12:63179773-63179795 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1097757888 12:63427078-63427100 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1098203677 12:68083720-68083742 CACTAGGCAGTGCCCCTGTGGGG + Intergenic
1098327318 12:69316261-69316283 CACTAGGGAGTGCCCCAGTGGGG + Intergenic
1098434113 12:70450779-70450801 CACTAGGTAGTGCCCCCATGGGG - Intergenic
1098592286 12:72228107-72228129 CACTAGATAGTGCCCCAAGTTGG + Intronic
1098772558 12:74572614-74572636 AACATGGAAGTGCCCCCAAGAGG + Intergenic
1098944374 12:76573672-76573694 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1099096294 12:78378880-78378902 CACTAGGCAGTGCCCCAATAGGG + Intergenic
1099105035 12:78486541-78486563 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1099229269 12:80003538-80003560 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1099360532 12:81694675-81694697 CACTATGCAGTGCCCTCATGGGG - Intronic
1099386473 12:82019027-82019049 CACTAGGGAGTGCCCCAGTGGGG - Intergenic
1099475583 12:83104279-83104301 CACTAGGCAGTGCCCCGTGGGGG + Intronic
1099724808 12:86412202-86412224 CCCTAGGAAGTGCCCCAGTGGGG - Intronic
1099838513 12:87937428-87937450 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1099846138 12:88031003-88031025 CACTAGGCAGTGCCCCAGGAGGG + Intronic
1099905108 12:88761932-88761954 CACTAGGCAGTGCCCCACTGGGG + Intergenic
1099932667 12:89091782-89091804 CACTAGGCAGTGCCCCATTGGGG - Intergenic
1100028812 12:90161699-90161721 CATTAGGAAGTGCCCCAGTGGGG + Intergenic
1100060240 12:90566271-90566293 CACTAGGCAGTGCCCCCTTTGGG + Intergenic
1100159700 12:91843806-91843828 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1100597957 12:96087835-96087857 CACTAGGCAGTGCCCCTGTGGGG - Intergenic
1100929096 12:99585528-99585550 CACTAGGCAGTGCCCCAGTGCGG + Intronic
1101193015 12:102354385-102354407 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1101194620 12:102369751-102369773 CACTAGGCAGTGCCCCATTGGGG + Intergenic
1103263533 12:119609891-119609913 CACTAGGCAGTGCCCCCATGGGG - Intronic
1103264613 12:119618355-119618377 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1104115968 12:125749214-125749236 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1104172076 12:126291818-126291840 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1104742030 12:131184717-131184739 CACTAGGCAGTGCCCCAATGTGG + Intergenic
1105469755 13:20682820-20682842 CACTGGGAAGTGCTCCCACAAGG - Intronic
1105647754 13:22339247-22339269 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1106929861 13:34652374-34652396 CACTAGGCAGTGCACCAATGGGG - Intergenic
1106960298 13:34990209-34990231 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1107105333 13:36636835-36636857 CACTAGGCAATGCCCCAATGGGG + Intergenic
1107330737 13:39296750-39296772 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1107343892 13:39438980-39439002 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1107554740 13:41507867-41507889 CACTAGGCAGTGCCCCCATAGGG + Intergenic
1108850896 13:54728003-54728025 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
1108944358 13:56002790-56002812 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1109097920 13:58142001-58142023 CACTAGGCAGTACCCCCGTGGGG - Intergenic
1109297488 13:60552582-60552604 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1109718384 13:66246281-66246303 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1109879341 13:68450921-68450943 CACTAGGCAGTGCCCCCGTAGGG - Intergenic
1110007782 13:70294031-70294053 CACTAGGCAGTGCCCCATTGGGG - Intergenic
1110250654 13:73377188-73377210 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1110411136 13:75204840-75204862 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1110566208 13:76959777-76959799 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1111085551 13:83371884-83371906 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1111189581 13:84790402-84790424 CACTAGGCAGTGCCCCAGTGTGG - Intergenic
1111222327 13:85220779-85220801 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1111271508 13:85892818-85892840 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1111385490 13:87521634-87521656 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1111441358 13:88285872-88285894 CACTAGGAAGTGTCCCAGTGGGG - Intergenic
1111584000 13:90261274-90261296 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1111601602 13:90481702-90481724 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1111687199 13:91516654-91516676 CACTAGGGAGTGCCCCAACAGGG + Intronic
1111751308 13:92335038-92335060 CACTAGGCAGTGCCCCAGTGAGG + Intronic
1112055305 13:95685034-95685056 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1112163022 13:96888957-96888979 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1112582740 13:100690533-100690555 CACTAGGCAGTACCCCCAGTGGG - Intergenic
1112840006 13:103564234-103564256 CACTAGGCAGTGCCCCAGTGCGG + Intergenic
1112954544 13:105041981-105042003 CACTAGGAAGTGCCCCAGTAGGG + Intergenic
1113029358 13:105976560-105976582 CAGTAGGCAGTGCCCCAATGCGG + Intergenic
1113087801 13:106585977-106585999 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1113133071 13:107059952-107059974 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1113264908 13:108606701-108606723 CACTAGACAGTGCCCCAATGGGG - Intronic
1114140270 14:19901530-19901552 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1114320984 14:21547001-21547023 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1114563386 14:23609755-23609777 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1114689076 14:24563551-24563573 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1114778656 14:25514625-25514647 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1114780429 14:25532872-25532894 CACTAGGTAGTGCCTCAATGGGG + Intergenic
1114935727 14:27534017-27534039 CACTAGGCAGTGCCCTCATGGGG - Intergenic
1114954897 14:27805406-27805428 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1115065665 14:29256913-29256935 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1115134311 14:30090734-30090756 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1115199086 14:30834212-30834234 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1115340770 14:32291186-32291208 CACTAGGCAGTGCCCCACAGTGG - Intergenic
1116098874 14:40408259-40408281 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1116119418 14:40703486-40703508 CACTAGGCAGTGCCCCACTGGGG + Intergenic
1116263591 14:42661014-42661036 CACTAGGCAGTGCCCCAATGGGG - Intergenic
1116356414 14:43936830-43936852 CACCAGGCAGTGCCCCAATGGGG + Intergenic
1116364369 14:44041126-44041148 CACTAGGCAGTGCCCAGAGTGGG - Intergenic
1116415501 14:44672634-44672656 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1116526808 14:45916108-45916130 CACTAGGCAGTGCCCCACTGGGG + Intergenic
1116542279 14:46112975-46112997 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1116669996 14:47828864-47828886 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1116998329 14:51347170-51347192 CACTAGGGAGTGCCCCAGTGGGG - Intergenic
1117084075 14:52181172-52181194 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1117198474 14:53364110-53364132 CACTAGGCAGTGCCCCAATAGGG + Intergenic
1117977250 14:61310692-61310714 CACTAGGCAGTGACCCAATGGGG + Intronic
1117984525 14:61374382-61374404 CACTAGGTAGTGCCCCAATGGGG + Intronic
1118151460 14:63195060-63195082 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1118466086 14:66032473-66032495 CACTAGGGAGTGCCAGCAGTGGG - Intergenic
1118485052 14:66206813-66206835 CACTAGGCAGTGCCACAGGGGGG - Intergenic
1118533454 14:66732167-66732189 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1118956985 14:70491456-70491478 CACTAGGAAGTGCCCCAGTGGGG + Intergenic
1118963936 14:70561967-70561989 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1119040412 14:71269565-71269587 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1119934035 14:78574282-78574304 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1119955923 14:78798590-78798612 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1120270684 14:82309752-82309774 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1120342980 14:83245325-83245347 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1120469417 14:84903652-84903674 CACTAGGCAGTTCCCCAATGGGG - Intergenic
1120590984 14:86372942-86372964 CACTAGGCAGTGCCCCAGTGTGG - Intergenic
1120620126 14:86752787-86752809 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1120623295 14:86792340-86792362 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1121140700 14:91539220-91539242 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1121384754 14:93509853-93509875 CACTAGACAGTGCCCCCATAGGG + Intronic
1121596502 14:95167454-95167476 CACTAGGCAGTGCCCCGGGAGGG - Intergenic
1122831928 14:104402428-104402450 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1123161904 14:106286881-106286903 CACCAGGAAGCGCCTCCAGGTGG + Intergenic
1123629001 15:22247882-22247904 CACTAGGCACTGCCCCAATGGGG - Intergenic
1124445006 15:29722631-29722653 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1124663204 15:31568070-31568092 TACTAGGCAGTGCCCCCATGAGG - Intronic
1124695798 15:31863302-31863324 CACTAGGCAGTGCCCCAGGAGGG + Intronic
1125231499 15:37462180-37462202 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1125279305 15:38027075-38027097 CACTAGGCAGTGCCCCAGGAGGG - Intergenic
1125407638 15:39370021-39370043 CACTAGGCAGTGCCCCTGTGGGG + Intergenic
1125806563 15:42498190-42498212 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1126122093 15:45262622-45262644 CACTGGGAAGTGCAGCCATGTGG - Intronic
1126190525 15:45873520-45873542 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1126490628 15:49232004-49232026 CACTAGGTAGTGCCCCAGTGGGG + Intronic
1126514418 15:49519345-49519367 CACTAGGCAGTACCCCCGTGGGG + Intronic
1126515037 15:49524559-49524581 CACTAGGCAGTGCCCCAATAGGG - Intronic
1127186501 15:56485968-56485990 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1127791115 15:62399402-62399424 CATTAGGCAGTGCCCCAATGGGG - Intronic
1129469486 15:75742848-75742870 CACTAGGCAGTGCCCCAGGAGGG - Intergenic
1130762119 15:86831794-86831816 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1130824755 15:87532678-87532700 CACTAGGCAGTGCCCCAGGAGGG + Intergenic
1132577416 16:670414-670436 CTCAGGGAAGTGCCCCGAGGAGG - Intronic
1134660564 16:15981276-15981298 CACTAGGCAGTGTCCCAATGGGG + Intronic
1136490634 16:30605535-30605557 CACTAGGAATTGAGACCAGGGGG - Intronic
1137778658 16:51077941-51077963 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1137951957 16:52792096-52792118 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1137993731 16:53186033-53186055 CACTAGGCAGTGCCCCGGTGGGG - Intronic
1138095389 16:54207229-54207251 AACTGGGAAGAGCCCCCATGGGG - Intergenic
1138402098 16:56754738-56754760 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1138798896 16:60002049-60002071 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1139030820 16:62878486-62878508 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1139041347 16:63002314-63002336 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1139166103 16:64566791-64566813 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1139300685 16:65942835-65942857 CATTATGAAGTGCCTACAGGGGG + Intergenic
1139561098 16:67742923-67742945 CACTAGCAACTGCAGCCAGGTGG + Intronic
1140623399 16:76763489-76763511 CACTAGGCAGTGCCCTGATGGGG - Intergenic
1141039607 16:80661544-80661566 CACTGGGAAGTGCCAGCATGAGG + Intronic
1141273085 16:82558465-82558487 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1141375045 16:83522883-83522905 CACTGGGAAGAGCCACTAGGTGG - Intronic
1141975075 16:87510376-87510398 CACTAGGCACTGCCCCAATGGGG + Intergenic
1142709831 17:1716910-1716932 GGTTAGGAAGAGCCCCCAGGAGG - Intronic
1144508808 17:15857385-15857407 CACTAGGCAGTGCCCCAGGGGGG - Intergenic
1145004867 17:19332131-19332153 CAGTGGGAAGAGCCCCCAAGAGG - Intronic
1145172925 17:20675025-20675047 CACTAGGCAGTGCCCCAGGGGGG - Intergenic
1145976736 17:28988267-28988289 CACTAGGAAGTGCCCCCAGGAGG - Intronic
1146324441 17:31873560-31873582 CACTATGGAGTGGCCTCAGGTGG - Intronic
1146452715 17:32987443-32987465 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1148871995 17:50663716-50663738 CACCAGGAAGCCCCACCAGGAGG - Exonic
1149029532 17:52067526-52067548 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1149113546 17:53063414-53063436 CACTAGGCAGTGCCCCAATGGGG - Intergenic
1149135574 17:53359677-53359699 CACTAGGCAGTGCCCCTGTGGGG - Intergenic
1149140612 17:53428642-53428664 CACTAGGAAGTGCCCCAGTGGGG - Intergenic
1149143188 17:53458350-53458372 CACTAGGCAGTGCCCCAGGGGGG - Intergenic
1149902395 17:60492331-60492353 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1150093828 17:62354517-62354539 GATTAGGCAGTGCTCCCAGGGGG - Intergenic
1150515759 17:65807893-65807915 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1150978815 17:70119348-70119370 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1151045701 17:70917455-70917477 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1152548100 17:81013111-81013133 CACTAGGCAGTGCCCCAGCGGGG - Intergenic
1152694190 17:81735445-81735467 CACAGGGAACTCCCCCCAGGAGG - Intergenic
1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG + Intronic
1152732515 17:81979311-81979333 CACTTGGAAAAGCCCCCAGGTGG + Intronic
1152905767 17:82970157-82970179 CATCAGGAAGAGCCCCGAGGGGG + Intronic
1152918147 17:83052416-83052438 CACTGAGATGTCCCCCCAGGAGG + Intergenic
1153388890 18:4532735-4532757 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1153392125 18:4574252-4574274 CACTAGGCAGTGCCCCATTGGGG - Intergenic
1155745847 18:29355825-29355847 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1155842858 18:30668015-30668037 CACTAGGCAGTGCCCCAGTGTGG + Intergenic
1156052330 18:32952191-32952213 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1156344259 18:36241610-36241632 CACTAGGCAGTGCCCCTGTGGGG + Intronic
1156504169 18:37578324-37578346 CTCTAGGTAGTGGCCACAGGTGG + Intergenic
1156632385 18:38985516-38985538 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1156769188 18:40698657-40698679 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1156995801 18:43465599-43465621 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1157504839 18:48218937-48218959 CTCTAGGGAGAGCCTCCAGGGGG - Intronic
1157682439 18:49617481-49617503 CACCAGGAAGGGCACCCAGGAGG - Intergenic
1157941135 18:51930197-51930219 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1158092162 18:53727310-53727332 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1158166583 18:54547511-54547533 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1158223040 18:55169524-55169546 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1158335840 18:56414405-56414427 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1159204584 18:65233272-65233294 CACTAGGCAGTGCCCCAATGGGG - Intergenic
1159218512 18:65428670-65428692 CACTAGGCAGTGCCCCACTGAGG - Intergenic
1159282887 18:66310312-66310334 CACTAGGCAGTGCCCCAATGGGG + Intergenic
1159811842 18:73025961-73025983 CACTAGGCAGTGCCCCAACTAGG - Intergenic
1161562557 19:4981564-4981586 CACCTGGACGTCCCCCCAGGAGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162901468 19:13797342-13797364 CCCTGGGAAGGGGCCCCAGGAGG - Intronic
1163169200 19:15519038-15519060 GTCTAGGAGATGCCCCCAGGGGG + Intronic
1163212924 19:15854759-15854781 GCCAAGGAAGTGCCCACAGGTGG - Intergenic
1163230120 19:15995990-15996012 CACTAGGCAGTGCCCCAATAGGG - Intergenic
1163262853 19:16201692-16201714 CTCTAGGAAGTCCTCCCAGCTGG - Intronic
1164663493 19:30001987-30002009 CAACAGGACGTGCCCCCTGGTGG - Intronic
1165118733 19:33545529-33545551 CAGTAGAAAGTGCCCACAAGAGG + Intergenic
1165263052 19:34637119-34637141 CATGAGGAAATGCCACCAGGAGG + Intronic
1168059739 19:53884219-53884241 CGCTGGGAAGGGCCCCCAGACGG + Exonic
925245624 2:2379940-2379962 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
925264100 2:2552529-2552551 CACTAGGCAGTGCCACTATGGGG + Intergenic
925291963 2:2753999-2754021 CACTAGGCAGTGCCCCAGCGTGG - Intergenic
925737974 2:6980742-6980764 CACTAGGCAGTGCCCCAGTGGGG + Intronic
926099553 2:10105585-10105607 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
926598279 2:14814219-14814241 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
926919465 2:17926376-17926398 CACTTGGCAGTGCCCCAATGGGG + Intronic
927380763 2:22476779-22476801 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
928235708 2:29537626-29537648 CACTAGGAAGTGCCCCAGTGGGG - Intronic
928797555 2:35040504-35040526 CACTAGGTAATGCCCCAATGGGG - Intergenic
929081639 2:38127813-38127835 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
929260759 2:39864207-39864229 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
929391278 2:41471691-41471713 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
929665784 2:43832732-43832754 CACTAGGAAGTTCCCACAGAGGG + Intronic
929823644 2:45292950-45292972 CACCTGGAAGTGCTGCCAGGAGG - Intergenic
930427822 2:51234048-51234070 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
930438504 2:51377311-51377333 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
930490126 2:52058750-52058772 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
930514849 2:52393651-52393673 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
930931271 2:56886326-56886348 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
930942102 2:57025662-57025684 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
930960112 2:57251334-57251356 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
931176694 2:59861545-59861567 CACTAGGCAGTGCCCCACTGGGG + Intergenic
931272160 2:60712704-60712726 CACTAGGTGGTGCCCCCAGTAGG - Intergenic
931494079 2:62783354-62783376 CACTAGGCAGTGCCCCAGTGGGG + Intronic
931529687 2:63199763-63199785 CACTAGGCAGTGCCCCAGTGGGG - Intronic
931955444 2:67418943-67418965 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
933085139 2:78046266-78046288 CACTAGGCAGTGCCCCAATGGGG - Intergenic
933521593 2:83381210-83381232 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
933798676 2:85942396-85942418 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
933864120 2:86500456-86500478 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
934536563 2:95139259-95139281 CACTAGGCAGTGCCCCATTGGGG - Intronic
935323018 2:101906885-101906907 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
935792069 2:106601839-106601861 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
935927806 2:108089279-108089301 CACTAGGCAGTGCCCCAGGAAGG - Intergenic
935931646 2:108133205-108133227 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
936014484 2:108947409-108947431 CACTAGGCAGTGCCCCAGTGGGG + Intronic
936728917 2:115357643-115357665 CACTAGGCAGTGCCCCAGTGGGG + Intronic
936813622 2:116433002-116433024 CACCAGGCAGTGCCCCACGGGGG + Intergenic
937595044 2:123662086-123662108 CAATAGGAAGTGCTCACAAGTGG - Intergenic
937806466 2:126151081-126151103 CACTAGGGAGTGCCCCAATGGGG + Intergenic
937889502 2:126926536-126926558 CACTAGGCAGTGCCCCAGCGGGG - Intergenic
937935316 2:127239267-127239289 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
937935668 2:127242046-127242068 CACTAGGCAGTGCCCCAATGGGG + Intergenic
939092893 2:137799608-137799630 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
939241958 2:139572805-139572827 CACTAGGAAGTGCCCAAATGGGG - Intergenic
939361270 2:141175697-141175719 CACTAGGGAGTGCCCCAGTGGGG - Intronic
939453084 2:142398758-142398780 CACTAGGCAGTGCCCATATGGGG - Intergenic
939605919 2:144254608-144254630 CACTAGGCAGTGCCCCAGTGGGG - Intronic
939703244 2:145420333-145420355 CACTAGGAAGTGCCCCAGTGGGG + Intergenic
940355606 2:152738361-152738383 CACTAGGTAGTTCCCCCGTGGGG + Intronic
940359946 2:152786617-152786639 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
940408818 2:153336213-153336235 CACTAGGCAGTGCCCCAATAAGG - Intergenic
940444830 2:153765129-153765151 CACTAGGCAGTGCACCAATGGGG - Intergenic
940691364 2:156924308-156924330 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
941057615 2:160806695-160806717 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
941261834 2:163307135-163307157 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
941346274 2:164372723-164372745 CACTAGGCAGTGCCCCCGTGGGG - Intergenic
941349448 2:164414164-164414186 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
941430570 2:165409159-165409181 CACTAGGCAGTGCCCCAATGGGG - Intergenic
941445248 2:165591905-165591927 CACTAGGCAGTGCCCCAGTGGGG - Intronic
941513042 2:166437497-166437519 CACTAGGCAGTGCCCCAGTGGGG - Intronic
941525164 2:166597886-166597908 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
942803565 2:179903289-179903311 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
942846134 2:180428460-180428482 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
942904708 2:181166773-181166795 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
942991489 2:182208129-182208151 CACTAGGCAGTGCCCCAGTGAGG - Intronic
943153940 2:184149343-184149365 CACTAGGCAGTGCCCCAATGGGG + Intergenic
943315770 2:186385888-186385910 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
943414353 2:187581590-187581612 CAAAATGAAGTGCCCCCTGGTGG - Intergenic
943481718 2:188427814-188427836 CACTAGGCAGTGCCCCAATGGGG - Intronic
943491124 2:188557706-188557728 CACTAGGCAGTCCCCCAATGGGG + Intronic
943493397 2:188585347-188585369 CACTAGGCAGTGCCCCAGTGGGG + Intronic
943557856 2:189427483-189427505 CACTAGGCAGTGCCCCATTGGGG - Intergenic
943876201 2:193071143-193071165 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
944272180 2:197796236-197796258 CACTAGGCAGTGCCCCTGTGGGG + Intergenic
944303970 2:198157864-198157886 CACTAGGCAGTGCCCCAGTGGGG - Intronic
944307433 2:198194267-198194289 CACTAGGCAGTGCTCCAGGGGGG + Intronic
944371164 2:198985385-198985407 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
944808906 2:203308888-203308910 CACTAGGCAGTGCCCCAATGAGG - Intergenic
944827966 2:203504149-203504171 CACTAGGCAGTGCCCCAGTGGGG + Intronic
945357894 2:208860549-208860571 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
945484792 2:210382270-210382292 CACTAGGAAGTGCCCCAGTAGGG - Intergenic
945495253 2:210500817-210500839 CACTAGGCAGTGCCCCAGTGGGG + Intronic
945760027 2:213903199-213903221 CACTAGGCAGTGCCCCCGTAGGG + Intronic
946370759 2:219279947-219279969 CACTCTGAAGTGCCCCATGGTGG - Intronic
946395414 2:219441803-219441825 GACAAGGAAGGGGCCCCAGGTGG + Intronic
946581004 2:221128198-221128220 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
946635842 2:221724663-221724685 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
946709545 2:222492186-222492208 CACTAGGCAGTGCCCCAGTGGGG + Intronic
946928931 2:224653920-224653942 CACTAGGGAGGCCACCCAGGGGG + Intergenic
947183322 2:227432056-227432078 CACTAGGAAGTGCCCCAGTGAGG + Intergenic
947443205 2:230141264-230141286 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
947571494 2:231239021-231239043 CATATGGAAGTTCCCCCAGGTGG + Intronic
948292389 2:236835440-236835462 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
948752699 2:240141699-240141721 CACTAGGAAGATGCCCTAGGAGG + Intronic
948878949 2:240846050-240846072 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1169322513 20:4645211-4645233 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1169840136 20:9926629-9926651 CCCTAGGAAGAGCCCTCAGCTGG + Intergenic
1169857960 20:10124074-10124096 CACTAGGCAGAGCCCCCATAAGG + Intergenic
1170318659 20:15069890-15069912 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1170481985 20:16775117-16775139 CACTAGGTAGTGCCCCAATGGGG - Intergenic
1170938582 20:20830234-20830256 CACTAGGCAGTGCCCCCGTGGGG - Intergenic
1171216722 20:23357756-23357778 CATTAGGAAGAGACCCCACGAGG + Intergenic
1171534314 20:25872849-25872871 CACTAGGAAGTGCCCCAGTAGGG - Intergenic
1171571511 20:26255745-26255767 CACTAGGAAGTGCCCCAGTAGGG - Intergenic
1171749884 20:29038590-29038612 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1171792820 20:29543992-29544014 CACTAGGAAGTGCCCCAGTAGGG + Intergenic
1171855645 20:30340412-30340434 CACTAGGAAGTGCCCCAGTAGGG - Intergenic
1173023571 20:39287584-39287606 CACTAGGCAGTGCCCCAACAGGG - Intergenic
1173098509 20:40061292-40061314 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1173323397 20:42009979-42010001 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1175779079 20:61670901-61670923 CAAAAGGAAGGGCCCCTAGGAGG + Intronic
1176934059 21:14846089-14846111 CACTAGGCAGTGCCCCCATGGGG + Intergenic
1177133314 21:17283045-17283067 CACTAGGCAGTGCCCCAATGGGG - Intergenic
1177187062 21:17808473-17808495 CACTAGGCAGTGCCACAATGGGG - Intronic
1177197587 21:17919202-17919224 CACTAGGTGGTGCCCCCATAGGG + Intronic
1177271117 21:18850523-18850545 CACTAGGCAGTGACCCAATGGGG - Intergenic
1177317137 21:19477031-19477053 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1177471247 21:21563601-21563623 CACTAGGCAGTGCCCCAGTGTGG + Intergenic
1177487462 21:21777879-21777901 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1177525748 21:22287863-22287885 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
1177577395 21:22976111-22976133 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1177767368 21:25473933-25473955 CACTAGGAAGTGCCCAAGAGGGG - Intergenic
1177773611 21:25544390-25544412 CACCAGGCAGTGCCCCAATGGGG + Intergenic
1177803260 21:25848860-25848882 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1177854239 21:26383695-26383717 CACTAGGAAGTGGCCCAGTGGGG - Intergenic
1177857880 21:26419903-26419925 CACTAGGGAGTGCCCCAGTGGGG + Intergenic
1178261843 21:31106988-31107010 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1179450546 21:41465700-41465722 CACTACCAAGTGGCCCCAGAGGG + Exonic
1179527966 21:41996135-41996157 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1179964212 21:44791711-44791733 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1180152921 21:45961246-45961268 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1180153465 21:45965164-45965186 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1180393123 22:12303281-12303303 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1180406627 22:12561487-12561509 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1180573692 22:16752749-16752771 CACTAGGAAGTGCCCCAGTAGGG - Intergenic
1181358398 22:22316400-22316422 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1181383877 22:22529086-22529108 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
1181448614 22:23000595-23000617 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1181583052 22:23838457-23838479 GTATAGGAAGTGCCACCAGGCGG + Intronic
1182260471 22:29070477-29070499 AAATAGGAAGGGCACCCAGGAGG - Intergenic
1182815206 22:33156179-33156201 CACTAGGCAGTGCCCCAATAGGG - Intergenic
1182816838 22:33171845-33171867 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1183169152 22:36172239-36172261 AACGAGGAAGGGGCCCCAGGTGG - Intergenic
1184477509 22:44729599-44729621 CCCCAGGAAGTTCCTCCAGGCGG - Intronic
1184642589 22:45880331-45880353 CACTAGGAGGTCACCGCAGGTGG - Intergenic
949464379 3:4329235-4329257 CACTAGGCAGTGCCCCAGTGGGG + Intronic
949692356 3:6654780-6654802 CACTAGGAAGTGACCCAGTGGGG + Intergenic
949721797 3:6998507-6998529 CACTAGGCAGTGCCCCAGTGGGG + Intronic
950843224 3:15988009-15988031 CACTAGGCAGTGCCCCAATAGGG + Intergenic
951177119 3:19615143-19615165 CACTAGGCAGTGCCCCACTGGGG + Intergenic
951446121 3:22782470-22782492 CACTAGGCAGTGTCCCAAGGAGG + Intergenic
951755582 3:26087597-26087619 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
951779488 3:26346837-26346859 CACTTGGCAGAGACCCCAGGAGG + Intergenic
951801712 3:26603591-26603613 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
952022498 3:29040430-29040452 CACTAGGCAGTGCCCCAGGAGGG - Intergenic
952096493 3:29960511-29960533 CAGTAGGCAGTGCCCCAGGGGGG + Intronic
952530103 3:34254629-34254651 CACTAGGAAGTGGGCCCTAGAGG + Intergenic
952671525 3:35974687-35974709 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
952807948 3:37375097-37375119 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
953379354 3:42455231-42455253 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
953898465 3:46823152-46823174 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
953958097 3:47246902-47246924 CACAAGGAAGGGTCCTCAGGGGG - Intronic
954484589 3:50836197-50836219 CACTAAGCAGTGCCCCGGGGGGG + Intronic
955586253 3:60480921-60480943 CACTAGGCAGTGCCCCAGTGGGG + Intronic
956174075 3:66456930-66456952 CACCAGGGAGTGCCTCCAGCTGG - Intronic
956252980 3:67253918-67253940 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
956347830 3:68300039-68300061 CACTAGACAGTGCCCCCGTGGGG - Intronic
956474989 3:69610210-69610232 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
956714150 3:72063507-72063529 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
957412832 3:79862604-79862626 CACTAGGCAGTGCCACAATGGGG - Intergenic
957444014 3:80291700-80291722 CACTAGGCAGTGACCCAATGGGG + Intergenic
957868078 3:86050473-86050495 CACTAGGCAGTGCCCCAGTGGGG + Intronic
957909970 3:86607908-86607930 CACTAGGCAGTGCCCTGATGGGG + Intergenic
958018426 3:87969197-87969219 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
958065977 3:88545169-88545191 CACTAGGCAGTGCCCCACTGGGG - Intergenic
958128405 3:89386617-89386639 CACTAGGCAGTGCCCCACTGGGG - Intronic
958469423 3:94498798-94498820 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
958469798 3:94502906-94502928 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
958483663 3:94676534-94676556 CCCTAAGAAGAGCCCCTAGGAGG + Intergenic
958583941 3:96061743-96061765 CACTAGGAAATGCCCCAGTGGGG - Intergenic
958754551 3:98234892-98234914 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
958841398 3:99209558-99209580 CACTAGGAAGTGCCCCAGTGGGG + Intergenic
958861055 3:99445732-99445754 CACTAGGCAGTACCCCCAGTGGG - Intergenic
958927996 3:100179773-100179795 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
959172006 3:102854986-102855008 CACTAAGAAGTGCCCCAGTGGGG + Intergenic
959317063 3:104822127-104822149 CACTAGGAAGTGCCCCAGGAGGG - Intergenic
959508182 3:107177975-107177997 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
959719389 3:109469998-109470020 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
959846628 3:111040706-111040728 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
959901001 3:111661886-111661908 CACTAGGCAGTGCCCCAGTGGGG + Intronic
959929838 3:111967861-111967883 TTCTAGGAACTGCCACCAGGGGG - Intronic
959935312 3:112022826-112022848 CACTAGGAAGTGCCCCTGTCGGG - Intergenic
960224964 3:115158084-115158106 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
960478293 3:118158171-118158193 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
960541990 3:118871573-118871595 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
960563824 3:119113723-119113745 CACTAGGCAGTGCCCCAGTGGGG + Intronic
960858029 3:122123093-122123115 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
961270318 3:125683115-125683137 CTCCAAGAAGAGCCCCCAGGTGG - Intergenic
961490565 3:127254255-127254277 CACCAGGACCTGCCCCCACGTGG + Intergenic
962162147 3:133011530-133011552 CACTAGGAAGTGCCCCAGTAGGG + Intergenic
962162420 3:133013282-133013304 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
962726815 3:138236560-138236582 CACTAGCATGTGCCCACAGGAGG - Intronic
962951930 3:140227571-140227593 CACTAGGGAGTGCCCCAGGAGGG + Intronic
962974274 3:140432548-140432570 CACGGAGAAGTGCCCCCACGAGG - Intronic
963538910 3:146562238-146562260 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
963539455 3:146566943-146566965 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
964092384 3:152892303-152892325 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
964605558 3:158556469-158556491 CACTAGGCAGTGCCCCAATGGGG - Intergenic
964895503 3:161590624-161590646 CACTAGGCAGTGCCCCTGGTGGG + Intergenic
964912621 3:161800972-161800994 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
965052034 3:163663405-163663427 CACTAGGAAGTGCCACAGTGGGG - Intergenic
965065382 3:163841116-163841138 CACTAGGCAGTGCCCCAGAGGGG + Intergenic
965189157 3:165506301-165506323 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
965265009 3:166531819-166531841 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
965281851 3:166764788-166764810 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
965342203 3:167504138-167504160 CACTAGGCAGTGCCCCAGTGGGG - Intronic
965799545 3:172477480-172477502 CACTATGAGCTGCCACCAGGTGG - Intergenic
965931073 3:174043805-174043827 CAGTAGGCAGTGTCCCCAGTGGG + Intronic
966097902 3:176228390-176228412 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
966253908 3:177896814-177896836 CACTAAGAAGTGGACCCTGGGGG - Intergenic
966302721 3:178496965-178496987 CACTAGGCAGTGCCCCAGTGAGG - Intronic
966314784 3:178633244-178633266 CACTAGGCAGTGCCTCAATGGGG + Intronic
966333377 3:178840422-178840444 CACTAGGCAGTGCCCCAGTGGGG + Intronic
966407133 3:179609582-179609604 AACAAGGAAGGGGCCCCAGGTGG - Intronic
966733326 3:183168592-183168614 CACTAGGCAGTGCCCCGATAGGG + Intergenic
967097383 3:186188140-186188162 CAGTAGTAGGTGCCCTCAGGTGG - Intronic
967634984 3:191790770-191790792 CACTAGGCATTGCCCCCTTGGGG + Intergenic
967849479 3:194071159-194071181 CGCTCGGAAGTGCCCCCGGGCGG + Intergenic
968387537 4:155254-155276 CACTAGGCAGTGCCCCAGTGGGG - Intronic
968554493 4:1240284-1240306 CACCCGGGAGTCCCCCCAGGCGG - Intronic
968590420 4:1456239-1456261 CACTAGGCAGTGCCCCAGCGGGG + Intergenic
968969900 4:3788328-3788350 TACTGGGAGGTGGCCCCAGGGGG + Intergenic
969072621 4:4551641-4551663 CACTAGGCAGTGCCCCAATAGGG - Intergenic
969108003 4:4822527-4822549 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
969152071 4:5178030-5178052 CACTAGGCAGTGCCCCAGTGGGG + Intronic
969163181 4:5279599-5279621 CACTAGGCAGTGCCCCAGTGGGG + Intronic
969177007 4:5406410-5406432 CACTAGGCAGTGCCCCAGTGGGG + Intronic
969467729 4:7367620-7367642 CAGTAGGATTTGCCCCCATGGGG + Intronic
970061548 4:12039565-12039587 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
970360925 4:15308231-15308253 CACTAAGCAGTGCTCCCATGGGG + Intergenic
970577697 4:17444050-17444072 CACTAGGCAGTGCCCCAGTGCGG + Intergenic
970655895 4:18229648-18229670 CACTAGGCATTGCCCCAATGGGG + Intergenic
970678239 4:18477180-18477202 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
970788514 4:19828788-19828810 CACTAGGCAGTGCCCCAGAGGGG - Intergenic
970997453 4:22283370-22283392 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
971111612 4:23591984-23592006 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
971119667 4:23689653-23689675 CACTAGGCAGTGCCCCACTGGGG - Intergenic
971499217 4:27300505-27300527 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
971741308 4:30525400-30525422 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
971845808 4:31916541-31916563 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
971857077 4:32057974-32057996 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
971972258 4:33635248-33635270 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
972051652 4:34742904-34742926 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
972220587 4:36950068-36950090 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
972832727 4:42833040-42833062 CACTAGGCAGTGCCCCATTGGGG - Intergenic
972895980 4:43620401-43620423 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
973968833 4:56190785-56190807 CACTAGGCAGTGCCCCAGTGGGG + Intronic
974071467 4:57127870-57127892 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
974178709 4:58358513-58358535 CACTAGGAAGTGCCTCAGTGGGG - Intergenic
974269586 4:59633291-59633313 CACTAGGGAGTGCCCCAGGAGGG + Intergenic
974832900 4:67211261-67211283 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
974925412 4:68292108-68292130 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
975361281 4:73474982-73475004 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
975456513 4:74597443-74597465 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
976070133 4:81231568-81231590 CACTAGGCAGTGCCCCCATGGGG - Intergenic
976075830 4:81298203-81298225 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
976312194 4:83623291-83623313 CACAAGGCAGTGCCCCAATGGGG - Intergenic
976842263 4:89445415-89445437 CACTAGGAAATGCTCCAATGGGG + Intergenic
977006033 4:91570330-91570352 CACTAGGCAGTGCCCCAGTGGGG + Intronic
977063769 4:92288177-92288199 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
977093874 4:92714464-92714486 CACTAGGCAGTGCCCCAGTGGGG + Intronic
977365949 4:96068261-96068283 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
977592506 4:98842316-98842338 CACTAGGTAGTGCCCCAGGAGGG - Intergenic
977953490 4:103000873-103000895 CACTAGGTAGTGCCCCATTGGGG + Intronic
977977762 4:103286927-103286949 CACTAGGAAGCGCCCCAGTGAGG - Intergenic
978044958 4:104114492-104114514 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
978153453 4:105463979-105464001 CACTAGGCAGTGCCCCAATAGGG - Intronic
978213140 4:106162443-106162465 CACTAGGCAGTGCCCCAGTGGGG + Intronic
978226268 4:106338699-106338721 CACTAGGCAGTGCCCCAGTGGGG - Intronic
978252493 4:106649799-106649821 CACTAGGCAGTGCCCCCAGTGGG - Intergenic
978255994 4:106693659-106693681 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
978262256 4:106773859-106773881 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
978665991 4:111182817-111182839 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
978983709 4:114983184-114983206 CACTAGGCAGTGCCCCAGTGGGG - Intronic
979049342 4:115910228-115910250 CACTAGGCAGTGCCCCCATGGGG + Intergenic
979058848 4:116029770-116029792 CACTAGGCAGTGCCCCAATGGGG - Intergenic
979183437 4:117758126-117758148 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
979373221 4:119914256-119914278 CACTAGGGAGTGCCCCAGTGGGG + Intergenic
979721487 4:123905377-123905399 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
979824953 4:125221210-125221232 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
979984346 4:127295765-127295787 CACTAGGCAGTGCCCCTGTGGGG + Intergenic
980065778 4:128187145-128187167 CACTAGGCAGTGCCCCAGTGGGG - Intronic
980293121 4:130870760-130870782 CACTAGGCAGTGCCCCATTGGGG - Intergenic
980324504 4:131324230-131324252 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
980346869 4:131633400-131633422 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
980383571 4:132058466-132058488 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
980532554 4:134073570-134073592 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
980545778 4:134259942-134259964 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
980702835 4:136455014-136455036 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
980742720 4:136973266-136973288 CACTAGGAAGTGCTCCAGTGGGG + Intergenic
981356849 4:143799043-143799065 CACTAGGGAGTGCCCCACTGGGG + Intergenic
981368377 4:143929640-143929662 CACTAGGGAGTGCCCCACTGGGG + Intergenic
981378174 4:144039925-144039947 CACTAGGGAGTGCCCCACTGGGG + Intergenic
981407183 4:144385376-144385398 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
981540491 4:145841709-145841731 CAATGGGAAGTGCCCCGATGAGG + Intronic
981862932 4:149379246-149379268 CACTAGGCAGTGCCCCAATGAGG - Intergenic
982299913 4:153867922-153867944 CACTAGGCAGTGCCCCTGTGGGG - Intergenic
982389883 4:154852590-154852612 CACTAGGCAGTGCCCTCATGCGG + Intergenic
982554303 4:156840571-156840593 CACTAGGCAGTGCCCCAGTGGGG - Intronic
982854340 4:160362316-160362338 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
982987743 4:162232198-162232220 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
983048130 4:163011179-163011201 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
983075153 4:163316892-163316914 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
983089500 4:163487121-163487143 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
983393946 4:167169179-167169201 CACTAGGCAGTGCCCCAGTGGGG - Intronic
983657468 4:170098047-170098069 CAGTAGGAAGTGCCCCACTGAGG + Intergenic
983874781 4:172863229-172863251 CACTAGGTAGTGCCCCAGTGGGG - Intronic
983889516 4:173016255-173016277 CACTAGGTAGTGCCCCAGTGGGG - Intronic
984026349 4:174547772-174547794 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
984436686 4:179718742-179718764 CACTAGGCAGTGCCCCATTGGGG + Intergenic
985386394 4:189452514-189452536 CACTAGGCAGTGCTCCAGGGGGG - Intergenic
985431795 4:189888247-189888269 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
986014707 5:3747782-3747804 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
986081091 5:4394937-4394959 CACTAGGCAGTGCCCCAATAGGG + Intergenic
986099755 5:4596260-4596282 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
986164885 5:5264837-5264859 CACTGGGAAGGTCCCCCAGAGGG - Intronic
986197420 5:5550935-5550957 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
986472956 5:8094116-8094138 CACTAGGCATTGCCCCAATGGGG + Intergenic
986798134 5:11232224-11232246 CACTAGGCAGTGCCCCAGTGGGG - Intronic
986916373 5:12625333-12625355 CACTAGGCAGTGCCCCGGTGTGG - Intergenic
986949135 5:13060503-13060525 CACTAGGCAGTGCCCCGGTGGGG + Intergenic
986949915 5:13070760-13070782 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
987201690 5:15583800-15583822 CACTAGGCAGTGCCCCAGTGGGG + Intronic
987435284 5:17885894-17885916 CACTAGGCAGTGCCCCAATAGGG - Intergenic
987543434 5:19283953-19283975 CACTAGGCAGTGCCCCCATGGGG + Intergenic
987659592 5:20855148-20855170 CACTAGGCAGTGCCCCAATGGGG - Intergenic
987663270 5:20904880-20904902 CACTAGGAAGTGCCCTGATAGGG + Intergenic
987663615 5:20907812-20907834 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
987680810 5:21133683-21133705 CACTAGGCAGTGTCCCCAGTGGG - Intergenic
987744121 5:21948178-21948200 CACTAGGCAGTGCCCCAGTGGGG - Intronic
988009631 5:25465255-25465277 CACTAGGGAGTGCCTCATGGGGG - Intergenic
988038750 5:25861128-25861150 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
988040910 5:25888100-25888122 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
988074757 5:26338548-26338570 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
988138128 5:27201186-27201208 CACTAGGCAGTGCCCCTTTGGGG + Intergenic
988170763 5:27652536-27652558 CACTAGGCAGTGCCCCGGTGAGG - Intergenic
988261106 5:28886975-28886997 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
988310300 5:29548427-29548449 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
988379393 5:30480930-30480952 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
988386612 5:30573932-30573954 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
988759070 5:34294377-34294399 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
988759420 5:34297305-34297327 CACTAGGAAGTGCCCTAATAGGG - Intergenic
988770419 5:34427417-34427439 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
988928580 5:36013735-36013757 CACTAGGCAGTGCCCCTGTGGGG - Intergenic
989144503 5:38235274-38235296 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
989203296 5:38786951-38786973 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
989229042 5:39065997-39066019 CACTAGGCAGTGCCCCACTGGGG + Intronic
989434706 5:41397582-41397604 CACTAGGCAGTGCCCCAGTGGGG - Intronic
989501847 5:42177262-42177284 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
989726828 5:44597216-44597238 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
989746864 5:44839564-44839586 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
990143399 5:52731298-52731320 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
990484281 5:56242809-56242831 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
990784917 5:59408513-59408535 CACTAGGCAATGCCCCAGGGGGG - Intronic
990941428 5:61206450-61206472 CACTAGGCAGTGCCCCAATAGGG + Intergenic
991042832 5:62193488-62193510 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
991090534 5:62689971-62689993 CACACGGAAGTGCTGCCAGGGGG + Intergenic
991136283 5:63185920-63185942 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
991764325 5:69958315-69958337 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
991783003 5:70159832-70159854 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
991843557 5:70833387-70833409 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
991875444 5:71160159-71160181 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
992666251 5:79012494-79012516 CACTAGGCAGTGCCCCAGTGGGG + Intronic
992817879 5:80463130-80463152 CACTAGGCAGTGCCCCAGTGGGG + Intronic
993000921 5:82379770-82379792 CACTAGGCAGTGCCCCAGTGGGG + Intronic
993067038 5:83113485-83113507 CACTAGGCAGTGCCCCAGTGGGG + Intronic
993198511 5:84782030-84782052 CACTAGGTAGTGCCCCAGCGAGG + Intergenic
993711539 5:91230229-91230251 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
993890172 5:93463484-93463506 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
994019005 5:95002290-95002312 CACTAGGCAGTGCCCCAGTGAGG - Intronic
994019315 5:95004871-95004893 CATTAGGCAGTGCCCCAATGGGG - Intronic
994808279 5:104479541-104479563 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
994936081 5:106255364-106255386 CACTAGGAAGTGCTCCAGTGGGG - Intergenic
995011357 5:107260112-107260134 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
995132777 5:108647839-108647861 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
995590951 5:113699240-113699262 CACTAGGCAGTGCCCCCATGGGG + Intergenic
995591576 5:113705602-113705624 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
995702856 5:114955402-114955424 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
995925567 5:117369553-117369575 CACTAGGCAGTGCCCCAATGGGG - Intergenic
995997835 5:118322589-118322611 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
996026988 5:118657442-118657464 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
996098143 5:119420750-119420772 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
996122871 5:119691294-119691316 CACTAGGCAGTGCCCCACTGGGG + Intergenic
996159473 5:120145173-120145195 AACTAGGCAGTGCCCCAAAGGGG + Intergenic
996255903 5:121402852-121402874 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
996284288 5:121770301-121770323 CACTAGGAAGTGTCCCAGTGAGG - Intergenic
996605212 5:125313421-125313443 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
996636162 5:125692259-125692281 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
996829149 5:127720572-127720594 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
996839872 5:127836441-127836463 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
997102046 5:130980381-130980403 CACTAGGCAGTGCCCCAATAAGG + Intergenic
997651315 5:135523538-135523560 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
997789367 5:136743318-136743340 CACTAGGCAGTGCCCAAATGGGG - Intergenic
998577075 5:143327946-143327968 CACTAGGTAGTGCCCCAGTGGGG + Intronic
998581830 5:143384859-143384881 CACTAGGCAGTGCCCCAGTGGGG + Intronic
998873440 5:146575620-146575642 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
999504383 5:152179952-152179974 CACCAGGCAGTGCCCCCAGTGGG + Intergenic
999571650 5:152925912-152925934 CACTAGGCAGATCCCCCATGGGG - Intergenic
999906176 5:156143402-156143424 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1000141121 5:158404283-158404305 CACTAGGGAGTGCCCCAGTGGGG - Intergenic
1000728483 5:164801767-164801789 CAGTAGGCAGTGCCCCAATGGGG + Intergenic
1000784668 5:165528740-165528762 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
1000929331 5:167232203-167232225 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1001194864 5:169663407-169663429 CACTAGGCAGTGCCTCACGGGGG + Intronic
1001756417 5:174173805-174173827 CATCAGCAAGTTCCCCCAGGAGG + Intronic
1001963330 5:175893832-175893854 CTCTAGGAAATGCCCCCAGCAGG - Intergenic
1001991060 5:176115603-176115625 CACCAGGAAGGGCCCCGACGTGG + Intronic
1001994268 5:176142925-176142947 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1002002926 5:176208234-176208256 CACTAGGAAGTGTTCCAATGGGG + Intergenic
1002223581 5:177703019-177703041 CACTAGGAAGTGTTCCAATGGGG - Intergenic
1002225811 5:177722537-177722559 CACCAGGAAGGGCCCCGACGTGG - Intronic
1002268039 5:178048675-178048697 CACCAGGAAGGGCCCCGACGTGG + Intronic
1002757156 6:172800-172822 CACTAGGCAGTGCCCCAGGTGGG - Intergenic
1002793999 6:456250-456272 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1002858028 6:1055449-1055471 CACTGGGCAGTGAGCCCAGGAGG + Intergenic
1002869857 6:1157008-1157030 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1003000261 6:2325361-2325383 CACTAGGCAGTGCCCCATTGGGG - Intergenic
1003230006 6:4243389-4243411 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1003403090 6:5806969-5806991 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1003791486 6:9551977-9551999 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1003948211 6:11094157-11094179 CCCTCGGCAGCGCCCCCAGGGGG - Exonic
1004165849 6:13255926-13255948 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1004186953 6:13429066-13429088 TACTAAGATGTGCTCCCAGGTGG + Intronic
1004245659 6:13972875-13972897 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1004430261 6:15536710-15536732 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1005113664 6:22313565-22313587 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1005153626 6:22779575-22779597 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1005180208 6:23095896-23095918 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1005597650 6:27394620-27394642 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1006883196 6:37357062-37357084 CAGTAGGAATTGTGCCCAGGAGG + Intronic
1007021525 6:38526476-38526498 CACTAGGTAGTGCCCCAGTGGGG - Intronic
1007223502 6:40296853-40296875 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1008498914 6:52161076-52161098 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1009309671 6:62134514-62134536 CACTAGGAAGTGCCCCAGTGGGG - Intronic
1009605078 6:65857232-65857254 CACTAGGCAGTGTCCCAATGGGG + Intergenic
1009680093 6:66880941-66880963 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1009726585 6:67543158-67543180 CACTAGGAAGTGCCCCAATGGGG - Intergenic
1009791177 6:68403521-68403543 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1010268283 6:73891891-73891913 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
1010458170 6:76082749-76082771 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1010517372 6:76789814-76789836 CACTAGGGAGTGCCCCAGTGAGG + Intergenic
1010527775 6:76924616-76924638 CACTAGGCAGTGCCCCAGAGGGG - Intergenic
1010530987 6:76966960-76966982 CACTAGGCAGTGCCCTCATAGGG - Intergenic
1010536640 6:77038825-77038847 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1010594559 6:77748172-77748194 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1010618274 6:78041385-78041407 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1010659742 6:78556185-78556207 CACTAAGAAGTGCCCCAGTGGGG + Intergenic
1010821732 6:80422437-80422459 CACTAGGCAGTGCCCCATTGGGG - Intergenic
1011287967 6:85745006-85745028 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1011343745 6:86346599-86346621 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1011895283 6:92217272-92217294 CACTAGGCAGTGCCCCAATGGGG - Intergenic
1011950583 6:92959309-92959331 CACTAGGCTGTGCCCCAAGAGGG + Intergenic
1012045129 6:94263757-94263779 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1012179847 6:96139489-96139511 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1012254462 6:97016152-97016174 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1012683243 6:102209765-102209787 CACTAGGAAGTGCCCCAGTAGGG - Intergenic
1012723885 6:102783943-102783965 CACTAGGAAGTGCCCCAGTAGGG - Intergenic
1012755782 6:103228277-103228299 CACTAGGCAGTGCCCCATGGAGG - Intergenic
1012771110 6:103436466-103436488 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1012780055 6:103546599-103546621 CACTAGGCAGTGCCCCAGGGGGG + Intergenic
1012967169 6:105687318-105687340 CACTAGGCAGTGCCCCGGTGGGG - Intergenic
1013159042 6:107523616-107523638 CCCTAGGAGGTGGCCCCACGTGG + Intronic
1013338700 6:109191896-109191918 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1013549169 6:111190447-111190469 CACTAGGCAGTGCCCCACTGGGG + Intronic
1013863174 6:114660708-114660730 CACTAGGCAGTGCCCCAATAGGG - Intergenic
1014067662 6:117145781-117145803 CACTAGGCAGTGCCCCAGTGTGG + Intergenic
1014075589 6:117230902-117230924 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1014342572 6:120228116-120228138 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1014407027 6:121064868-121064890 CACTAGGCAGTGCCCCAACAGGG - Intergenic
1014524925 6:122491099-122491121 CACTAGGAAGAGGCCCAAGCAGG + Intronic
1014670771 6:124301433-124301455 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1014714593 6:124849307-124849329 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
1014883919 6:126756599-126756621 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1014895233 6:126892976-126892998 CACTAGGCAGTGCGCCCATGGGG - Intergenic
1014951232 6:127558373-127558395 CACTAGGTAGTGCCCCAGTGGGG - Intronic
1015039882 6:128703868-128703890 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1015347244 6:132174761-132174783 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1015995799 6:138994334-138994356 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1016126350 6:140408616-140408638 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1016151536 6:140747638-140747660 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1016611929 6:145999654-145999676 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
1016613780 6:146024257-146024279 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1016693482 6:146965655-146965677 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1017133603 6:151129288-151129310 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1017231391 6:152077446-152077468 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1017724382 6:157266987-157267009 CCCCAGTAAGTGCCCCGAGGCGG + Intergenic
1017763732 6:157590706-157590728 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1018155737 6:160983661-160983683 CACTAGGCAGTGCCCCAGAGGGG - Intergenic
1018358281 6:163040419-163040441 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1018489729 6:164279716-164279738 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1018507087 6:164483267-164483289 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1018510550 6:164520122-164520144 CACTAGGAAGTGCCCCACTGGGG - Intergenic
1018516081 6:164581432-164581454 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1018566843 6:165163379-165163401 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1019050603 6:169180144-169180166 CACCAGGAAGTGCCCCAGTGGGG + Intergenic
1019073943 6:169371620-169371642 CACCAGGAAGGGCCCTGAGGGGG + Intergenic
1019084987 6:169467313-169467335 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1019150397 6:170001648-170001670 CACTAGGAAGTGCCCCAGTAGGG + Intergenic
1020373630 7:7461308-7461330 CACTGGGAAAAGCCCACAGGGGG + Intronic
1020565333 7:9787799-9787821 CACTAGGAAGTGCCCCAGTGGGG + Intergenic
1020585061 7:10055404-10055426 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1020611271 7:10401125-10401147 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1020729709 7:11866194-11866216 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1020730196 7:11870137-11870159 CACTAGGAAGTGCCCCAGTGGGG - Intergenic
1020869334 7:13607824-13607846 CACTAGGCAGTGCCCCAATGAGG - Intergenic
1021096357 7:16539988-16540010 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1021326288 7:19273386-19273408 CATTAGGAAGTGCGCCCCAGTGG + Intergenic
1022101229 7:27170103-27170125 CCCTAAGGAGTGCCGCCAGGTGG + Intronic
1022512863 7:30952334-30952356 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1022735304 7:33070552-33070574 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1022852724 7:34282055-34282077 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1023669392 7:42560308-42560330 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
1023804126 7:43859247-43859269 CACTAGGCAGTGCCCCAATGGGG - Intergenic
1024012234 7:45278800-45278822 CACCAGGAGCTGCTCCCAGGAGG + Intergenic
1024413743 7:49078816-49078838 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1024667293 7:51559558-51559580 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1024729280 7:52236243-52236265 CACTAGGTAGTGCCCCAGTGCGG - Intergenic
1024778750 7:52821693-52821715 CACTAGGCAATGCCCCAGGGGGG + Intergenic
1025285805 7:57659780-57659802 CACTAGGAAGTGCCCCAGTAGGG - Intergenic
1025300346 7:57814984-57815006 CACTAGGAAGTGCCCCAGTAGGG + Intergenic
1027584780 7:80044628-80044650 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1027733894 7:81908012-81908034 CACTAGGTGGTACCCCCACGGGG + Intergenic
1028066537 7:86391687-86391709 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1028140925 7:87274125-87274147 CACTAGGCAGTGCCCCAGCGGGG + Intergenic
1028493683 7:91441349-91441371 CACTAGGTAGTGCCCCAGAGGGG - Intergenic
1028844183 7:95461121-95461143 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1028961017 7:96749889-96749911 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1029120023 7:98261562-98261584 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1030381202 7:108813666-108813688 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1030527618 7:110672978-110673000 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1030752211 7:113241932-113241954 CATTAGGCAGTGCCCCAATGAGG - Intergenic
1030809872 7:113959167-113959189 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1030907638 7:115206495-115206517 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1030970079 7:116045689-116045711 CACTAGGCAGTGCCCCAGGAGGG - Intronic
1031175075 7:118339315-118339337 CACTAGGCAGTGCCCCAGGAGGG - Intergenic
1031330362 7:120456795-120456817 CACTAGGCAGTGCCCCAGTGAGG + Intronic
1031365508 7:120895790-120895812 CACTAAGAAGTGCCCCAATAGGG - Intergenic
1031818797 7:126473104-126473126 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1031914093 7:127546173-127546195 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1032366794 7:131307358-131307380 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1033721123 7:144060410-144060432 CAGTAGGCAGTGCCCCAATGAGG - Intergenic
1033910733 7:146260320-146260342 CACTAGGCAGTGCCCCAGGTGGG - Intronic
1033953352 7:146813156-146813178 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1034212137 7:149373176-149373198 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1034451021 7:151137358-151137380 CACAAAGAAATGGCCCCAGGCGG - Intronic
1034689267 7:153000839-153000861 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1034710356 7:153185698-153185720 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1034876123 7:154726210-154726232 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1036277628 8:7369396-7369418 CACTAGGCAGTGCCCCAGTGTGG - Intronic
1037511290 8:19585958-19585980 CAGCAGGCAGAGCCCCCAGGAGG + Intronic
1039168533 8:34714542-34714564 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
1039798889 8:40937593-40937615 CAGTTGAAAGTGCCCCCTGGTGG + Intergenic
1039829245 8:41199918-41199940 GACTTGGATGTGCCCCCAGAAGG + Intergenic
1039863894 8:41484202-41484224 CACATGGAAGAGCCCACAGGGGG + Intergenic
1039956094 8:42208096-42208118 CGGTAGGAGGTGCCCCCATGGGG + Intergenic
1040554035 8:48463234-48463256 CACTAGGAAGTGCCAGACGGTGG - Intergenic
1040645043 8:49388156-49388178 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1040797281 8:51299986-51300008 CACTAGGCAGTGCCCCATTGGGG + Intergenic
1040863493 8:52024378-52024400 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1040925870 8:52681956-52681978 CACTAGGGAGTGCCCCCAGTAGG - Intronic
1041351362 8:56950968-56950990 CACTAGGCAGTGCCCCAGCGGGG + Intergenic
1041781325 8:61580251-61580273 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1041902466 8:62997025-62997047 CACTAGGTAGTGCCCCAGTGAGG + Intronic
1041927586 8:63252394-63252416 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1041955437 8:63553952-63553974 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1042407517 8:68422666-68422688 CACTAGGCAGTGCCCCAATGGGG + Intronic
1042528983 8:69795703-69795725 CACTAGGCAGTGCCCCAATGGGG + Intronic
1042728315 8:71902973-71902995 CACTAGGCAGTGCCCCAACAGGG + Intronic
1042895012 8:73657269-73657291 CATAAGGAAGTGCCACAAGGTGG + Intronic
1042989225 8:74620347-74620369 CTCTAGGCAGTGCCCGCATGGGG + Intronic
1043085573 8:75827409-75827431 AACTAGGCAGTGCCCCAGGGGGG - Intergenic
1043345846 8:79296934-79296956 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1043471691 8:80569315-80569337 CACCAGGAAGCCCCACCAGGAGG - Intergenic
1043704364 8:83330226-83330248 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1043714720 8:83467404-83467426 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1043805873 8:84671387-84671409 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1043940420 8:86190070-86190092 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1044040156 8:87357231-87357253 CACTAGGCAGTGCCCCAATGGGG - Intronic
1044188469 8:89284071-89284093 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1044205816 8:89490940-89490962 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1044303954 8:90616752-90616774 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1045176080 8:99726422-99726444 CAATAGGCAGTGCACACAGGAGG - Intronic
1045207446 8:100056854-100056876 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1045597170 8:103669921-103669943 CACTAGGCAGTGCCCCAGTGTGG + Intronic
1045597545 8:103673301-103673323 TACTAGGCAGTGCCCCAGGGGGG + Intronic
1046359481 8:113131674-113131696 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1046452777 8:114415531-114415553 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1046607646 8:116389031-116389053 CACTAGGGAGTGCCCCAGTGGGG - Intergenic
1046640218 8:116721465-116721487 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1046880173 8:119299053-119299075 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1047060427 8:121219195-121219217 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1047153743 8:122294436-122294458 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1047649057 8:126900198-126900220 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1047918025 8:129603715-129603737 CACTAGGCAGTGCCCCACTGGGG + Intergenic
1047923355 8:129657612-129657634 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1047937716 8:129798488-129798510 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1048043297 8:130751002-130751024 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1048137434 8:131759917-131759939 CACTAGGAAGTGCCCCAATGGGG - Intergenic
1048416771 8:134235412-134235434 CCCTAGGCAGTGCCCCCCTGGGG + Intergenic
1048537659 8:135312658-135312680 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1048758661 8:137767267-137767289 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1049449158 8:142649830-142649852 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1049612579 8:143562331-143562353 CACTGGTCAGTGCCCCCAGCAGG - Exonic
1049828651 8:144685921-144685943 CGCGAGGCAGTGCCCCCTGGCGG - Intergenic
1049836487 8:144738799-144738821 CACAAACAGGTGCCCCCAGGAGG - Intronic
1050053015 9:1622858-1622880 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
1050674502 9:8036734-8036756 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1050773579 9:9233998-9234020 CACTAGGTAGTGCCCCGGTGGGG + Intronic
1050935773 9:11392947-11392969 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1051767416 9:20540273-20540295 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1051920717 9:22260468-22260490 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
1052053937 9:23882539-23882561 CACTAGGAAGTGCCCCAGTGGGG + Intergenic
1052120867 9:24714574-24714596 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1052179004 9:25502115-25502137 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1052518160 9:29510128-29510150 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1052526890 9:29629812-29629834 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1052540943 9:29810855-29810877 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
1052542451 9:29828259-29828281 CAGTAGGAAGTGCCCCAGTGGGG - Intergenic
1052557106 9:30031971-30031993 CACTAGGAAGTGCCCCAGTGGGG + Intergenic
1053084227 9:35204356-35204378 CACTAGGCAGTGCCCCAGTGTGG - Intronic
1053264216 9:36698813-36698835 CACTAGGTAGTACCCCCGTGGGG + Intergenic
1053616361 9:39770432-39770454 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1053619676 9:39802575-39802597 CACTAGGCAGTGCCCCAGTGCGG - Intergenic
1053675419 9:40420848-40420870 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1053793466 9:41703703-41703725 CACTAGGAAGTGCCCCAGTAAGG - Intergenic
1053874526 9:42529739-42529761 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1053877848 9:42561891-42561913 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1053894806 9:42732475-42732497 CACTAGGCAGTGCCCCAGTGCGG + Intergenic
1053898088 9:42764848-42764870 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1053925209 9:43047185-43047207 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1054181876 9:61915718-61915740 CACTAGGAAGTGCCCCAGTAAGG - Intergenic
1054233847 9:62539803-62539825 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1054237156 9:62571957-62571979 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1054264482 9:62904868-62904890 CACTAGGCAGTGCCCCAGTGCGG + Intergenic
1054267808 9:62937016-62937038 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1054288691 9:63259374-63259396 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1054323889 9:63703657-63703679 CAGTAGGAAGAAACCCCAGGAGG - Intergenic
1054345028 9:63905870-63905892 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1054386517 9:64560911-64560933 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1054471481 9:65542266-65542288 CACTAGGAAGTGCCCCAGTAAGG + Intergenic
1054509203 9:65955444-65955466 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1054897313 9:70328718-70328740 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1055170764 9:73255199-73255221 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1055225466 9:73989808-73989830 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1055715087 9:79108812-79108834 CACTAGGCAGTGCCCCAGCGGGG - Intergenic
1056042817 9:82685687-82685709 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1056092250 9:83216685-83216707 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1056325559 9:85475444-85475466 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1056536118 9:87529183-87529205 CACTTGGAAGAGGGCCCAGGAGG - Intronic
1057325681 9:94061428-94061450 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1057749492 9:97780141-97780163 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1058101826 9:100925130-100925152 CACCAGGAAGTGCCCCAGTGGGG - Intergenic
1058210433 9:102161377-102161399 CACTAGGAAGTGCCCCAATTGGG + Intergenic
1058288542 9:103209837-103209859 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1058307708 9:103463957-103463979 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1058385389 9:104429590-104429612 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1058810046 9:108630577-108630599 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1059023011 9:110596875-110596897 CACTAGGAAGTGCTCCAGTGGGG + Intergenic
1059421082 9:114192804-114192826 AACTAGAAAGTGCCTCCAGAAGG - Intronic
1059587220 9:115619529-115619551 CACTAGGCAGTGCCCCCAGTAGG + Intergenic
1059601446 9:115783493-115783515 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1061551385 9:131336782-131336804 AACTAGGAAGAGCCAGCAGGAGG + Intergenic
1062382932 9:136296308-136296330 CACCAGCAAGAGCCCCCAGGTGG - Intronic
1062438808 9:136559843-136559865 CACTAGGCAGTGCCCCAGCGGGG - Intergenic
1062639443 9:137510791-137510813 CACCAGGCAGTGCCCCCGTGTGG + Intronic
1186488533 X:9952991-9953013 CACTAGGCAGTGCCCCACTGGGG + Intergenic
1186613025 X:11156969-11156991 CTCTAGAAAGTGCCCCCATTGGG - Intronic
1186926194 X:14335713-14335735 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1187002757 X:15199582-15199604 CACTAGGTAGTGCCCCAGTGGGG + Intergenic
1187214695 X:17264952-17264974 CACTAGGCAGTGCCCCTGTGGGG - Intergenic
1187574789 X:20542642-20542664 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1187598435 X:20800360-20800382 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1187643378 X:21319166-21319188 CACTAGGGAGTGCCCCAGTGGGG + Intergenic
1187649946 X:21391234-21391256 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1188115572 X:26238718-26238740 CACTAGGCAGTACCCCAATGGGG + Intergenic
1188127138 X:26383393-26383415 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1188162379 X:26819636-26819658 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1188259678 X:28008087-28008109 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1188389922 X:29607536-29607558 GAATGAGAAGTGCCCCCAGGAGG - Intronic
1188457176 X:30380014-30380036 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1188587926 X:31800144-31800166 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1188662312 X:32775310-32775332 CACTAGGCAGTGCCCCAGTGAGG + Intronic
1188719520 X:33505767-33505789 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1188807821 X:34613617-34613639 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1188833376 X:34928269-34928291 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1188889713 X:35595252-35595274 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1189035089 X:37487585-37487607 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1189071277 X:37866498-37866520 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1189176535 X:38963312-38963334 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1189652797 X:43208310-43208332 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1189869704 X:45369228-45369250 CACTAGGCAGTGCCCCATTGGGG - Intergenic
1190466176 X:50726851-50726873 CAATAGGCAGTGCCCCAATGGGG - Intronic
1190499730 X:51062677-51062699 CACTAGGCAGTGCCCCATTGGGG - Intergenic
1190531781 X:51386068-51386090 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1190974562 X:55386788-55386810 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1191096794 X:56681442-56681464 CACTAGGAAGTGCCCCAGTGGGG - Intergenic
1191595898 X:62943906-62943928 CACTAGGCAGTGCCCCAATGAGG + Intergenic
1191602667 X:63026892-63026914 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1191607859 X:63081418-63081440 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1191674229 X:63778007-63778029 CACTAGGCAGTGCCCCAGTGGGG + Intronic
1191689798 X:63927891-63927913 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1191694842 X:63978941-63978963 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1191877752 X:65813253-65813275 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1192131865 X:68559245-68559267 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1192676544 X:73202758-73202780 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1192713555 X:73616473-73616495 CACTAGGCAGTGCCCCAGTGAGG + Intronic
1193139924 X:78016960-78016982 CACTAGGCAGTGCCCCATTGGGG + Intronic
1193271480 X:79534573-79534595 CACTAGGCAGTGCCCCGCTGAGG + Intergenic
1193273365 X:79555011-79555033 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1193320433 X:80115059-80115081 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1193643465 X:84039746-84039768 CACTAGGAAGTGCCTCAGTGGGG + Intergenic
1193827321 X:86242085-86242107 CACTAGGCAGTGCCCCATTGGGG - Intronic
1193865854 X:86728972-86728994 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1193871559 X:86805029-86805051 TACTAGGCAGTGCCCCAATGGGG + Intronic
1193900229 X:87167583-87167605 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1193981371 X:88185660-88185682 CACTAGTAAGTGCCCCACTGGGG - Intergenic
1194023835 X:88726553-88726575 CACTAGGTAGTGCCCCAGTGAGG + Intergenic
1194048016 X:89033559-89033581 CACTAGGCAGTGCCCCAGTGAGG + Intergenic
1194048658 X:89039552-89039574 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1194053790 X:89105033-89105055 CACTAGGAAGTGCCTCAGTGGGG + Intergenic
1194082880 X:89490027-89490049 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1194107756 X:89792767-89792789 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1194119212 X:89939155-89939177 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1194149781 X:90309753-90309775 CACTAGGCAATGCCCCAAGTGGG + Intergenic
1194184975 X:90764951-90764973 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1194219843 X:91176793-91176815 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1194306777 X:92257914-92257936 CACTAGGCAGTGCCCCAGAGGGG + Intronic
1194328875 X:92556745-92556767 CACTAGGCAGTGCCCCAAAGGGG + Intronic
1194560348 X:95412001-95412023 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1194590830 X:95797933-95797955 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1194841695 X:98752032-98752054 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1194850259 X:98860189-98860211 CACTAGGCAGTGCCCCACTGGGG - Intergenic
1195289746 X:103420642-103420664 CACTAGGCAGTGCCCCATTGGGG + Intergenic
1195457383 X:105084202-105084224 CACTAGGCAGTGCCCCATTGGGG - Intronic
1195536338 X:106012985-106013007 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1195814190 X:108867560-108867582 CACTAGACAGTGCCCCCATGGGG + Intergenic
1195816802 X:108896889-108896911 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
1196173675 X:112617132-112617154 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1196223530 X:113139200-113139222 CACTAGGCAGTGCCCCAGAGGGG + Intergenic
1196313474 X:114196439-114196461 CACTAGGGAGTGCTCCAATGGGG + Intergenic
1196390612 X:115203883-115203905 CACTAGGCACTGCCCCAATGGGG + Intronic
1196480486 X:116141763-116141785 CACTAGGCAGTGCCCCAATAGGG - Intergenic
1196582515 X:117393855-117393877 CACTAGGAAGTGCCCCAGTGGGG + Intergenic
1196903498 X:120409779-120409801 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1196996306 X:121387938-121387960 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1197023441 X:121717958-121717980 CACTAGGCAGTGCCCCATTGGGG + Intergenic
1197040446 X:121930047-121930069 CACTAGGCAGTGCCCCAGTGAGG - Intergenic
1197088650 X:122510133-122510155 CACTAGGCAGTGCCCCAGTGTGG + Intergenic
1197094268 X:122574666-122574688 CACTAGGAAGTGCCCCACTGGGG + Intergenic
1197464297 X:126784302-126784324 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1198304617 X:135368385-135368407 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1198517906 X:137427407-137427429 GGCTAGGAGGGGCCCCCAGGCGG + Intergenic
1198835009 X:140795581-140795603 CACTAGGCAGTGCCCCACGGGGG + Intergenic
1198872849 X:141194045-141194067 CACTAGGGAGTGCCCCAGTGGGG - Intergenic
1198912852 X:141633781-141633803 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1199072733 X:143497879-143497901 CACCAGGAAGTGCCCCAGTGGGG + Intergenic
1199077863 X:143544986-143545008 CACTAGGCAGTGCCCCTGTGGGG + Intergenic
1199112841 X:143955463-143955485 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1199139258 X:144290254-144290276 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1199193322 X:144997500-144997522 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1199228703 X:145409787-145409809 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
1199289880 X:146093690-146093712 CACAAGGCAGTGCCCTCATGGGG + Intergenic
1199306220 X:146270027-146270049 CACTAGGTAGTGCCCCAGTGGGG - Intergenic
1199349853 X:146787838-146787860 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1199362860 X:146943263-146943285 CACTAGGCAGTGCCCCCGTAGGG + Intergenic
1199462681 X:148101423-148101445 CACTAGGCAGTGCCCCCCTGAGG - Intergenic
1199560644 X:149159385-149159407 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1199580807 X:149358150-149358172 CACTAGGCAATGCCCCAATGGGG - Intergenic
1199909678 X:152272085-152272107 CACTAGGCAGTGCCCCAGTGGGG - Intronic
1199931807 X:152530793-152530815 CACTAGGCAGTGCCCCAATGGGG + Intergenic
1200255499 X:154580369-154580391 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1200262270 X:154624035-154624057 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1200269001 X:154663333-154663355 CACTTGGAAGAGACCCAAGGGGG - Intergenic
1200346249 X:155452217-155452239 CACTAGGCAGTGCCCCAGTGGGG - Intergenic
1200435531 Y:3145899-3145921 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1200459713 Y:3440552-3440574 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1200472085 Y:3596714-3596736 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1200531602 Y:4347060-4347082 CACTAGGCAGTGCCCCAGTGGGG + Intergenic
1200637581 Y:5675947-5675969 CACTAGGCAGTGCCCCAAAGGGG + Intronic
1201548958 Y:15198543-15198565 CACTATGAAATGCTTCCAGGGGG - Intergenic
1202097889 Y:21272729-21272751 CACTAGGCAGTGCCCCTGTGGGG + Intergenic