ID: 1145977427

View in Genome Browser
Species Human (GRCh38)
Location 17:28992546-28992568
Sequence GAAATATATCCCTTCTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145977427_1145977436 26 Left 1145977427 17:28992546-28992568 CCCCAAAAGAAGGGATATATTTC 0: 1
1: 0
2: 3
3: 31
4: 299
Right 1145977436 17:28992595-28992617 TTTCACTCTGCCCTCTCCTTGGG 0: 1
1: 0
2: 4
3: 41
4: 380
1145977427_1145977435 25 Left 1145977427 17:28992546-28992568 CCCCAAAAGAAGGGATATATTTC 0: 1
1: 0
2: 3
3: 31
4: 299
Right 1145977435 17:28992594-28992616 TTTTCACTCTGCCCTCTCCTTGG 0: 1
1: 0
2: 0
3: 51
4: 397
1145977427_1145977437 27 Left 1145977427 17:28992546-28992568 CCCCAAAAGAAGGGATATATTTC 0: 1
1: 0
2: 3
3: 31
4: 299
Right 1145977437 17:28992596-28992618 TTCACTCTGCCCTCTCCTTGGGG 0: 1
1: 0
2: 3
3: 38
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145977427 Original CRISPR GAAATATATCCCTTCTTTTG GGG (reversed) Intronic