ID: 1145977427

View in Genome Browser
Species Human (GRCh38)
Location 17:28992546-28992568
Sequence GAAATATATCCCTTCTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145977427_1145977435 25 Left 1145977427 17:28992546-28992568 CCCCAAAAGAAGGGATATATTTC 0: 1
1: 0
2: 3
3: 31
4: 299
Right 1145977435 17:28992594-28992616 TTTTCACTCTGCCCTCTCCTTGG 0: 1
1: 0
2: 0
3: 51
4: 397
1145977427_1145977437 27 Left 1145977427 17:28992546-28992568 CCCCAAAAGAAGGGATATATTTC 0: 1
1: 0
2: 3
3: 31
4: 299
Right 1145977437 17:28992596-28992618 TTCACTCTGCCCTCTCCTTGGGG 0: 1
1: 0
2: 3
3: 38
4: 371
1145977427_1145977436 26 Left 1145977427 17:28992546-28992568 CCCCAAAAGAAGGGATATATTTC 0: 1
1: 0
2: 3
3: 31
4: 299
Right 1145977436 17:28992595-28992617 TTTCACTCTGCCCTCTCCTTGGG 0: 1
1: 0
2: 4
3: 41
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145977427 Original CRISPR GAAATATATCCCTTCTTTTG GGG (reversed) Intronic
903039404 1:20517185-20517207 GTAGTATTTCCCTCCTTTTGGGG + Intergenic
905609181 1:39334233-39334255 GAAATATTTTCCTTCGTTTCAGG - Intronic
906228863 1:44143334-44143356 CAATTATCTCCCTTCTTTTAAGG - Intergenic
906783833 1:48596836-48596858 TTATTATATCCCTTTTTTTGTGG - Intronic
908950497 1:69556943-69556965 CAAACATTTCCCTTCTTTTTTGG - Intergenic
909461196 1:75916515-75916537 GAAAGATATCATGTCTTTTGAGG + Intergenic
911565873 1:99462704-99462726 GAAATATATACTTTCTTTTTGGG - Intergenic
911992193 1:104713739-104713761 TAAATTTATTCCTTCTCTTGAGG - Intergenic
912326761 1:108770927-108770949 GAAATATGTCTCTTATTTTAAGG + Intronic
912961505 1:114199713-114199735 GAAATGTCTCCATTCATTTGAGG - Intergenic
913241304 1:116832342-116832364 AAAATGTATCTCTTTTTTTGTGG - Intergenic
917365799 1:174231052-174231074 GAAATATTTCATTTCTTTTTGGG + Intronic
917983276 1:180288097-180288119 GAAATTTATCACTGCTTTAGAGG - Intronic
918033413 1:180840370-180840392 GATATATTTCCCTTCATCTGAGG + Intronic
919644762 1:200084141-200084163 GACAAAAATCCCTGCTTTTGAGG + Intronic
920355388 1:205368374-205368396 GAAATTTATACCTTTCTTTGAGG - Intergenic
920662985 1:207933883-207933905 GAAATAACTCCATTCTTTGGTGG + Intergenic
920909780 1:210205655-210205677 GAAACAGATCCATTCTTATGTGG - Intergenic
921557656 1:216618224-216618246 ATAATATATCTGTTCTTTTGAGG - Intronic
921810066 1:219502448-219502470 CAAATAAGTCCCTTATTTTGGGG - Intergenic
921853530 1:219955735-219955757 GTAATGTATCACTTCTTTTGTGG - Intronic
923234238 1:232017038-232017060 GAAATATATTCTTTGTGTTGTGG + Intronic
923392542 1:233528302-233528324 GCAATATATCCTTTTTTTTAAGG - Intergenic
923490546 1:234479689-234479711 GCAATAAATCTCTGCTTTTGTGG - Intergenic
924163467 1:241258174-241258196 GAAAGATTTCCCTTCTCTTATGG + Intronic
924419254 1:243892101-243892123 TAAATATATAGCTTCTTCTGGGG - Intergenic
1065169498 10:23012317-23012339 TAGATAAATCCCTTCTTTTTTGG + Intronic
1065228912 10:23576802-23576824 GAAATTTATCCATTCTCTTTAGG + Intergenic
1071051785 10:81459383-81459405 GAAAGATATCCCACCTTTTTAGG + Intergenic
1071203000 10:83241633-83241655 GAACTATATCCCCACTTATGGGG + Intergenic
1071357204 10:84810156-84810178 GAAGTATTTCCCTCCTTTTGAGG - Intergenic
1071392252 10:85187793-85187815 GAAGTATTTCCCTCCTTTTGGGG - Intergenic
1071737727 10:88320035-88320057 GTAATTTATCCCTTTTTTTCAGG - Intronic
1075633010 10:124012487-124012509 GAAATAATGCCCTTCTTCTGTGG - Intronic
1075743120 10:124707749-124707771 GAAATGTATGCCTTTTTTTGGGG - Intronic
1076244415 10:128935024-128935046 GAAATGTTTCCATTATTTTGGGG - Intergenic
1077789377 11:5422220-5422242 GAAGTAGATGCCTTCTTGTGTGG - Exonic
1077809067 11:5619470-5619492 GAAAAAGATCCTTTCTTTTCTGG - Intronic
1078261389 11:9712712-9712734 GAAGAAGATACCTTCTTTTGGGG - Intronic
1079496630 11:21051859-21051881 GAGAAAAATCCCTGCTTTTGTGG + Intronic
1080685229 11:34509751-34509773 CAAATATATCCCTTTTCTTCTGG + Intronic
1081078500 11:38708182-38708204 GAAATATATCAGTTATTCTGGGG - Intergenic
1082748055 11:56988855-56988877 CAAAGATTTCCCTTCTTTTCTGG + Exonic
1085959022 11:81437104-81437126 GTAATAAATCCCTTTTCTTGGGG + Intergenic
1085959034 11:81437218-81437240 GTAATAAATCCCTTTTCTTGGGG + Intergenic
1086048545 11:82561660-82561682 GAAATTTATCACTCATTTTGGGG + Intergenic
1087129537 11:94656364-94656386 GAAAAAAGTCCCTTCTATTGGGG - Intergenic
1087229198 11:95640747-95640769 GAAATCTATTACTTCTTTTTAGG + Intergenic
1087883170 11:103443916-103443938 GAAATATTTCCCATTTTGTGAGG - Intronic
1087938822 11:104068336-104068358 GAAATACATTCCCTCATTTGGGG - Intronic
1088356298 11:108947464-108947486 TAAATATCTCCATTGTTTTGGGG + Intergenic
1088984056 11:114890018-114890040 TAAAAACATCCCTTCTTTAGTGG - Intergenic
1090602880 11:128390904-128390926 GAAATACATCCCTTCTGTGAAGG + Intergenic
1093342063 12:17989461-17989483 GAAAAATACTCATTCTTTTGTGG + Intergenic
1094595111 12:31858433-31858455 GAAATACATCCCTTCCCTAGTGG - Intergenic
1098655824 12:73028149-73028171 GAATTGTATCCCTAATTTTGGGG + Intergenic
1099688129 12:85915514-85915536 GGAATATATCCATCTTTTTGTGG + Intergenic
1099925770 12:89014806-89014828 AAAAGAAATCCCTTCTTTTGTGG - Intergenic
1101092141 12:101298200-101298222 GAAAAAAGTTCCTTCTTTTGGGG + Intronic
1104139100 12:125969585-125969607 TTAATATATTCCTTTTTTTGTGG - Intergenic
1105320166 13:19312066-19312088 GAAATTTTTACCTTTTTTTGTGG + Intergenic
1105560056 13:21481829-21481851 GAAAAAAATCCCTGCTTTTATGG + Intergenic
1106270715 13:28150843-28150865 AAGAAAAATCCCTTCTTTTGTGG + Intronic
1106576174 13:30977813-30977835 GAAATACATTCCATCTTTAGTGG - Intergenic
1106906663 13:34416421-34416443 GTAATAAATCCCTTCATTTGGGG - Intergenic
1107428145 13:40314924-40314946 GAAATAAATCCCTGCTCTTAAGG - Intergenic
1108843114 13:54645678-54645700 AACATATTTCCTTTCTTTTGTGG + Intergenic
1109167071 13:59048928-59048950 AAAAAAAAACCCTTCTTTTGAGG + Intergenic
1109498234 13:63203773-63203795 GAAATATATCCCATGTTTATGGG + Intergenic
1109584225 13:64376683-64376705 AAAATATCTCCCTACATTTGAGG - Intergenic
1109714745 13:66206664-66206686 GAAATATATCCTTTCTTTTATGG - Intergenic
1109847749 13:68019016-68019038 TAAATATATACCTTTTTTTTTGG + Intergenic
1112089117 13:96063941-96063963 TAATTATATCTCTTCTTTTGGGG + Intergenic
1113155924 13:107321867-107321889 GAAATATATACCGTTTTTTTAGG - Intronic
1113846810 13:113396492-113396514 GAAAAATAGCCCCACTTTTGGGG + Intergenic
1114706851 14:24736423-24736445 GAAAGAAATCCTTTCATTTGAGG - Intergenic
1114845700 14:26318754-26318776 GTAATATATTTCTTCCTTTGGGG - Intergenic
1115127899 14:30018295-30018317 GAGAGATGTCCCTTCTTCTGAGG - Intronic
1115229095 14:31138905-31138927 GAACTTTATCACTTTTTTTGTGG - Intronic
1115762849 14:36592558-36592580 GAAACATGTCCCTTCTAATGAGG - Intergenic
1116036400 14:39632374-39632396 GACATACATTCCTTGTTTTGTGG - Intergenic
1116818567 14:49605691-49605713 GAAATAAAGCCTTTATTTTGGGG - Intronic
1117235842 14:53773851-53773873 TAAATATATTCCTTATTTTTGGG + Intergenic
1119814913 14:77557203-77557225 GAAATATATCTCTGCATTTCCGG - Intronic
1122579848 14:102764678-102764700 GACACACATCCCCTCTTTTGGGG - Intergenic
1122908960 14:104816925-104816947 GAAAAATATCCCTACTCTAGAGG + Intergenic
1124429149 15:29591366-29591388 GAAATAAGTCACTCCTTTTGGGG - Intergenic
1125119787 15:36141605-36141627 GAAATATACCCATACTTATGTGG - Intergenic
1125163852 15:36679612-36679634 GACATATTTTTCTTCTTTTGAGG + Intronic
1126017959 15:44371214-44371236 CATATATATCCCTTCTTTTAAGG + Intronic
1127114820 15:55715593-55715615 GACATTTATCTCTTCTTTTAAGG - Intronic
1127306882 15:57715084-57715106 GACATAGTTCCCTTCTTTTTTGG + Exonic
1127553312 15:60062513-60062535 GAAAAATATTCTTTCTTTTGGGG - Intergenic
1129686757 15:77690634-77690656 GAAAGATATCCCTTTTGTTCTGG + Intronic
1130837526 15:87665175-87665197 GAAGTATTTCCCTCCTTTTGGGG + Intergenic
1131914582 15:97251031-97251053 GTAATATTTCCCTCCTTTTGGGG - Intergenic
1134541552 16:15071027-15071049 GAAATATCTCCCATTTTTTTTGG - Intronic
1135472274 16:22742011-22742033 GAAGTATATCCATACTATTGAGG + Intergenic
1137925619 16:52538604-52538626 GATATATACTCATTCTTTTGGGG - Intronic
1143225816 17:5301978-5302000 GAAATATCTCCTTTCTTCAGAGG - Intronic
1143852868 17:9825829-9825851 GAAAAATCTCCCTGCTTTTGGGG + Exonic
1145819175 17:27818141-27818163 GACAAAAATCCCTGCTTTTGTGG - Intronic
1145977427 17:28992546-28992568 GAAATATATCCCTTCTTTTGGGG - Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1148468389 17:47878341-47878363 GAAATTTAACCCTTCATTGGAGG - Intergenic
1149822160 17:59790314-59790336 AAAATATATCCCTACTTTTGAGG - Intronic
1150051389 17:61967776-61967798 GATATATATCCCTTTTAATGTGG - Intronic
1153147906 18:2054904-2054926 GAGAAAGATCCCATCTTTTGGGG - Intergenic
1153251529 18:3127152-3127174 GAAAAATATTTCTTCTTATGGGG - Intronic
1155540136 18:26861448-26861470 TAAATTTATTCCTTCTTTTTGGG - Intronic
1155694104 18:28663216-28663238 GAAATATATTCTATCTTTTATGG + Intergenic
1156035492 18:32762205-32762227 AAAATATTTTCTTTCTTTTGAGG + Intronic
1156284454 18:35677170-35677192 TAAATATTTCTCTTCTTTTGTGG + Intronic
1158502070 18:58011339-58011361 GAGAAAAATCCCTTCTTTTGGGG - Intergenic
1158512127 18:58099997-58100019 GTATTTTATCCCTTCTTTTCTGG - Intronic
1159332226 18:67011293-67011315 AAAATATATACCCTATTTTGTGG - Intergenic
1159346542 18:67214047-67214069 GAAATATTTCCATTCTCATGTGG - Intergenic
1160002287 18:75036876-75036898 GAAGTATTTCCACTCTTTTGGGG + Intronic
1160753282 19:745346-745368 GAAATGAATCCCTACTTTTCAGG + Intronic
1164470321 19:28524747-28524769 GAAATATTTCCCTCCTTTTGGGG + Intergenic
1166334064 19:42095011-42095033 GACATATATCCCTTCCTGTGTGG + Intronic
1167795438 19:51705161-51705183 GAAATATATTCTTTATTTTCAGG - Intergenic
1202679251 1_KI270711v1_random:36839-36861 TAAATATATCTCTTATATTGTGG + Intergenic
925591640 2:5515790-5515812 GAATTAGATCCCTTCTCTTTTGG - Intergenic
925786208 2:7433429-7433451 AAAATTTATCTCTTTTTTTGTGG + Intergenic
926470865 2:13256060-13256082 GAGACATATTCTTTCTTTTGTGG + Intergenic
927577504 2:24211693-24211715 TAAATATATCTCTTCTGTTTAGG - Intronic
929372420 2:41242074-41242096 GAAATATCTCCATTCCCTTGTGG - Intergenic
930290588 2:49488405-49488427 GGAATATATTTCTTCTTCTGAGG + Intergenic
930390499 2:50755524-50755546 AAAATCTATCCTGTCTTTTGTGG - Intronic
930901465 2:56511903-56511925 GAAATCTATCTTTTCTTTTGAGG + Intergenic
930907174 2:56585308-56585330 TAAATATATGGCTTCTTTTTGGG - Intergenic
932918058 2:75878224-75878246 AAAATATTTTCCTTCTTTGGTGG - Intergenic
933412147 2:81940157-81940179 GAAATATAACCTTTATTTTCTGG + Intergenic
936766803 2:115860064-115860086 GAAATATATTCTTACATTTGTGG - Intergenic
937348030 2:121139670-121139692 GAAAGATATCCTTTCTGTGGAGG - Intergenic
937915802 2:127098188-127098210 GAAATATGGTCCTTGTTTTGTGG - Intronic
939465836 2:142555331-142555353 TAATTATATACATTCTTTTGGGG + Intergenic
939656599 2:144834059-144834081 GAAATATATCTTTGATTTTGAGG + Intergenic
941888090 2:170550300-170550322 TAAAAAGATCCCTTCATTTGAGG - Intronic
942531780 2:176917967-176917989 AAAATGTATACCTTCTTTTACGG - Intergenic
942631348 2:177952986-177953008 GAAATATTTTCCTGCTTTTCAGG - Intronic
942944755 2:181659992-181660014 AAAATATATCTCCTCTTTTCTGG + Intronic
942988122 2:182165967-182165989 GAACTTTATCCTTTCTTCTGAGG + Intronic
945148660 2:206765042-206765064 GAAACATATCCCTGCCTTAGAGG - Intronic
945490156 2:210445472-210445494 GAAGCATATCCCTTTTTTTCTGG + Intronic
945498176 2:210535184-210535206 GAAACATACCCCAGCTTTTGTGG + Intronic
946608345 2:221430813-221430835 TAAAAAAATTCCTTCTTTTGGGG + Intronic
1170045793 20:12084233-12084255 CTAATGTCTCCCTTCTTTTGGGG - Intergenic
1170549850 20:17467690-17467712 GAAAAAAATCTCTTATTTTGGGG - Intronic
1170669552 20:18418626-18418648 GATATATATGCTTGCTTTTGGGG + Intronic
1171281538 20:23903532-23903554 GAATTAAATCCTCTCTTTTGTGG + Intergenic
1173138141 20:40458346-40458368 TAAATATACCCCTCCTTTGGTGG - Intergenic
1173805282 20:45920822-45920844 GGAAAAAATCCCTTCCTTTGGGG - Intergenic
1177296440 21:19182380-19182402 GAAAAATATTGATTCTTTTGAGG + Intergenic
1177468903 21:21528913-21528935 GAAGTATATAACTTCTTTTCTGG - Intronic
1178177293 21:30117600-30117622 TAAAGAAATCTCTTCTTTTGGGG - Intergenic
1178827391 21:36028311-36028333 TAAATATATGCCTTTATTTGTGG + Intergenic
1179121607 21:38551089-38551111 TAAATTTATCCCTTTTTTTCTGG + Intronic
1179350609 21:40607423-40607445 GAAATAAATTCCATCTTTTCAGG + Intronic
1184609940 22:45596999-45597021 GAAATAGATCTCTTTTTTTTTGG + Intronic
1184811754 22:46839781-46839803 GAAATAAATCCATGCATTTGTGG + Intronic
949201405 3:1384024-1384046 GAAAGATTTCCCTTACTTTGAGG - Intronic
949766311 3:7530728-7530750 CACATAAATGCCTTCTTTTGAGG + Intronic
951296802 3:20946950-20946972 GAAAAATATCATATCTTTTGTGG - Intergenic
952930630 3:38358141-38358163 GAAAAATTTTCCTTCTTTTCAGG + Intronic
953009506 3:39011262-39011284 TAAATATATCCCACCTTTTTAGG - Intergenic
953613098 3:44464184-44464206 GTAGTATTTCCCTTATTTTGGGG + Intronic
954933647 3:54306826-54306848 TAAATATCTTCCTTCTCTTGAGG - Intronic
956871632 3:73424173-73424195 CAAATATATCCCTTTTCTTTTGG - Intronic
957530478 3:81434553-81434575 GAAATAAATCCATGCATTTGTGG + Intergenic
958708404 3:97686916-97686938 AAAATATCTCCCATATTTTGTGG + Intronic
960111100 3:113845726-113845748 AAAATAAATCTCATCTTTTGAGG + Intronic
960540175 3:118853289-118853311 GAAATATATTCTTCCTTTTTGGG + Intergenic
960676108 3:120196307-120196329 CACATATTCCCCTTCTTTTGTGG - Intronic
961231586 3:125317148-125317170 CAAATATATGCCTTAATTTGGGG - Intronic
963078728 3:141371696-141371718 CATATATATCACATCTTTTGGGG - Intronic
964027076 3:152087422-152087444 GACATATTTTCCTTCTTTTGGGG + Intergenic
964561284 3:157999265-157999287 GAGAGATGTCCATTCTTTTGAGG - Intergenic
965099873 3:164282272-164282294 GAAATGTATCCATTTCTTTGAGG - Intergenic
965254982 3:166395248-166395270 CACATAAATGCCTTCTTTTGAGG + Intergenic
965354847 3:167661305-167661327 TATATATATCTCTTCCTTTGGGG - Intergenic
967434327 3:189426999-189427021 CAGATATTTCTCTTCTTTTGTGG - Intergenic
967475931 3:189918241-189918263 GAAATACAGCCTTTCTTTTCTGG - Intergenic
970324907 4:14913503-14913525 GGCATATAACCCTGCTTTTGAGG - Intergenic
970352433 4:15216455-15216477 GAATTATATCACTGGTTTTGTGG - Intergenic
971650356 4:29263534-29263556 GAAATATCTTACTTATTTTGGGG - Intergenic
971826793 4:31633705-31633727 GATATATGCCCCTTCTCTTGCGG + Intergenic
972401094 4:38704584-38704606 GCAAGATATCCCATCTTTTTAGG - Intergenic
974395309 4:61326710-61326732 TTAAAATTTCCCTTCTTTTGGGG + Intronic
974904665 4:68040055-68040077 GACATAGTTCCCTTCTTTTTTGG + Intergenic
976239495 4:82939736-82939758 GATATATGTCCCTTCTTTTTAGG - Exonic
976255555 4:83096994-83097016 GTAGTATTTCCCTCCTTTTGGGG + Intronic
976643648 4:87364702-87364724 GTAGTATTTCCCTCCTTTTGGGG + Intronic
977604227 4:98965797-98965819 TAAATATATCCTTTCTCTTTGGG - Intergenic
977752852 4:100630702-100630724 GAAATTTATTCCTTTTTCTGGGG - Intronic
978617650 4:110612435-110612457 AAAATAGAACCCTTCTTCTGTGG - Intergenic
979216142 4:118166299-118166321 GAAATATATCCATTTTTTCTAGG - Intronic
979321937 4:119335133-119335155 AAAATGTAACCCTTTTTTTGTGG + Intergenic
979544568 4:121925282-121925304 AAAAGGTATCCCTTCTTTTGGGG + Intronic
979808285 4:125002540-125002562 GAAATATTTTCCACCTTTTGCGG + Intergenic
979818149 4:125135919-125135941 GAAGTATATCATTTGTTTTGAGG - Intergenic
980345460 4:131611018-131611040 GAAAAATCTCCATTCATTTGTGG + Intergenic
980517376 4:133880137-133880159 GAAAAAGATTCCTACTTTTGTGG - Intergenic
980573846 4:134659951-134659973 AAAATGTTTCCCTTCTTTTCAGG + Intergenic
980856712 4:138449719-138449741 GAGAAAAATCCCTTCCTTTGTGG + Intergenic
980998906 4:139809265-139809287 AAAATGTTTCCCTTCTCTTGTGG - Intronic
981669450 4:147270664-147270686 GAAATTTATCCATTCTTTCTAGG + Intergenic
981867979 4:149449711-149449733 GAAATATCTTCCTTTTTTGGTGG - Intergenic
982515769 4:156347407-156347429 CAAAAATATCCATTGTTTTGGGG + Intergenic
983057585 4:163116800-163116822 AAAATATATCCCTTTTTTCAGGG + Intronic
983848764 4:172553296-172553318 GAAATAAAGCCTTTCTTTTCTGG + Intronic
983910742 4:173235967-173235989 CAAATACATCCCTGCTTTTGTGG - Intronic
984367676 4:178819995-178820017 GCCACAAATCCCTTCTTTTGTGG - Intergenic
984665048 4:182418159-182418181 GAAATGTTTCCCTACTTTTTTGG - Intronic
986342080 5:6798588-6798610 GAAATATTTCCCAACTTTTATGG - Intergenic
987288074 5:16479613-16479635 GTTATATATGACTTCTTTTGGGG + Intronic
987476385 5:18396997-18397019 AAAATATATACATTCATTTGTGG + Intergenic
987935591 5:24460431-24460453 CAATTATACTCCTTCTTTTGTGG - Intergenic
988190508 5:27926268-27926290 GGAATACATCCCTTTTTGTGAGG - Intergenic
989248003 5:39275678-39275700 GAAATAGATCCCTTTTGATGTGG - Intergenic
990272290 5:54156708-54156730 AAAACATACCCCTTCCTTTGTGG + Intronic
990427618 5:55702987-55703009 GAAATAAAGCCCTTCTTGTTTGG - Intronic
990572331 5:57091987-57092009 TAAGTATATTCCTTATTTTGGGG + Intergenic
991162794 5:63524671-63524693 GGAACATATGTCTTCTTTTGAGG + Intergenic
991514435 5:67418390-67418412 GGAAAATATCCTTTCTGTTGAGG - Intergenic
993346476 5:86789425-86789447 AAAATTTTTTCCTTCTTTTGAGG - Intergenic
993422402 5:87718791-87718813 GTAGTATTTCCCTCCTTTTGTGG - Intergenic
994498131 5:100538967-100538989 GAAATAATTCCCTGCTTTTAAGG - Intronic
995836741 5:116406978-116407000 GAAATATATCTCATCCTTTGGGG + Intronic
995966659 5:117915592-117915614 GAAATATATCCAAGCTCTTGAGG + Intergenic
996686777 5:126291415-126291437 GAAAAATGTCCCTTCTTTAATGG + Intergenic
999673402 5:153976615-153976637 GAAATGTCTCCCTCCTTCTGTGG - Intergenic
999748738 5:154610753-154610775 GAAATAAATCCCTTCTGTGAGGG + Intergenic
1000224559 5:159247763-159247785 CATATACATGCCTTCTTTTGAGG + Intergenic
1004070021 6:12289334-12289356 AAAATATGTCCCTGCTTGTGCGG + Intergenic
1004082371 6:12407312-12407334 TAAAGATATCCTTTCTCTTGGGG - Intergenic
1007135004 6:39512347-39512369 GAAATACCTCCCTTCTTTAGGGG - Intronic
1008043259 6:46825170-46825192 GAACTATTTCCCTTTTTTGGAGG + Intronic
1008494530 6:52119371-52119393 TGAATATATGCTTTCTTTTGTGG + Intergenic
1010576415 6:77537320-77537342 GAAATATTTCCATAATTTTGGGG + Intergenic
1010584118 6:77636691-77636713 CAAATATTGCCCTTATTTTGTGG - Intergenic
1011308968 6:85960183-85960205 GAAATATAACCCTTGCTTTCTGG + Intergenic
1011589985 6:88962993-88963015 GATATTCATCCCTTCTTTCGAGG + Intronic
1012095741 6:94957037-94957059 GAACGATATCACTTTTTTTGTGG + Intergenic
1012559690 6:100565274-100565296 GAAAAATGTTCTTTCTTTTGGGG - Intronic
1013263035 6:108465542-108465564 GAAATATATCCATGCTTGTGAGG - Intronic
1013362670 6:109409181-109409203 GAACTATACCCAGTCTTTTGAGG - Intronic
1014200596 6:118605207-118605229 GTAGTATTTCCCTCCTTTTGGGG - Intronic
1015263407 6:131264081-131264103 TAATTATATCCAGTCTTTTGGGG + Intronic
1015391214 6:132684106-132684128 AAAATATATATCTTATTTTGGGG - Intronic
1016702814 6:147072543-147072565 TAAATAAGTCACTTCTTTTGAGG - Intergenic
1016742036 6:147539170-147539192 GAGTTATTTCCCTCCTTTTGGGG - Intronic
1016796163 6:148119825-148119847 GAAAAATATCCCTTATTGTCTGG + Intergenic
1016975955 6:149807947-149807969 AGAATATATCCCTGCTTTTAAGG - Intronic
1020368556 7:7407444-7407466 GTAATTTATCCTTTCTTTGGTGG - Intronic
1020919763 7:14248156-14248178 GAAATAAATCCACTCATTTGTGG - Intronic
1021219514 7:17960278-17960300 GAAAGACATCCCTTCTCTTTGGG + Intergenic
1021264235 7:18499487-18499509 CAAGTACATCCCTACTTTTGTGG + Intronic
1021619255 7:22535117-22535139 TAAATGTATCCATTCTTCTGTGG - Intronic
1023783474 7:43681484-43681506 GAAATGGTTCCCTTCTTTTACGG + Intronic
1024412034 7:49054776-49054798 GATTTATATACCTTCTCTTGTGG - Intergenic
1024525554 7:50345979-50346001 GAAATCCATCACTGCTTTTGTGG + Intronic
1024539999 7:50468404-50468426 GAGATAAATCCCTTATTTTTTGG + Intronic
1027829417 7:83159029-83159051 GAAATATATCCTTTCTCTCTAGG - Intronic
1027943361 7:84713262-84713284 GAAAAATAGCCCTACTTTTTTGG - Intergenic
1027958656 7:84915983-84916005 GAGATATATCACTTCATTTTAGG + Intergenic
1028320460 7:89453106-89453128 CAAATATGTCACTTCTTTAGTGG - Intergenic
1028372005 7:90102473-90102495 TAAATGTATCCATTCTTCTGTGG + Intergenic
1029064130 7:97831255-97831277 GAGATACATCCCATCTTCTGAGG - Intergenic
1029433621 7:100548648-100548670 CAAATATTTCCCTTCTTTCCTGG + Intronic
1030351533 7:108493735-108493757 GAAATGTATCACTTATTTTGTGG - Intronic
1030570515 7:111216513-111216535 CAAATATTTCCATTGTTTTGTGG + Intronic
1030783790 7:113635041-113635063 GAAGAAAATCCTTTCTTTTGAGG - Intergenic
1031029003 7:116714278-116714300 TAAATAAATCCTTTCTCTTGAGG - Intronic
1031665673 7:124480106-124480128 GAAAAATATCCTTTCTTCAGAGG - Intergenic
1033819953 7:145123331-145123353 TATATATATCCTTTCTATTGAGG + Intergenic
1034031585 7:147772502-147772524 GAAAAAAATCACCTCTTTTGTGG - Intronic
1034540061 7:151752229-151752251 GAAAGAGATCACGTCTTTTGAGG + Intronic
1037365128 8:18114075-18114097 GAAATATATCCATGCATTTACGG - Intergenic
1037677299 8:21062318-21062340 GGAATATATACCTTCCTTCGTGG - Intergenic
1038361393 8:26882768-26882790 AAAATATATTTTTTCTTTTGTGG + Intergenic
1039937953 8:42063994-42064016 GAAAGATACACCTTGTTTTGTGG + Intergenic
1040350962 8:46567457-46567479 GAGATACATCCCATCTTCTGAGG - Intergenic
1040366039 8:46717219-46717241 GAGATACATCCCATCTTCTGAGG + Intergenic
1040810656 8:51448948-51448970 AAAATAAGTGCCTTCTTTTGTGG - Intronic
1041212913 8:55570607-55570629 GAAAAATCCCCCTTCTTTTATGG - Intergenic
1042161125 8:65896942-65896964 GAAATATGCCCCTTATTTTGGGG + Intergenic
1042509048 8:69592118-69592140 GAAATTTTACCCATCTTTTGAGG - Intronic
1043706337 8:83355885-83355907 ATAATATTTCCCTCCTTTTGGGG - Intergenic
1043944331 8:86232394-86232416 GGAATAAATCCTTTCTTTTTCGG - Intronic
1043973094 8:86554624-86554646 AAAGTAAATCCCTTCTATTGGGG + Intronic
1044198840 8:89411140-89411162 GAATTAAATCCCATCATTTGTGG + Intergenic
1044589791 8:93903093-93903115 GAACTATATCCATACTTTTCTGG - Intronic
1045206565 8:100048024-100048046 GATATAGAGCCCTTCTTATGTGG - Intronic
1045612607 8:103863689-103863711 GAAATATATCCTAGGTTTTGTGG + Intronic
1045725526 8:105168871-105168893 CAACTATATCTCTTATTTTGGGG + Intronic
1046426920 8:114065644-114065666 GACATAAATTCCTTCCTTTGTGG + Intergenic
1046757731 8:117989107-117989129 GAAATATCTCCCTTTTTCAGAGG + Intronic
1047693838 8:127383762-127383784 GAGAAAAATGCCTTCTTTTGTGG - Intergenic
1048181373 8:132197729-132197751 GAAGTATTTGCCTTCTCTTGTGG + Intronic
1048233860 8:132671397-132671419 GAGATATATCCCTTGTTTTTGGG + Intronic
1050287877 9:4122254-4122276 GGAATATATTTTTTCTTTTGAGG - Intronic
1051760146 9:20454063-20454085 GAAAAACATCTCTTCCTTTGTGG - Intronic
1052847419 9:33349564-33349586 GAAGTATATCCCTCATTTCGAGG + Intronic
1052975231 9:34405346-34405368 CAAATATCTCCCTTCCTTTCTGG - Intronic
1055162856 9:73152615-73152637 AAAGTATTTCCCTTCTTTTTAGG - Intronic
1055325822 9:75128137-75128159 GAAAATTATACCTTGTTTTGTGG + Intronic
1056442783 9:86637254-86637276 GTAATATATGACTTCGTTTGCGG + Intergenic
1056732713 9:89179682-89179704 GGAAAATATGCCTTCTTTTCAGG + Intergenic
1058201154 9:102042630-102042652 TAAATATATCAATTCTTTTATGG + Intergenic
1058630925 9:106985692-106985714 GAAATATAGTCCTTCTTTTCTGG + Intronic
1059896735 9:118874734-118874756 AAAATATTTCCCTCCTCTTGTGG - Intergenic
1060214707 9:121731751-121731773 GCATTAGATCTCTTCTTTTGGGG + Intronic
1186293815 X:8126963-8126985 GAAATCTATCACTGCTTTTTAGG + Intergenic
1188220781 X:27538859-27538881 GAAATATGTCTCTTCTGTGGCGG - Intergenic
1188358221 X:29219564-29219586 GAATTACATCCCTTCTTATCTGG + Intronic
1188611307 X:32101669-32101691 GAAATATATCCCTTGGTTAGAGG + Intronic
1188699570 X:33241743-33241765 TAAATTTATTCCTTTTTTTGTGG + Intronic
1188843268 X:35042207-35042229 GAACTAGATCACGTCTTTTGTGG + Intergenic
1189735864 X:44068906-44068928 GAAATATTTCCCATCTTTGAGGG - Intergenic
1193199285 X:78668836-78668858 GAAAAATATACTTTCTTTTGTGG - Intergenic
1194387044 X:93268127-93268149 GTAATATATCCCTTGTGTCGAGG - Intergenic
1194698704 X:97087848-97087870 GAGATATAGGCCTTCATTTGGGG - Intronic
1195063418 X:101218089-101218111 TATATATATCTTTTCTTTTGAGG - Intergenic
1195458531 X:105097708-105097730 GAAAAATATCCCATTTTTTATGG + Intronic
1195549029 X:106145323-106145345 GAAAAATATTTCTTCCTTTGTGG + Intergenic
1197041875 X:121946957-121946979 GAAATTTACCCCTTCTTTCTAGG - Intergenic
1197104141 X:122693799-122693821 TAAATATATGCATTTTTTTGAGG + Intergenic
1197926594 X:131653245-131653267 TTATTATATGCCTTCTTTTGAGG + Intergenic
1198176565 X:134161928-134161950 GAAATAGATCCCTGCTTTGGTGG + Intergenic
1198814848 X:140578458-140578480 TAAAAATATCCCTTGTTTTTTGG - Intergenic
1200676899 Y:6159348-6159370 GTAATATATTCTTTCTTTTTTGG + Intergenic
1201751701 Y:17439034-17439056 TAAATATATTCCATCTTTTTGGG - Intergenic