ID: 1145977974

View in Genome Browser
Species Human (GRCh38)
Location 17:28995328-28995350
Sequence CTGTGTGTGTGCATGTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6089
Summary {0: 2, 1: 12, 2: 114, 3: 681, 4: 5280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145977974 Original CRISPR CTGTGTGTGTGCATGTATGT GGG Intronic
Too many off-targets to display for this crispr