ID: 1145978357

View in Genome Browser
Species Human (GRCh38)
Location 17:28997154-28997176
Sequence GCGTGGGAATTGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 381}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145978347_1145978357 11 Left 1145978347 17:28997120-28997142 CCAGTAGGGCAGGACTGGGGCTC 0: 1
1: 0
2: 4
3: 36
4: 253
Right 1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG 0: 1
1: 1
2: 1
3: 27
4: 381
1145978346_1145978357 12 Left 1145978346 17:28997119-28997141 CCCAGTAGGGCAGGACTGGGGCT 0: 1
1: 0
2: 3
3: 40
4: 245
Right 1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG 0: 1
1: 1
2: 1
3: 27
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145978357 Original CRISPR GCGTGGGAATTGAGGGAAGG GGG Intronic
900681722 1:3920268-3920290 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
901421437 1:9154000-9154022 GGCTGGGAGTTGAGGGAGGGAGG - Intergenic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901921480 1:12540571-12540593 GCGTTGGAGTTGGGGGAGGGTGG - Intergenic
902377572 1:16037018-16037040 GTGGGGGCATTGAGGGGAGGGGG - Intergenic
902382748 1:16060277-16060299 GTGGGGGCATTAAGGGAAGGGGG - Intronic
903136731 1:21314257-21314279 GCGTGGGAGTTCTGGGAAGGGGG + Intronic
903689756 1:25164390-25164412 GGGTGGGGAATGAGGGATGGAGG + Intergenic
904825330 1:33270690-33270712 GCGGGGGCACTCAGGGAAGGTGG - Intronic
905417156 1:37811916-37811938 GGTTGGGCATTGAGGGAAGGTGG - Exonic
905434201 1:37945912-37945934 GCAGGGGAACAGAGGGAAGGTGG - Intronic
905935596 1:41821667-41821689 GCCTGGGAACTAAGGGAAGTAGG - Intronic
906057124 1:42926119-42926141 GCTTGTGGATTGAGGGTAGGAGG - Exonic
906471272 1:46132991-46133013 GCGAGGGAAGAGAGGCAAGGTGG + Intronic
907237474 1:53062127-53062149 GGGTGGGGAGTGGGGGAAGGGGG + Intronic
908682815 1:66681800-66681822 GTGTGGGGAGTGAGGGAGGGAGG - Intronic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912518564 1:110230566-110230588 GGGAGGGAAGAGAGGGAAGGAGG - Intronic
912688160 1:111783329-111783351 TGGTGGAAATTCAGGGAAGGAGG - Intronic
912796767 1:112698230-112698252 GGGAGGGAATAGAGGGAGGGTGG + Intronic
913098776 1:115544288-115544310 GCCAGGGAATGGTGGGAAGGAGG + Intergenic
914247529 1:145897164-145897186 TCCTGGGACTTCAGGGAAGGGGG - Intronic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915292882 1:154898095-154898117 GTGTGGGAGTTGTGGGGAGGAGG - Intergenic
916607551 1:166358225-166358247 GCCTGGGAAGTGAGGAAATGGGG + Intergenic
917218939 1:172706798-172706820 GTGTGTGACTTGGGGGAAGGAGG - Intergenic
917598375 1:176552353-176552375 GCGTGGGGAAAGAGGGAAAGGGG - Intronic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
918216312 1:182394465-182394487 GGGTGGCAATTTAGGGAAGAAGG - Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
920013337 1:202886282-202886304 GCGGGGGAAGGGAGGGGAGGGGG + Intronic
920074628 1:203327322-203327344 TCGTGGGGATTGAGGGACGTGGG - Intergenic
920225479 1:204435526-204435548 GGGTGGAAATTTATGGAAGGAGG - Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921495670 1:215838173-215838195 TCATGTGAAATGAGGGAAGGTGG - Intronic
923101602 1:230821885-230821907 GCCTGGCAATTGAAAGAAGGTGG + Intergenic
923608198 1:235464493-235464515 ATGTGGGAAGTGAGGGAGGGAGG - Intronic
924328674 1:242921177-242921199 GGGAGGGAATGGAGGGGAGGAGG + Intergenic
924424668 1:243940385-243940407 GACTGGGAAGGGAGGGAAGGAGG + Intergenic
1062819580 10:524056-524078 GCGTGAGAACTGAGGGCGGGAGG - Intronic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1064048822 10:12042854-12042876 GAGGGGGAGCTGAGGGAAGGCGG - Intronic
1064154673 10:12894207-12894229 GGGAGGGAAAGGAGGGAAGGAGG - Intergenic
1065024472 10:21527130-21527152 GGGTTGGAATCGGGGGAAGGAGG + Intergenic
1065342770 10:24723024-24723046 GCGGGGGAATCGTGGGGAGGTGG - Intronic
1066408533 10:35143310-35143332 GGGTGGGAAGTGAAGAAAGGGGG + Intronic
1067068476 10:43116559-43116581 ATGTTGGAAATGAGGGAAGGGGG - Intronic
1067183245 10:44006078-44006100 GCCTGGCAATGGTGGGAAGGGGG - Intergenic
1067806312 10:49395639-49395661 GCGGGGGACAGGAGGGAAGGCGG + Intronic
1067879182 10:50029047-50029069 GTGTGGGAGTTGTGGGGAGGAGG + Intergenic
1068485253 10:57650005-57650027 GGGTGGGGAGTGGGGGAAGGGGG - Intergenic
1069004092 10:63297984-63298006 GCGTGTGGATGGAGGGAATGTGG - Intronic
1069388931 10:67911803-67911825 GCCTGGGCAATGAGGGAGGGAGG - Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069824466 10:71246584-71246606 GGGAGGGAAGTGAGGGAGGGAGG + Intronic
1069913432 10:71773280-71773302 GAGTGGGAACTGTGGGATGGGGG - Intronic
1071578862 10:86752451-86752473 GCGTGGGAGTTGGGGTAGGGAGG + Intergenic
1072167875 10:92831207-92831229 GGGTGGGAGTAGAGGGAGGGTGG + Intergenic
1073091110 10:100940720-100940742 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1073510334 10:104038792-104038814 GCTGGGGAGTTGAGAGAAGGGGG - Intronic
1073585395 10:104704999-104705021 GGTTGGGAAATGAGGGAAGAGGG - Intronic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1076606485 10:131692870-131692892 GCGTGGGAATTGGGGGCCGTTGG + Intergenic
1077881181 11:6351591-6351613 GGATGGAAATTGAGGGAGGGTGG + Intergenic
1077933223 11:6754983-6755005 GCCTTGGAATTGGGGGTAGGAGG + Intergenic
1078151295 11:8761667-8761689 GCGTGGGAAGGGTGAGAAGGAGG - Intronic
1078440078 11:11357449-11357471 GGGTGGAGATTGATGGAAGGCGG - Intronic
1080756122 11:35200932-35200954 GCATGGAAATGGAGGGAAAGCGG - Intronic
1081211476 11:40340129-40340151 GCTTGGGCAGTGTGGGAAGGGGG - Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081869957 11:46378924-46378946 GCGTGTGAGCTCAGGGAAGGAGG + Intronic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1084273382 11:68040389-68040411 GCCTGGGAAAGGAGAGAAGGAGG - Intronic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084433497 11:69124164-69124186 GCGGGGGCATTGAGGGCAGCTGG + Intergenic
1084932862 11:72570957-72570979 GCATGGGAAATCAGGGGAGGAGG - Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1089147324 11:116338853-116338875 GCCTGTGGGTTGAGGGAAGGGGG + Intergenic
1089396745 11:118141096-118141118 GAATGGGAATGGGGGGAAGGAGG + Intronic
1090640099 11:128722747-128722769 GCCTGGGGAATGAGGGATGGAGG + Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091595580 12:1876686-1876708 GCATGGGAAAGGAGGGAAAGAGG - Intronic
1092968482 12:13668986-13669008 GAGAGGGAATGGAGGGGAGGTGG + Intronic
1093093246 12:14944330-14944352 GGGTGGCATTGGAGGGAAGGGGG - Intronic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097298148 12:57989414-57989436 ATGTGGGGATTGAGGGAAAGAGG + Intergenic
1097349797 12:58536350-58536372 GTGTGGGGATTCAGGGAATGTGG - Intergenic
1100550303 12:95640818-95640840 ACGTGGGAAATGAAGGAAAGGGG - Intergenic
1101345335 12:103880941-103880963 GCAGGGGAGTGGAGGGAAGGGGG - Intergenic
1101925181 12:108965954-108965976 GGGAGGGAATGGAGGGAGGGAGG - Intronic
1102234193 12:111283996-111284018 GCCTGAGAAAGGAGGGAAGGAGG - Intronic
1102650216 12:114436572-114436594 GGGTGGAAATTAAGGGATGGGGG + Intergenic
1102787016 12:115613206-115613228 GTGAGGGAATTGGGGGATGGGGG + Intergenic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104428403 12:128696639-128696661 GGGTGGGACTTGAGGGATTGAGG - Intronic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1105007336 12:132729522-132729544 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105007347 12:132729544-132729566 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105403984 13:20118861-20118883 GCGGGGGAGGCGAGGGAAGGGGG - Intergenic
1105758673 13:23493326-23493348 GCCAGGCAGTTGAGGGAAGGTGG - Intergenic
1105953481 13:25255947-25255969 GAGTGGGAATGGAGGCTAGGAGG - Intronic
1106110950 13:26776506-26776528 GGGTGAGAAATGAGGGCAGGAGG - Intergenic
1108282880 13:48876807-48876829 GCCTGGGAATTGGGGCAGGGAGG - Intergenic
1109447005 13:62454087-62454109 TTGTGGGCATTGAGGGAAAGGGG - Intergenic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1111705880 13:91748938-91748960 GTGTGTGAATAGAGAGAAGGGGG + Intronic
1112369551 13:98782728-98782750 GGGTGGGAATTGGAGGAAGTGGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113508368 13:110832194-110832216 GCTTGGGCAGTGAGGGAGGGAGG - Intergenic
1115157844 14:30360566-30360588 GTGTGGAAATGAAGGGAAGGAGG + Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1117294072 14:54362863-54362885 GCATGGGAATGGACAGAAGGAGG + Intergenic
1118845937 14:69547925-69547947 GCGTTGGATGTGAAGGAAGGCGG - Intergenic
1119382639 14:74239078-74239100 GCATAGGAGTTGAGGGAAGGAGG + Intergenic
1120222582 14:81751223-81751245 GCGTGGGAAATAAGAGAAAGAGG - Intergenic
1120871410 14:89340211-89340233 GCGTGTGTTCTGAGGGAAGGGGG + Intronic
1121556152 14:94839302-94839324 GTCTGGGAAGTCAGGGAAGGTGG + Intergenic
1122050050 14:99051495-99051517 GCCTGGGAAATGAGGGAAATAGG + Intergenic
1122096511 14:99376608-99376630 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1122407521 14:101509140-101509162 CCATGGGAATTGATGGCAGGTGG + Intergenic
1122905255 14:104798652-104798674 GCGAGGGAACTTAGCGAAGGTGG + Intergenic
1124616874 15:31248474-31248496 GCATGGGAATTGGGGGCTGGGGG + Intergenic
1128676828 15:69615856-69615878 GGGTGGGTATTGAGATAAGGGGG + Intergenic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1130302730 15:82692374-82692396 GCGGGGGGATTGCGGGGAGGGGG - Intronic
1131509707 15:93043135-93043157 GCGTGAGAATGGTGTGAAGGCGG - Intronic
1133325176 16:4937571-4937593 TGGTGGCAATTGAGGGAAGGGGG + Intronic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1134288619 16:12884247-12884269 GGGTGGGAAGGGTGGGAAGGGGG + Intergenic
1134597969 16:15511029-15511051 GCTTGAGAAAGGAGGGAAGGAGG - Intronic
1134834939 16:17353346-17353368 GTGGGGGAAGTGAGGGCAGGAGG + Intronic
1135866010 16:26102613-26102635 GCATGGCAATTGTGGGATGGAGG - Intronic
1136186977 16:28594032-28594054 GCATGTGAATCCAGGGAAGGAGG - Intronic
1136189555 16:28607541-28607563 GCATGTGAATCCAGGGAAGGAGG - Intronic
1136597605 16:31262310-31262332 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1139133090 16:64169644-64169666 GAGTGGGAAATGGGGGGAGGAGG - Intergenic
1139409768 16:66750315-66750337 CCATGGGAATTGGGGGATGGAGG + Intronic
1140191708 16:72823091-72823113 GAGTGGGGAGTGAGAGAAGGGGG + Intronic
1140565599 16:76037494-76037516 GAATGAGAATTGAGCGAAGGGGG + Intergenic
1140943861 16:79749198-79749220 GAGTGGGAAGTGAGAGAGGGAGG - Intergenic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141094883 16:81156078-81156100 ACCTGGGAAGGGAGGGAAGGAGG - Intergenic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141830056 16:86505558-86505580 GCTTCGGAAGGGAGGGAAGGAGG - Intergenic
1141884087 16:86879933-86879955 GGGTGGGAGTTGAGGGACAGAGG - Intergenic
1142184616 16:88688594-88688616 GGGTGGGGATTGGGGGAGGGCGG + Intergenic
1142309700 16:89305281-89305303 GCGTGGCGATGGCGGGAAGGAGG - Exonic
1143473336 17:7190014-7190036 GAGTGGGAAATGCGGGAGGGAGG - Exonic
1144278782 17:13703303-13703325 GGGGGGGAAGTGAGGGAGGGGGG + Intergenic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1145851664 17:28104934-28104956 GTGTGGGAGTTTGGGGAAGGTGG - Intronic
1145865523 17:28238799-28238821 GCGAGGTAATTGATGGACGGAGG - Intergenic
1145885884 17:28382147-28382169 GGGTGGGCGTTGGGGGAAGGGGG + Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1146277269 17:31523715-31523737 GCCTAGGAATTGGGGGCAGGTGG + Intronic
1146725891 17:35155427-35155449 GCGGGAGCATCGAGGGAAGGAGG + Exonic
1148391499 17:47276150-47276172 GGGTTGGAAAGGAGGGAAGGAGG - Intronic
1150449984 17:65258600-65258622 GCGAGGGAATGGAAGAAAGGAGG - Intergenic
1150631268 17:66882034-66882056 GCTGGGGAATGGAGGGAGGGAGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1153239491 18:3017462-3017484 GTAGGGCAATTGAGGGAAGGTGG - Intergenic
1154063414 18:11084522-11084544 CCGTGGGAGGTGAGGAAAGGGGG - Intronic
1154343900 18:13526898-13526920 GGGAAGGAAGTGAGGGAAGGAGG - Intronic
1154433176 18:14324008-14324030 GGGTGGGGTTAGAGGGAAGGGGG + Intergenic
1154966903 18:21367459-21367481 GGGTGGGGAGTGAGGGAGGGTGG + Intronic
1155068062 18:22285659-22285681 GAGTGGGAAGTGAGGGGAAGGGG + Intergenic
1155283850 18:24268933-24268955 GGTAGGGAATTGAGGGAATGTGG - Intronic
1157349226 18:46870045-46870067 GAGGAGGAATTGAGTGAAGGGGG - Intronic
1157762887 18:50276997-50277019 GCCTGGAAAGTAAGGGAAGGAGG + Exonic
1157798334 18:50597116-50597138 GAATGGGAATTGACTGAAGGGGG - Intronic
1160888875 19:1366453-1366475 GCGTGGGGATGGAGGGACAGAGG + Intronic
1161134464 19:2611464-2611486 GCGTGGGGCTTGAAGGCAGGTGG + Intronic
1161540002 19:4844805-4844827 GAGAGAGAAGTGAGGGAAGGAGG + Intronic
1162212907 19:9107225-9107247 GCTTTGGAAATGAGGGCAGGTGG - Intergenic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1163291705 19:16383549-16383571 GCGTGGCATATGAGGGATGGAGG + Intronic
1163848485 19:19650617-19650639 GCCTGGGGATTGTGGGCAGGTGG - Intronic
1164658699 19:29942910-29942932 GCGTGGGAATTTGGGGGCGGGGG + Intronic
1165899891 19:39164416-39164438 GCCTGGGAAGTCAGGGAAGGTGG + Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166072578 19:40395601-40395623 CCGTGGAAATTGAGGAAGGGCGG - Exonic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167643192 19:50693228-50693250 GGGAGGGAATTCAGGGAATGTGG - Intronic
1167959115 19:53091546-53091568 GCGGGGGACTTGGGGAAAGGGGG + Intronic
926776781 2:16430987-16431009 GGGTGAGAATTTAGGGAAGTGGG - Intergenic
928965168 2:36968520-36968542 GCCTGGGAGTTGTGGGCAGGAGG + Intronic
930622527 2:53658891-53658913 GGGGGGGGAGTGAGGGAAGGGGG + Intronic
930753924 2:54957453-54957475 GCTGGGGACTTGATGGAAGGGGG + Intronic
931228917 2:60357401-60357423 GGCTTGGAGTTGAGGGAAGGCGG + Intergenic
931355938 2:61537835-61537857 GGCTGGGGAGTGAGGGAAGGGGG + Exonic
931389961 2:61833054-61833076 TGGTGGGGAATGAGGGAAGGTGG + Intronic
931669498 2:64634380-64634402 GGGGGGGAATTGGGGGGAGGAGG + Exonic
932407290 2:71521990-71522012 GCGGAGGAAGGGAGGGAAGGTGG - Intronic
933708473 2:85308478-85308500 GGGGGGGAAGGGAGGGAAGGAGG - Intronic
934027145 2:88010590-88010612 GGGTGAGATATGAGGGAAGGGGG + Intergenic
936118508 2:109721842-109721864 TGGTGGGAATTGGGGCAAGGTGG - Intergenic
936333931 2:111572928-111572950 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
936333943 2:111572961-111572983 GGGAGGGAAGGGAGGGAAGGAGG + Intergenic
937121576 2:119443000-119443022 GCGAGGGAACTGAGGCACGGAGG + Intronic
938254970 2:129850557-129850579 GCTAGGGAATGGAAGGAAGGTGG - Intergenic
939571788 2:143848498-143848520 GAGTGAGAAAAGAGGGAAGGAGG - Intergenic
939992357 2:148887805-148887827 GCGTGGGGAGGGCGGGAAGGGGG - Intronic
942189739 2:173457848-173457870 GAGTGGGAATGGGGGGAGGGCGG - Intergenic
942418042 2:175779223-175779245 GCATAGGATTTGAGGGAAAGAGG + Intergenic
942503050 2:176612140-176612162 GAGTGAGAATTGTGGGAAGTGGG - Intergenic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
942700131 2:178698224-178698246 GCTGGGGATTTGAGGGAATGGGG + Intronic
943662531 2:190574776-190574798 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
944060053 2:195563122-195563144 GCGGGGGAAGTGGGGGGAGGGGG - Intergenic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946302940 2:218835513-218835535 GCAGGTGAATTGAGGGAATGTGG - Intergenic
946326183 2:218985671-218985693 GGGTGGGGATAGAGGGAGGGAGG - Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
948586594 2:239023855-239023877 GCGTGGGGCTTGGGGGAAGAGGG - Intergenic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1170100037 20:12688837-12688859 TAGTGGGGATTGAGGAAAGGTGG - Intergenic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1172460285 20:35112956-35112978 GAGTGGGAAAGGAGGGAGGGAGG + Intergenic
1172581871 20:36054730-36054752 GTGTGGGAAGTGAGAGAATGGGG - Intergenic
1172674718 20:36660306-36660328 GGGTTGGAAGTGAGGGAAGAAGG + Intronic
1172955539 20:38755573-38755595 GCGGGGGATGTGAAGGAAGGTGG - Intronic
1173326157 20:42035595-42035617 GCTTGGGGATTGTGGGATGGGGG - Intergenic
1173438819 20:43057252-43057274 GGGTGGGGAATGAAGGAAGGAGG + Intronic
1173961908 20:47080424-47080446 GGGAGGGAAATGAGGGAGGGGGG + Intronic
1173961917 20:47080448-47080470 GGGAGGGAAATGAGGGAGGGAGG + Intronic
1173961925 20:47080469-47080491 GGGAGGGAAATGAGGGAGGGAGG + Intronic
1174171261 20:48619527-48619549 GCAGGGGATGTGAGGGAAGGAGG + Intergenic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1175100393 20:56575118-56575140 GGACGGGAATTGAGGAAAGGAGG - Intergenic
1178666862 21:34555625-34555647 TGGTGGGAAGTGTGGGAAGGAGG + Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1180156115 21:45978014-45978036 GAGGGGGAAAGGAGGGAAGGGGG + Intergenic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183361331 22:37384741-37384763 GAGTGGGAATTGGGGTCAGGTGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184127990 22:42501054-42501076 GAGTGGAAATTTAGGGCAGGCGG - Intergenic
1184136779 22:42554369-42554391 GAGTGGAAATTTAGGGCAGGCGG - Intronic
1185116004 22:48938627-48938649 GCAGGAGAAGTGAGGGAAGGAGG - Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185256978 22:49839472-49839494 GTGTGGGGAATGAGGGTAGGCGG + Intergenic
952246822 3:31603362-31603384 GCATGGGAATTGAGCAAGGGAGG + Intronic
952450311 3:33425960-33425982 GGGTGGGAAGTGGGGGAGGGCGG + Intronic
953447100 3:42977979-42978001 GGTTGGGAAATGAGGGAAGAGGG - Intronic
954224754 3:49174410-49174432 GCCTGGGGAATGTGGGAAGGGGG + Intronic
954397112 3:50298772-50298794 GTGTGGGAGGTGAGGGGAGGGGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
959317847 3:104831824-104831846 GTTTGGGAATAGAGTGAAGGTGG + Intergenic
959615258 3:108340158-108340180 GGGAGAGAATTGAGGCAAGGAGG + Intronic
959899871 3:111648739-111648761 GAGTGGGTAGTGGGGGAAGGAGG - Intronic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960854643 3:122090739-122090761 GCGTGGGTAGTGAAGGAGGGAGG + Intronic
961145012 3:124586210-124586232 GGCTGGGAATTGAGGGAAAGGGG + Intronic
961543507 3:127616812-127616834 GAGTGGGAAGTGAGAGGAGGAGG - Intronic
961615344 3:128175114-128175136 GCGTGGGAAGAGAAGGGAGGAGG - Intronic
961827933 3:129608280-129608302 GCGAGGGTGTTGAGGGAAGTGGG - Intergenic
961861431 3:129919395-129919417 GGGAGGGAAAGGAGGGAAGGAGG + Intergenic
962342713 3:134598620-134598642 TCGTGGGAAAGGAGAGAAGGTGG + Intronic
962613554 3:137102285-137102307 TTGTGGGAGATGAGGGAAGGAGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
966638973 3:182168266-182168288 GCATGGGAAAAGGGGGAAGGAGG - Intergenic
967092424 3:186146480-186146502 GAGCGGGAGTTGGGGGAAGGAGG - Intronic
967267250 3:187701649-187701671 GAGTTGGAACTGAAGGAAGGAGG - Intronic
967294821 3:187954641-187954663 GCTTGGGAAATGGGGGAAAGGGG + Intergenic
967849535 3:194071397-194071419 GCGTGGGGAAGGCGGGAAGGCGG - Intergenic
969706368 4:8794324-8794346 GGGTGGGAATGGAGGGACAGAGG + Intergenic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
973173477 4:47174855-47174877 GGGAGGGAAGGGAGGGAAGGAGG - Intronic
973646448 4:52955527-52955549 GCGTGGGAACTGAGGCACAGAGG + Intronic
975029661 4:69599765-69599787 GCCTGGGAAAGGAAGGAAGGAGG + Intronic
975366401 4:73534205-73534227 GAGTGGGAACTGTGGGCAGGAGG + Intergenic
975599363 4:76083233-76083255 GAGTGGAAATTGAGGAAAGGTGG - Intronic
978243804 4:106548836-106548858 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
980825833 4:138071411-138071433 GCGTGTGGGTTGGGGGAAGGGGG + Intergenic
981837169 4:149067466-149067488 GGGGGGGAATAGAGGGAGGGAGG + Intergenic
983327477 4:166275171-166275193 CTGTTGGAATTGAGGGAATGAGG + Intergenic
984150382 4:176122881-176122903 GTGTGTGTATTGAGGGTAGGAGG + Intronic
985338539 4:188922213-188922235 TGGTGGGAATTGAGGCAAGGAGG - Intergenic
985485509 5:146268-146290 GTGTGGGAAAGGAGGGAGGGGGG - Intronic
986212821 5:5690188-5690210 GTGAGGGAAGTGAGGGAAGCAGG - Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
988174459 5:27703474-27703496 GCGAGAGAAATGAGGGAGGGAGG + Intergenic
988676585 5:33439633-33439655 GCGTGGGGATTTAGGGGAGTGGG + Intergenic
989137419 5:38168637-38168659 GAGTGGAAATTGAGGCAGGGAGG - Intergenic
989599955 5:43192118-43192140 GCGTGGGGAAGGAGGGACGGGGG - Intronic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
991645385 5:68795814-68795836 AGGTGGGAGGTGAGGGAAGGTGG - Intergenic
991970486 5:72136222-72136244 GGGTGGGAATAGAGGAAATGAGG - Intronic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
997426326 5:133805145-133805167 GGCTGGGAAATGAGGGGAGGTGG - Intergenic
997576251 5:134979930-134979952 GGGTGGGAAATGAGGGTGGGAGG - Intronic
998091527 5:139373679-139373701 GAGAGGGCACTGAGGGAAGGTGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1002046086 5:176542634-176542656 GGCTGGGAAGTGAGGGAAGGAGG - Exonic
1004193544 6:13485674-13485696 GCCTGGGAGTTGAGGGGAGCAGG + Intronic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004615290 6:17282459-17282481 GCGGGGGATTCGGGGGAAGGAGG + Intronic
1004729374 6:18342800-18342822 GGGTGGGAATAGAGGGAGTGAGG + Intergenic
1004852634 6:19715822-19715844 TTGTGGGAATTGAAGGATGGGGG + Intergenic
1005631890 6:27716115-27716137 TAGGGGGAATTGAGGGAATGGGG + Intergenic
1006301067 6:33193709-33193731 GCCTGAGAATTGAGGGGAGGTGG - Exonic
1006361454 6:33589518-33589540 GCCTGGGAACTTAGGGAGGGAGG - Intergenic
1006520187 6:34566866-34566888 GGGTGGGCAATGAAGGAAGGTGG + Intergenic
1007811377 6:44488495-44488517 GGGTGGGGATTGAGAGGAGGGGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008695913 6:54036846-54036868 GCATGGGAAATGAGAGAAGTTGG + Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1011768673 6:90652112-90652134 GCCTGGGAAATTAGGGAAGGGGG + Intergenic
1013227749 6:108132825-108132847 GCGGGGAAAATGAGGGAGGGTGG - Intronic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013345178 6:109253175-109253197 GAGTGCAAAGTGAGGGAAGGTGG - Intergenic
1015244534 6:131062599-131062621 GCGTGGGGACTGCGGGAAGCCGG - Intronic
1016451026 6:144182407-144182429 GTGTGGTAAAGGAGGGAAGGGGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1019103388 6:169649991-169650013 GAGGGGGAATAGAGGGATGGAGG - Intronic
1019376335 7:694500-694522 GCCTGGGCATTAGGGGAAGGAGG - Intronic
1019732231 7:2634560-2634582 GCGGGGGGATGGAGGGGAGGTGG + Intronic
1019859776 7:3646936-3646958 GCCAGGGACTTGGGGGAAGGAGG + Intronic
1020641206 7:10755983-10756005 GCTTGGAAACTGAGGCAAGGAGG + Intergenic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1022482835 7:30755158-30755180 TCCTGGGGATTAAGGGAAGGGGG + Intronic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1023347200 7:39283422-39283444 GCTTGGGAGTGGAGGGAATGGGG - Intronic
1024526656 7:50355050-50355072 GCCTGGGTCTTGGGGGAAGGTGG + Intronic
1024973150 7:55088836-55088858 GCGTGGGAGATGAGGCAGGGAGG - Intronic
1026046589 7:66909795-66909817 TGGTGGGAATTGGGGAAAGGAGG - Intergenic
1026605920 7:71815778-71815800 GGGTGGGAAGGGAGGAAAGGGGG - Intronic
1027941963 7:84694096-84694118 GGCTGGGAATTGAGGGAATTGGG - Intergenic
1028492293 7:91425596-91425618 GTGTGGGAAGTCAGGGAAGTGGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029053657 7:97717046-97717068 GCGGGGGAAGGGTGGGAAGGGGG + Intergenic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032607037 7:133366932-133366954 CCGTGGCAATGGAGTGAAGGAGG + Intronic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1033459580 7:141533225-141533247 ACTTGGGGACTGAGGGAAGGTGG + Intergenic
1034976130 7:155450093-155450115 GCGAGGGACTTGGGGGAAGGGGG + Intergenic
1035746698 8:1966290-1966312 GCGTGGGAAGTGAGGAGAGTGGG - Intergenic
1036020709 8:4842214-4842236 GTGTGGGAATTAAGGGAACCAGG + Intronic
1036075371 8:5493575-5493597 GCGTGTTAATTGATGGAAGGGGG - Intergenic
1036724810 8:11210432-11210454 TCTTGAGAACTGAGGGAAGGCGG + Intergenic
1038054170 8:23842672-23842694 GGGTGGGAAGTGTGGGAGGGAGG + Exonic
1041953619 8:63533155-63533177 GGGAGGGAAAAGAGGGAAGGAGG - Intergenic
1042210422 8:66375177-66375199 GGGTGGGAATTGAGGAAGGAGGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044803773 8:95983755-95983777 GAGAGGGAATGGAGGGGAGGGGG + Intergenic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1047180412 8:122582498-122582520 GGGTAGGATGTGAGGGAAGGAGG - Intergenic
1047993157 8:130307708-130307730 GCGTGGGAATTGGGAAATGGAGG - Intronic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1049702490 8:144021494-144021516 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702697 8:144022341-144022363 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1050091411 9:2018193-2018215 GCTTGGGAATCGAGGGAGTGGGG + Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1051181130 9:14412989-14413011 AGGTGTGATTTGAGGGAAGGAGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053617124 9:39779858-39779880 GCCAGGGATTTGAGGGAAGCAGG - Intergenic
1053897335 9:42755407-42755429 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054236393 9:62562500-62562522 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054267044 9:62927579-62927601 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054550535 9:66597030-66597052 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1056716162 9:89031716-89031738 GCGTGGGAATGGGGTGAGGGTGG + Intronic
1056726399 9:89122805-89122827 GAGTAGGAATTGTGGGAAGGAGG + Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1060180396 9:121529736-121529758 TCGTGGGAACTCAGGCAAGGAGG + Intergenic
1060343178 9:122794378-122794400 GGGTGGAAATTGAGGGGAAGAGG + Intergenic
1060851052 9:126876183-126876205 GGGGGGGAAAGGAGGGAAGGGGG - Intronic
1061339207 9:129965767-129965789 GGGAGGGAAGGGAGGGAAGGAGG + Intronic
1061805647 9:133136312-133136334 GCGCGGGTATGGATGGAAGGAGG + Intronic
1061917396 9:133762609-133762631 GCTTGGGAAATGAGGGGAGGTGG - Exonic
1062030345 9:134359398-134359420 GCCTGGGAAGGGAGGGGAGGTGG - Intronic
1062550702 9:137085037-137085059 GGGTGGGGATTGAGGAAAGGGGG + Intergenic
1185504749 X:624032-624054 GGGGAGGAATTCAGGGAAGGGGG + Intergenic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1189121386 X:38398986-38399008 GGGAGGGAATTGAGGGAAAAAGG - Intronic
1189363755 X:40372250-40372272 ACGTGGGAAGTGAGTGCAGGGGG - Intergenic
1189713721 X:43842900-43842922 GGGTGAGAACTGAGGGAATGAGG + Intronic
1190060310 X:47206571-47206593 TGGTGGGAAGTGAGGGAGGGAGG - Intronic
1190076375 X:47320271-47320293 GCATGGGGCTTGAGGGAAGTTGG - Intergenic
1190749868 X:53352730-53352752 GCCAGGGGTTTGAGGGAAGGAGG + Intergenic
1191178219 X:57529461-57529483 AAGTGGGACTTGAGTGAAGGAGG - Intergenic
1191749100 X:64521775-64521797 ACTTGGGAAATGAGGCAAGGAGG + Intergenic
1192310207 X:70005609-70005631 GTGTAGGTATTGAGGGAAAGTGG + Intronic
1193249178 X:79267880-79267902 GTGTGGGAAATGAGAGAAAGAGG - Intergenic
1193743409 X:85244717-85244739 GCCTGGGAGTTGGGGGGAGGGGG + Intronic
1194766861 X:97851812-97851834 GAATGAGAATTGAGTGAAGGGGG + Intergenic
1195086450 X:101418352-101418374 GCGTGGCGAATGACGGAAGGTGG + Intronic
1195329013 X:103781211-103781233 GCATGGGAAAGGAGGGAGGGAGG + Intronic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197354861 X:125425911-125425933 GTGGGGGAATTGAAGGAAGATGG + Intergenic
1197417805 X:126196672-126196694 GTGAGGGAAGTTAGGGAAGGGGG + Intergenic
1197606461 X:128591260-128591282 TCGGGGGAGTTGAGGGGAGGGGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199976907 X:152899505-152899527 GGCTGGGAATTGCTGGAAGGAGG - Intergenic
1201578236 Y:15483587-15483609 GGGAGGGAAGGGAGGGAAGGAGG - Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic