ID: 1145979300

View in Genome Browser
Species Human (GRCh38)
Location 17:29002431-29002453
Sequence TCCTGGCCTCCTCAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 373}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145979300_1145979310 13 Left 1145979300 17:29002431-29002453 CCACCCTGCTGAGGAGGCCAGGA 0: 1
1: 0
2: 3
3: 36
4: 373
Right 1145979310 17:29002467-29002489 CTGCCAAGCTTAGACCTATGAGG 0: 1
1: 0
2: 0
3: 6
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145979300 Original CRISPR TCCTGGCCTCCTCAGCAGGG TGG (reversed) Intronic
900418553 1:2545994-2546016 GCCTGGCCTCCTCAGGGGTGAGG - Intergenic
901012617 1:6210080-6210102 TGCTGCCCTCCTTAGCTGGGAGG - Intronic
901045376 1:6393014-6393036 TCCTGGCCGCATCTCCAGGGCGG - Intronic
901153892 1:7122775-7122797 TTCTGGCTTCAGCAGCAGGGAGG - Intronic
901228636 1:7629781-7629803 TCCTGCCCTCCTCTCCAGGCTGG + Intronic
902606920 1:17573957-17573979 TCCTTTCCTCTTCACCAGGGAGG - Intronic
902754165 1:18538081-18538103 AGCTGGGCCCCTCAGCAGGGAGG - Intergenic
902838475 1:19060877-19060899 TCCTGCCCAGCTCAGCAGTGAGG - Intergenic
903268892 1:22175529-22175551 GCCTGGCCTTCCCAGCAGGAAGG + Intergenic
903732023 1:25503669-25503691 CCCTGTCCTCCTCTGCACGGAGG + Intergenic
903800355 1:25962707-25962729 TCTTGGCCTCCTGAGTAGGTAGG - Intronic
904239821 1:29136701-29136723 TTCTGGCCGCCGCAGCAGTGTGG + Intergenic
904385097 1:30135947-30135969 TCCCAGCCTCCTCTGCAGGTAGG - Intergenic
904783685 1:32969600-32969622 TCCTAGCTTCCTCACCAGAGAGG + Intergenic
905611650 1:39357691-39357713 TCCTTGCCGCTTTAGCAGGGAGG - Exonic
906061476 1:42952000-42952022 TCCTGGCCCCCTGACCAGTGAGG - Intronic
906480126 1:46194218-46194240 TCCTTCCCAGCTCAGCAGGGGGG - Intronic
906948937 1:50318769-50318791 TCCTGGCCTCCCTGGCAGGAAGG - Intergenic
907250274 1:53133523-53133545 TCCAGGACTCCTCTGCAGAGAGG - Intronic
907422782 1:54358368-54358390 TCCTGGCCTCCTGAGCTGGGTGG - Intronic
909272881 1:73646334-73646356 TGCTGAGCTCCTCAGCAAGGGGG - Intergenic
911501813 1:98695544-98695566 TCCTGGCTTGCTAAGCAGGATGG + Exonic
911561979 1:99417755-99417777 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
911734743 1:101324692-101324714 TCCTGGCCTCCTTAGGTGGATGG + Intergenic
912649485 1:111425204-111425226 TCCTGGCCTCTTCTCCATGGTGG - Intronic
914825139 1:151134128-151134150 TCCTGGGTTCCACAGGAGGGAGG - Intronic
915117664 1:153610767-153610789 TCCTGGCCTCCAGGGGAGGGAGG - Intronic
915637138 1:157195100-157195122 ACCTGGCGCCGTCAGCAGGGTGG - Intergenic
915821734 1:159031249-159031271 TGCTTGCTTTCTCAGCAGGGAGG - Intronic
915999986 1:160606285-160606307 TGCTTGCCTTCTCAGCAGAGAGG - Intergenic
916023448 1:160814285-160814307 TCCTGGCCTCCTCCTCTGAGGGG - Intronic
916070859 1:161168975-161168997 TCTTTGCTTCCTCTGCAGGGCGG + Exonic
916207554 1:162330273-162330295 TCCTTGCCTGCTTAGAAGGGAGG - Intronic
918963293 1:191306959-191306981 ACCTGGCACCCTCAGCGGGGTGG + Intergenic
919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG + Intronic
919925399 1:202189367-202189389 GCCTGGGCTCCCCAGAAGGGCGG + Intergenic
920070636 1:203300550-203300572 TCCTTGCTTCCTAATCAGGGTGG - Intergenic
922155430 1:223037136-223037158 TCCTGGCCTTCTCAGATGGTGGG + Intergenic
922800085 1:228361163-228361185 TCCTGGCCTTTTCTGCAGGGTGG + Intronic
923173944 1:231445401-231445423 TGCTGGTTTTCTCAGCAGGGAGG + Intergenic
924451275 1:244181339-244181361 TCCAGGTCTCCTCCGCAGGGAGG - Intergenic
924900035 1:248388004-248388026 TCCTGTCCTCATCAGCTGGCGGG + Exonic
1063016717 10:2085262-2085284 TCTTGGCCTCCTAAGCAGCTTGG + Intergenic
1063062424 10:2570007-2570029 CCCTGCCCTCTTCAGCAGGATGG + Intergenic
1064014242 10:11760430-11760452 TCCTGGCCGGCTCAGCAGATGGG - Intronic
1064605333 10:17033168-17033190 ACCTGGCCTGCAGAGCAGGGTGG - Intronic
1064868054 10:19904562-19904584 TGCTTGCTTTCTCAGCAGGGAGG - Intronic
1065831447 10:29618139-29618161 TCCTGTCCTCTTGAGGAGGGAGG + Intronic
1068148760 10:53105326-53105348 TCCTGGATTCCTCAGAAAGGTGG + Intergenic
1072381807 10:94879851-94879873 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1073462853 10:103676577-103676599 TTCCGGTCTTCTCAGCAGGGTGG - Intronic
1073469418 10:103713639-103713661 TCCTGACCACCTCAGCAGGCTGG + Intronic
1074459151 10:113621156-113621178 TCCTAGCCACCTCAGTGGGGGGG + Intronic
1074754712 10:116615757-116615779 GCCTGGTCTCTTCTGCAGGGTGG - Intergenic
1076057938 10:127390662-127390684 TCCTGGCCTCCAGAACAGTGAGG + Intronic
1076521132 10:131082070-131082092 TCCTGGCCTGCATAGCAGGATGG + Intergenic
1076842050 10:133050534-133050556 GCCTGGCCTCCGAGGCAGGGAGG + Intergenic
1077233897 11:1470761-1470783 TCCTGGCCACCTCCTCAGGAAGG + Intronic
1080956271 11:37099550-37099572 TCCTATCCTCCTCAGCAGAGAGG - Intergenic
1081850825 11:46274140-46274162 ACCAGGCCTCCTGAGCGGGGAGG + Intergenic
1083492609 11:63023935-63023957 TCCTGAGCTCTTCAGCACGGAGG + Intergenic
1084454812 11:69262337-69262359 TCCTGGGCTCCTCTCTAGGGAGG + Intergenic
1085392310 11:76188801-76188823 TCCTTCCCTCCTCTGCACGGCGG - Intronic
1086100752 11:83097054-83097076 TCCTGGCCTCCTTTGCAGTTAGG + Intergenic
1086743097 11:90391914-90391936 GGCTTGCTTCCTCAGCAGGGAGG + Intergenic
1086958573 11:92958885-92958907 TGCTTGCCTCCTCAGCACCGAGG - Intergenic
1088413834 11:109567518-109567540 TGCTGGCCTTCTCTGCAGGGAGG - Intergenic
1088589113 11:111387523-111387545 GCCTGGCCTCCACAGCAGGCTGG + Intronic
1088739163 11:112752716-112752738 TCCAGGCCTTCTCAGCAGTTGGG + Intergenic
1090549939 11:127808678-127808700 TCCTGGCATCCTGGGCTGGGTGG + Intergenic
1091089407 11:132756091-132756113 TCATGACCTCCTGACCAGGGTGG + Intronic
1091673176 12:2467470-2467492 TCCCAGCCTCCCCAGAAGGGAGG + Intronic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1092196427 12:6552301-6552323 TCCTGCTCTGCCCAGCAGGGAGG - Intronic
1092587908 12:9919632-9919654 TCCTTGTCTCCTCACCAGGAGGG - Intronic
1095570088 12:43674982-43675004 TCCTGGCCTCCACAGATGGCAGG - Intergenic
1095976374 12:47943214-47943236 TCCTTTCCTCCTCAGGAGGGTGG - Intergenic
1096243975 12:49974228-49974250 GCCTGGTCTCCTCAGCTGGAGGG - Intronic
1097054558 12:56241903-56241925 TCCCTGCCTTCCCAGCAGGGAGG - Exonic
1097302588 12:58034527-58034549 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1097399697 12:59114124-59114146 ACCTGGCATCCACATCAGGGGGG - Intergenic
1099526958 12:83727784-83727806 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1099719486 12:86342306-86342328 TCCATGTCTCCTCAGCAGGCAGG + Intronic
1099734069 12:86543953-86543975 ACATGGACTCCTCATCAGGGGGG + Intronic
1100658271 12:96670055-96670077 TCCTGGGCTGCTCATCATGGTGG + Intronic
1101796787 12:107982389-107982411 TCATGCCCCCATCAGCAGGGGGG + Intergenic
1101936970 12:109066134-109066156 TCTTGGCCTCCTGAGCAGCTGGG - Intronic
1102215835 12:111160852-111160874 TCCTGGCCTGAACAGCTGGGTGG + Intronic
1102278468 12:111599771-111599793 TCCTGTCCTCCACACCAGGCAGG - Intergenic
1102421061 12:112803160-112803182 CCCAGGTCTCCACAGCAGGGTGG + Intronic
1103440846 12:120961781-120961803 TCGTTGACTCCTCAGCAGGGAGG + Intergenic
1104474987 12:129063821-129063843 TCCGGGCCACCTCAGTAAGGTGG - Intergenic
1104960909 12:132488426-132488448 TCCTGGCCTTCTGTCCAGGGAGG + Intergenic
1105426655 13:20300396-20300418 TGGTGGCCACCTCAGCAGGGCGG - Intergenic
1107661378 13:42643079-42643101 TCCAGCCCTCCTCACCAGGCAGG - Intergenic
1108188907 13:47917241-47917263 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1110181747 13:72625854-72625876 TGCTTGCCTTCTCAGCAGGGAGG + Intergenic
1110300652 13:73922888-73922910 CCCAGGCCTCCTCTGTAGGGTGG + Intronic
1111225549 13:85266486-85266508 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1112033117 13:95475051-95475073 TCCTTGACTCCTTAGCAGAGAGG - Intronic
1113217854 13:108063282-108063304 TCCTGCCCTTTGCAGCAGGGAGG - Intergenic
1114298877 14:21356048-21356070 TCCTAGCCTGCTATGCAGGGAGG + Intronic
1114493867 14:23119411-23119433 TCCTGGCCTATTCAGCAGTTGGG + Exonic
1116045203 14:39734514-39734536 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1119102335 14:71891436-71891458 ACTTGGCCTCTCCAGCAGGGTGG + Intergenic
1119548465 14:75490888-75490910 TCCTAGCCTCCTTTGCAGTGAGG - Intergenic
1120574821 14:86169075-86169097 TCATTGCCTTCTCAGCAGGAAGG + Intergenic
1122151108 14:99726716-99726738 TGGAGGCCCCCTCAGCAGGGGGG - Exonic
1122179687 14:99946309-99946331 CCCTGAACTGCTCAGCAGGGAGG - Intergenic
1122682884 14:103479754-103479776 TCCTGGCCTCCTGAGTAGCTGGG + Intronic
1122744097 14:103887865-103887887 TGATGGCCTAGTCAGCAGGGCGG - Intergenic
1123040045 14:105486724-105486746 TCCTGCCCTCCCCAGGACGGAGG - Intergenic
1123707284 15:22959531-22959553 CCATGGCCTCCTGAGCAGGCGGG - Intronic
1126184873 15:45821968-45821990 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1126938575 15:53739941-53739963 TACTGTTCTACTCAGCAGGGTGG - Intronic
1128450691 15:67804444-67804466 TCCTGCCCTCCTCAGCTGGGAGG - Intronic
1128672779 15:69586838-69586860 GCCGGGCATCCACAGCAGGGCGG - Intergenic
1128738355 15:70066269-70066291 GCGTGGCCACCTCAGGAGGGAGG + Intronic
1129562805 15:76589609-76589631 TCCTTGCTTTCTCAGCTGGGAGG - Intronic
1130937994 15:88486330-88486352 TCTTGGCCTCCTGAGCAGCTGGG - Intergenic
1130996640 15:88907868-88907890 CCCTGGCTTCCTCAGGAGGGTGG + Intronic
1132266499 15:100476940-100476962 TTGTGGCCTCTTCAGCAGGATGG - Intronic
1132698569 16:1212604-1212626 TGCTGGGGTCCTCCGCAGGGTGG + Intronic
1133815359 16:9193441-9193463 TCCTAGCCTCCTGAGTAGGCAGG + Intergenic
1134073911 16:11277339-11277361 GCCTGGCCTTCTCAGCAGAGTGG - Intronic
1134215142 16:12311453-12311475 TCCTGGCTTCCTCTGCTGGCTGG + Intronic
1134251345 16:12576249-12576271 TCCTGGCCTCCTGAGTAGCTGGG - Intergenic
1134622876 16:15702900-15702922 TACTGGGCCGCTCAGCAGGGAGG - Intronic
1135415208 16:22263752-22263774 TCCTGGGCTGCTGAGCAGAGAGG + Intronic
1136355903 16:29744721-29744743 TCCTGGGCGCCACACCAGGGTGG + Exonic
1136411619 16:30081010-30081032 TCCAGGCCTTCTGAGCAGGCTGG - Intronic
1136419226 16:30122141-30122163 CCCAGGCCTCCACAGCAGGAAGG - Intronic
1136540193 16:30924295-30924317 TCCCGGCCTCCGCCGGAGGGAGG + Intronic
1137711298 16:50568667-50568689 TCTGGGCCTCCTTAGCAGGTTGG + Intronic
1137780703 16:51095664-51095686 TCCTGGAAGCCACAGCAGGGCGG + Intergenic
1138217101 16:55214096-55214118 TCTTGGCTTCCTGAGTAGGGTGG + Intergenic
1139710796 16:68774402-68774424 TCTTGGCCTCCTGAGCAGCTGGG - Intronic
1141312175 16:82925203-82925225 TCCTGGCCTCCTTATCAAAGAGG + Intronic
1141947454 16:87320386-87320408 TCCTGGCATCCCCCGCAGGATGG + Intronic
1142193442 16:88728397-88728419 TCCTGGGTTCCCCAGCATGGAGG - Intronic
1142193509 16:88728737-88728759 TCCTGGGTTCCCCAGCATGGAGG - Intronic
1142193525 16:88728822-88728844 TCCTGGGTTCCCCAGCATGGAGG - Intronic
1142193541 16:88728907-88728929 TCCTGGGTTCCCCAGCATGGAGG - Intronic
1142566586 17:844158-844180 TCCTGCCCTCCTTAGCTGGAAGG + Intronic
1142566626 17:844308-844330 TCCTGCCCTCCTTAGCTGGAAGG + Intronic
1142566638 17:844357-844379 TCCTGCCCTCCTTAGCTGGAAGG + Intronic
1142566650 17:844406-844428 TCCTGCCCTCCTTAGCTGGAAGG + Intronic
1142972992 17:3625464-3625486 CCGTGGTCTCCTCAGCATGGCGG - Intronic
1144707810 17:17380947-17380969 TCCTGGCAGCCTCAGGAGGCCGG - Intergenic
1144825370 17:18102794-18102816 TCCTGCCCTCCTTTGCAGGGTGG + Intronic
1144853816 17:18257489-18257511 TGCTGGCCTGCCCTGCAGGGTGG - Intronic
1145979300 17:29002431-29002453 TCCTGGCCTCCTCAGCAGGGTGG - Intronic
1146249042 17:31321789-31321811 TCCCCGCCTCCAGAGCAGGGAGG + Intronic
1146396510 17:32472187-32472209 TCCTGACCTCATCAGTAGGTTGG + Intronic
1146565127 17:33906337-33906359 TCTTGACATCCTCAGCTGGGTGG + Intronic
1146917104 17:36685016-36685038 TCCAGGCCTCCCCAGCATGCAGG - Intergenic
1148205560 17:45777594-45777616 TCCTGGCCTTGTCAACAGTGTGG - Intergenic
1148957120 17:51363058-51363080 TCATCGCCCTCTCAGCAGGGGGG + Intergenic
1149597169 17:57871147-57871169 CCTGGGCCTCCTCAGCAGGCTGG - Intronic
1149992291 17:61389895-61389917 TCCTGGCTTCCTTGGCAGTGTGG + Intronic
1150117846 17:62569957-62569979 TCTTTGCCTCTTCAGCAGTGTGG + Intronic
1150896208 17:69213647-69213669 TGCTTGCTTTCTCAGCAGGGAGG - Intronic
1151772891 17:76176898-76176920 ACCTGGCACCCTCGGCAGGGTGG - Intronic
1151855836 17:76721206-76721228 TACTGGCCCTCTCAGCAGGGAGG + Intronic
1152576527 17:81143672-81143694 TCCTGGCCTCATCAGGGGTGGGG - Intronic
1155128427 18:22903824-22903846 TCTTGGCCTCCTGAGCAGCTGGG - Intronic
1155572728 18:27213143-27213165 TCATGGCTCCCACAGCAGGGAGG + Intergenic
1157176415 18:45456477-45456499 GCCTGGGCTCCTCAGTAAGGTGG + Intronic
1157791137 18:50532229-50532251 TCCTGGAATCGTCAGCAGTGGGG - Intergenic
1157809495 18:50684622-50684644 TCCTGGCCTCCCCATCACAGTGG + Intronic
1160273765 18:77411359-77411381 TCCTGCCCTCCTCAGCAACCTGG + Intergenic
1160953310 19:1677897-1677919 TCCTGTCCTCCCCACCATGGCGG - Intergenic
1161075977 19:2285976-2285998 TCTTGGCTGCCTGAGCAGGGAGG + Intronic
1161440390 19:4288249-4288271 TCATGGCCCCCTGAACAGGGCGG + Exonic
1161582791 19:5090069-5090091 GCCTCACCTGCTCAGCAGGGAGG - Intronic
1162471129 19:10872315-10872337 GCGTGGCCGCCTCTGCAGGGAGG + Intronic
1162841958 19:13363345-13363367 TCCTGGCCTCGTCACCCAGGCGG - Intronic
1163780883 19:19247367-19247389 CCTTGGCCTCCTCAGCAGCTGGG + Intronic
1164160892 19:22624770-22624792 TATTGGCCTCCTCAACAGGCTGG + Intergenic
1164601276 19:29565252-29565274 TCCTGGCCTCCTGTGGCGGGTGG + Intergenic
1166698007 19:44865258-44865280 TCCTGGGCTCCTGGGCAGAGAGG - Exonic
1167593833 19:50417536-50417558 GCCTGGCCCCCTCCCCAGGGCGG + Intronic
1167669852 19:50844479-50844501 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1168059524 19:53883216-53883238 TCCTGGGACCCTCAGGAGGGTGG + Intronic
925314657 2:2911999-2912021 TACTGGCCTCCCCAGGAGGAAGG + Intergenic
925415405 2:3666881-3666903 ACCTGTGCTGCTCAGCAGGGAGG + Intronic
925447870 2:3943133-3943155 TCCTGGCCGTCCAAGCAGGGAGG - Intergenic
926855288 2:17249714-17249736 ACCTGGCTTCCTCTGCAGTGAGG - Intergenic
927079916 2:19617253-19617275 TGCTTGCATTCTCAGCAGGGAGG + Intergenic
927140325 2:20125827-20125849 ATGTGGCCTCTTCAGCAGGGTGG - Intergenic
927364096 2:22274021-22274043 TCCTAGCCTCCTTTGCAGTGAGG - Intergenic
927855146 2:26523142-26523164 CCCTGGCATCCTTAGCAGGCAGG + Intronic
930023494 2:47015420-47015442 TGCTGCCCTCCTCAGGAAGGAGG - Intronic
930422909 2:51176642-51176664 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
931263225 2:60638291-60638313 CCCTGGCCCCCTCAGCCTGGGGG - Intergenic
932284197 2:70518791-70518813 CCCTGACCACCTCAGCAGAGTGG + Intronic
932883734 2:75528342-75528364 TGCTTGCTTTCTCAGCAGGGAGG + Intronic
934054609 2:88241285-88241307 TCCTGGGCTCCTCCTCTGGGCGG - Intergenic
934123026 2:88858157-88858179 TCAGGGCCTGCTCTGCAGGGAGG - Intergenic
936455870 2:112673889-112673911 GCCTGCCCTCCTCAGCAGCCAGG - Intergenic
936532297 2:113284583-113284605 TCATGGCCCCCACACCAGGGTGG + Intergenic
936881336 2:117254858-117254880 TCCTGTCCTCCCCAGCATGCTGG - Intergenic
937323894 2:120977628-120977650 TCCTGGCCTCGCCACCAGGCTGG + Intronic
937788342 2:125928806-125928828 TCCTGGGCTGCTGAGCAGGACGG + Intergenic
940420697 2:153477292-153477314 TTCTGCGCTCCCCAGCAGGGGGG - Intergenic
940630280 2:156229746-156229768 TGCTTGCTTCCTCAGCAGAGAGG + Intergenic
941357851 2:164514778-164514800 TGCTTGCCTCCTCAGTTGGGAGG + Intronic
941931531 2:170945419-170945441 TCCTGGCCTCCCAAGCAGCTGGG - Intronic
942110985 2:172682546-172682568 TCCTGTCCTCCTCTGCATGCAGG + Intergenic
944485331 2:200199629-200199651 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
944499749 2:200347279-200347301 TCCTAGCCTCCTTTGCAGTGAGG + Intronic
944827267 2:203497195-203497217 TGCTGGCTTCCTCCACAGGGAGG - Intronic
946426617 2:219601791-219601813 GCCTGGCCTCCTCACCAAAGAGG - Intronic
946869941 2:224076070-224076092 TCCTGTCCTCATCAGGAGGGAGG + Intergenic
946961977 2:224995061-224995083 ACCTGACTTCCTCAGCAGGTGGG + Intronic
947536574 2:230943481-230943503 TCCGGGCATCCCCAGCTGGGGGG + Intronic
948541745 2:238696212-238696234 TCCAGGCCCCCCGAGCAGGGTGG - Intergenic
1168919250 20:1517189-1517211 TCCCGTCCTCCTCACCAGAGCGG - Intergenic
1169475374 20:5926319-5926341 CCTTGGCCTCCTGAGTAGGGAGG - Intergenic
1169708421 20:8534211-8534233 TCCTAGCCTCCCCAGCAGCTGGG + Intronic
1169881429 20:10351331-10351353 GCCTCCCCTCCTCAGCAGGCAGG + Intergenic
1170478821 20:16744689-16744711 TCCTGTTCTGGTCAGCAGGGTGG + Intergenic
1171402077 20:24880180-24880202 CCCCAGCCTCCTCAGCAGGGTGG - Intergenic
1172631880 20:36384088-36384110 TCATTGCCACCTCAGCATGGGGG + Intronic
1173077718 20:39835642-39835664 TCCTTGCCTCCTCAGCACTCTGG + Intergenic
1175121194 20:56717412-56717434 TCCTGGAATGCTCAGCAGGGTGG - Intergenic
1175164847 20:57036170-57036192 TCCTGGCTGCCTCACCAGGATGG - Intergenic
1175391958 20:58633112-58633134 GCCTGGCCTGCTCACCATGGTGG - Intergenic
1175964556 20:62654061-62654083 TCCTGGCCTCCGGAGCTGGTGGG - Intronic
1175996793 20:62815551-62815573 ACTTGGACTCCTCAGGAGGGTGG + Intergenic
1176066389 20:63198754-63198776 TCCAGGCCGGCTCAGCAGAGTGG - Intronic
1176430123 21:6570172-6570194 TTCTGGCCTCCCCAGCAGCCTGG - Intergenic
1176797463 21:13380508-13380530 TCCTGGTCTCCCCATCTGGGAGG + Intergenic
1178679402 21:34659958-34659980 CCCTGCCCTCCTCAGCAGCAGGG + Intergenic
1179705517 21:43177634-43177656 TTCTGGCCTCCCCAGCAGCCTGG - Intergenic
1179809218 21:43859554-43859576 GCCTGGCCTCATCAGCCTGGAGG - Intergenic
1181022368 22:20110145-20110167 TGCTGGTCTCCTCAGAAGTGCGG - Exonic
1181169505 22:21000312-21000334 TGCCGGCCTCCCCAGCTGGGAGG - Exonic
1181365364 22:22372372-22372394 TCCTTGCCTCCTTCTCAGGGCGG + Intergenic
1181519053 22:23434879-23434901 TCCTGACCTCCTCAGCGAAGAGG - Intergenic
1181584385 22:23845116-23845138 TCCTGGCCTACCCAGCTTGGGGG + Intergenic
1181936539 22:26442906-26442928 TCATGGGCTTCTGAGCAGGGTGG - Intronic
1182280690 22:29216330-29216352 GCCTGGGCTGCTCAGCAGAGGGG - Intronic
1182326020 22:29513570-29513592 TCTTGGCCTCCTAAGCAGCTGGG - Intronic
1183107595 22:35625954-35625976 TCCCAGCCTCCTCTGCAGTGAGG - Intronic
1183484439 22:38081724-38081746 CCCTGGCCCCCACAGGAGGGAGG + Intronic
1184245852 22:43235416-43235438 TCCTGGAGTGCCCAGCAGGGAGG + Intronic
1185401887 22:50623242-50623264 TGTTGGCCTCCTCTGCAGGGAGG - Intronic
949217181 3:1583757-1583779 TCCTGACCTCGTGATCAGGGCGG - Intergenic
950025291 3:9815985-9816007 CCCTGCCCTGCTGAGCAGGGTGG - Intronic
950425210 3:12921359-12921381 TCCTGGCCCCATCACCAGTGTGG + Intronic
951889795 3:27557731-27557753 GCATGGCCTCCTCAGCAGAAGGG - Intergenic
952087183 3:29838221-29838243 CCCTGGCCTCCTCAGTAGGTGGG - Intronic
952522459 3:34174962-34174984 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
952955671 3:38555832-38555854 TCCTGGCATCCTCATCAAGAAGG - Intronic
953173014 3:40524845-40524867 ACCTCGCCTCTTCCGCAGGGCGG + Intergenic
954117429 3:48474905-48474927 GCCTGGCCTCTTCTGCATGGTGG - Intronic
954314290 3:49792821-49792843 TCCTTGGGCCCTCAGCAGGGTGG - Intronic
954592886 3:51798847-51798869 TGCTGGAATCCTCAGCAGGCTGG + Intergenic
954636724 3:52074938-52074960 TCCTGGCTTCCCCAGCACAGGGG + Intergenic
954959289 3:54550260-54550282 TCATGGCCCCCTCAGCAGAGGGG - Intronic
955999045 3:64709248-64709270 TCCTGGCCTCAAAAGAAGGGTGG - Intergenic
958406069 3:93760606-93760628 GCCTGGCCTCCCCATCTGGGAGG - Intergenic
959995377 3:112675037-112675059 TCCTGGACTCCACAGCACTGTGG - Intergenic
961393221 3:126569028-126569050 TCCTGGCCTCATCTCCATGGAGG + Intergenic
962399194 3:135042562-135042584 GGCAGCCCTCCTCAGCAGGGTGG - Intronic
962764525 3:138549267-138549289 TGCTGGCTTTCTCAGCTGGGAGG + Intronic
963509353 3:146227647-146227669 TCCTGGCCTCTCCACAAGGGAGG + Intronic
963766343 3:149340063-149340085 TCCTGTTCTCCACAGCAGAGGGG + Intergenic
963910568 3:150814041-150814063 TCATGGCATCATCAGCAGGGTGG + Intergenic
965184514 3:165446271-165446293 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
966884866 3:184371706-184371728 TCCTGACCTCCACAGGAGGGAGG + Intronic
968543306 4:1179286-1179308 ACCTGGCCTCCTTTGCAAGGTGG - Intronic
969094014 4:4718671-4718693 TCATGTACTCCTCAGCAGAGTGG + Intergenic
969423537 4:7110837-7110859 TGCTGACCTCCTCTGCAGAGTGG + Intergenic
969498540 4:7539875-7539897 GCGTGGCCCCCACAGCAGGGAGG - Intronic
969595581 4:8147760-8147782 TGCTGGCCTCCAGAGCTGGGAGG + Intronic
969605114 4:8198545-8198567 GCCAGGCTTCCTCAGCAGGCAGG + Intronic
970205034 4:13647056-13647078 TCATGTCCTCCTCAGCGGAGAGG + Intergenic
971320102 4:25598765-25598787 TCCTGGCCTCCTGAGTAGCTGGG + Intergenic
973920063 4:55675354-55675376 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
975326045 4:73059929-73059951 TCCTTGCCTCTTCTGCAGTGAGG + Intronic
975860232 4:78669340-78669362 TCCTGGTCTCCTAACCAGGTAGG - Intergenic
979304057 4:119121803-119121825 ACCTGGCCTACTCAGCTAGGGGG - Intergenic
979314547 4:119246347-119246369 ACCTGGCTTCCTCATCATGGTGG - Intronic
979984134 4:127294479-127294501 TGCTTGCCTTCTCAGCAAGGAGG + Intergenic
980519336 4:133910387-133910409 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
982049822 4:151489546-151489568 TGCTTGCTTTCTCAGCAGGGAGG + Intronic
984010853 4:174369795-174369817 TCTTGGCCCCCTCAGCAAAGTGG + Intergenic
984629493 4:182045930-182045952 TCCTGGCCTCCCAAGCAGCTGGG - Intergenic
985488206 5:163510-163532 TCCCATCCTCCTCAGCAGGGTGG - Exonic
985494243 5:195735-195757 GACTGGGCTCCACAGCAGGGAGG + Intergenic
986180026 5:5384582-5384604 TCTTGGACTCCTCAGCAAGCAGG - Intergenic
986627136 5:9732564-9732586 TTCTGGCTTCCATAGCAGGGTGG + Intergenic
986970565 5:13331724-13331746 CCCGGGCATCCTCAGCAGGTTGG - Intergenic
987434958 5:17883483-17883505 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
988935588 5:36079407-36079429 TTCTGCCATCCTCATCAGGGAGG - Intergenic
990176943 5:53118530-53118552 TCCTGGCCTCCTCATCCTTGTGG - Intergenic
992193384 5:74316203-74316225 TCGTTCCCTCCTCAGCAGTGAGG + Intergenic
992672570 5:79074959-79074981 TACTGTCCTCCTCAGCATGGGGG - Intronic
993620032 5:90157250-90157272 ACATGGCCTCTTCATCAGGGAGG - Intergenic
994220859 5:97193256-97193278 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
994887409 5:105582444-105582466 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
995479673 5:112581773-112581795 TCCTATCCTCATCAGAAGGGAGG - Intergenic
996233211 5:121092061-121092083 AACTGGCCACCTCAGCAGTGAGG + Intergenic
996875418 5:128235409-128235431 TGCTTGCATTCTCAGCAGGGAGG - Intergenic
998046733 5:138993078-138993100 TCTCGGCCTCCTTTGCAGGGAGG + Intronic
998854240 5:146379091-146379113 CGCAGGCCTCCGCAGCAGGGAGG - Intergenic
999491070 5:152052261-152052283 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
999844298 5:155461589-155461611 TCCTGTCCTCCTTAACAGGAAGG + Intergenic
1000148837 5:158480226-158480248 TCCAGACCTCCTCAGGAGAGAGG - Intergenic
1000426127 5:161093447-161093469 CCCTGCCCTCCAGAGCAGGGAGG - Intergenic
1001683935 5:173578428-173578450 GCCTGGGCCCCTCAGCAGGTGGG - Intergenic
1002045861 5:176541589-176541611 CCCAGGCCTCCTCTGCAGTGGGG + Intergenic
1003570797 6:7255148-7255170 TCCTGTCCTCCTCAGGGAGGTGG - Intergenic
1005977311 6:30809621-30809643 TCCTGGCCTCCTTAACACTGAGG + Intergenic
1006011956 6:31049929-31049951 TCCTAGCCTCCTGAGCAGCTAGG - Intergenic
1006466105 6:34195915-34195937 GCCAGCCCTCCTCAGCAGTGGGG - Intergenic
1006544212 6:34765852-34765874 TCTTGGCCTCCTGAGTAGGTAGG + Intronic
1007203679 6:40132040-40132062 TCCTAGCCCCTTCAGGAGGGTGG - Intergenic
1007227799 6:40327219-40327241 CCAGGGCCTCCTGAGCAGGGGGG - Intergenic
1007328274 6:41080799-41080821 TCCTGTTCTCAGCAGCAGGGTGG + Exonic
1007769938 6:44184234-44184256 TCTTGGCCTCCCCAGCCAGGGGG - Exonic
1007924685 6:45641700-45641722 CCCTGTCCTCCGCAGCAGGCGGG - Intronic
1008242930 6:49134532-49134554 TCCAGTCTTCATCAGCAGGGAGG + Intergenic
1009360329 6:62803285-62803307 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1010451465 6:76008523-76008545 TCCTTGCCTCCGCAGAAGGAGGG - Intronic
1011156676 6:84341077-84341099 TGCTTGCTTTCTCAGCAGGGAGG - Intergenic
1012359314 6:98357378-98357400 GCCTGGCCTTCTGAGCAGAGGGG - Intergenic
1012889714 6:104884529-104884551 TCCTGGCCTCCTATGCAGGTAGG - Intergenic
1013015957 6:106160816-106160838 TCCTTGCATCCTGAGCAGGAAGG + Intergenic
1013175427 6:107672852-107672874 TCCTGGCCTCCTCAGTCTAGTGG - Intergenic
1014942616 6:127460934-127460956 TCCTAGCCTCATAAGCATGGAGG - Intronic
1016366629 6:143325571-143325593 TCCTGGCTTGATTAGCAGGGTGG - Intronic
1016411953 6:143792759-143792781 ACATGGCCTCTTCAGCATGGTGG + Intronic
1017057617 6:150452409-150452431 TCCTGTGATCCTCAGCAGGCAGG + Intergenic
1018786187 6:167109811-167109833 TCCTGGCATGCTCCGCAGGATGG - Intergenic
1019128450 6:169857044-169857066 GCCTGGCCGCCCCATCAGGGAGG - Intergenic
1019592227 7:1841447-1841469 TCCTGACCTCCTCAGCAAAGAGG + Intronic
1019931751 7:4228135-4228157 TCCTGTCCACCTCAGAAGGAAGG - Intronic
1022468671 7:30668296-30668318 TCCGGGCCTTCTCAGGTGGGAGG - Intronic
1024282790 7:47733319-47733341 TCCTGCCCTCCTCTGCAGCCTGG + Intronic
1025056676 7:55770927-55770949 TCTTGGCCTCCCAGGCAGGGCGG + Intergenic
1028401551 7:90430782-90430804 TACTTGCTTTCTCAGCAGGGAGG + Intronic
1028472891 7:91223998-91224020 TCCTGTCCTCACCAGCAAGGAGG - Intergenic
1028647923 7:93119390-93119412 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1028904107 7:96134148-96134170 TCCTGGCCTCCTGAGTAGCTGGG + Intronic
1029240474 7:99158001-99158023 TCCTGGCCTCCTGAGTAGCTGGG + Intergenic
1030972275 7:116075444-116075466 TGCTTGCCTTCTCAACAGGGAGG + Intronic
1032148622 7:129407467-129407489 TCTTGCCATCCTCAGCAGGGTGG + Intronic
1032332666 7:130994503-130994525 TCCTGGCCTCCAGAACTGGGAGG + Intergenic
1032804205 7:135339374-135339396 TCCCAGCCTCCCCTGCAGGGTGG + Intergenic
1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG + Intergenic
1034192586 7:149223618-149223640 TTCTGGGCTCCACAGCAGGGTGG + Intronic
1034411861 7:150946214-150946236 TCCTGGCCTCTGCAGGATGGCGG - Intronic
1034800239 7:154051786-154051808 TCCTGCCCTCCTCCGGAGAGAGG + Intronic
1035338174 7:158143421-158143443 CCCTCGCCTCCTAAGCACGGAGG - Intronic
1035345261 7:158193183-158193205 CCCTGCCGCCCTCAGCAGGGTGG - Intronic
1035651739 8:1271291-1271313 ATCTGGACTCCTCAGCCGGGGGG + Intergenic
1035677895 8:1467872-1467894 TGGTGGCCTCCTGACCAGGGGGG - Intergenic
1036032568 8:4990722-4990744 TCCTGGCTTCATCAGGAGGAAGG + Intronic
1036289464 8:7474701-7474723 TCATGGAATCCTCAGCAGTGAGG - Intronic
1036582042 8:10084184-10084206 TTCTGGCCTCCTGAGGATGGTGG + Intronic
1036739327 8:11347204-11347226 TCTTGGCCTCCCCAGCTGGGAGG - Intergenic
1038628429 8:29217171-29217193 TGCAGGCCTCCTCTACAGGGTGG - Intronic
1039552001 8:38450258-38450280 TCCTGGGCTCCTGAACGGGGCGG - Intronic
1039881666 8:41629124-41629146 GCCCTGACTCCTCAGCAGGGAGG - Intergenic
1039887770 8:41665023-41665045 TCCTCGCCTCCTCACCAGCCCGG + Intronic
1041157964 8:55007252-55007274 TCCTGGCCTCCAGAGCTGGGAGG - Intergenic
1041831997 8:62164704-62164726 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1041897092 8:62937769-62937791 TGCTTGCTTTCTCAGCAGGGAGG + Intronic
1045366918 8:101484971-101484993 TCCTGGCTTACTAAGCTGGGTGG + Intergenic
1048878583 8:138855648-138855670 GCATGGCCTCCTCAGAAGGTGGG - Intronic
1048986292 8:139736898-139736920 TGCAGCCCTGCTCAGCAGGGTGG - Intronic
1049003421 8:139840217-139840239 CCCTGGCCTCCCCTGCAGGGAGG + Intronic
1049156597 8:141070968-141070990 TCCTGGCCTCCGCGTCAGGGAGG - Intergenic
1049252689 8:141597607-141597629 TCCTGTCTTCATCAGCATGGGGG + Intergenic
1049423206 8:142525901-142525923 TCCTGGCCTCCTCTGCTGGGGGG - Intronic
1049593351 8:143472496-143472518 CCCTGGCCCGCTCAGCAGTGGGG - Intronic
1051564902 9:18486414-18486436 TCCTGGCCTAGCCAGCATGGTGG + Intronic
1054768989 9:69067197-69067219 TCCGGGCCTCACCACCAGGGCGG + Intronic
1056256328 9:84803132-84803154 GCCTCTCCTCCACAGCAGGGTGG - Intronic
1056796265 9:89660834-89660856 CTCTGCGCTCCTCAGCAGGGTGG + Intergenic
1057601153 9:96458547-96458569 TGCTGCAGTCCTCAGCAGGGCGG + Intronic
1057810351 9:98252578-98252600 TCCTGGATTCTTCAGGAGGGAGG + Intronic
1057873578 9:98736056-98736078 TCCTGGCCTCCTCTGCATCCAGG + Exonic
1057949551 9:99359012-99359034 TTCTTGCCTGCTCAGCAGGGCGG - Intergenic
1058976243 9:110127689-110127711 TCCTGTCGTCGTTAGCAGGGAGG + Intronic
1059331580 9:113538891-113538913 TCATGGCCTTCTTAGGAGGGTGG - Intronic
1059466216 9:114470436-114470458 TCATGGCACCCTCACCAGGGAGG - Intronic
1059589951 9:115648064-115648086 TCTTGGCCTCCTGAGAAGGTAGG + Intergenic
1060157807 9:121332227-121332249 TCCTGTGTTCCTGAGCAGGGTGG + Intronic
1060236566 9:121867758-121867780 TCATGGACTCCCCAGCAGGGTGG - Intronic
1060266580 9:122115206-122115228 ACCTGGCCTCTGCAGCAGAGGGG - Intergenic
1060776413 9:126378011-126378033 TCCTGTCCTCCTCTGCAAAGTGG - Intronic
1061109166 9:128555003-128555025 TCCTGGGATCCTCAGGAGGAAGG + Intronic
1061577977 9:131519525-131519547 GCATTGACTCCTCAGCAGGGAGG + Intronic
1061946182 9:133909239-133909261 TCATTGCCTCCTCAGAAGGGGGG + Intronic
1062032106 9:134366386-134366408 TCCCAGCTTCCTCTGCAGGGCGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062235371 9:135505441-135505463 AGCTGGCCTCCCCAGCATGGTGG - Intergenic
1062566365 9:137165653-137165675 TCCTGGACTCCTCAGCTGCCGGG + Intronic
1062580418 9:137226953-137226975 TCCTGGTCTGCTGAGCAGGGTGG + Intergenic
1187478332 X:19631549-19631571 TCCTGCCCTCCACAGCAGCCAGG - Intronic
1189260717 X:39676986-39677008 GCATGGCCTCTTCAGCATGGTGG + Intergenic
1192664121 X:73069695-73069717 GCCTGGCCTCCCCATCTGGGAGG + Intergenic
1192691260 X:73367089-73367111 TTCTTGCTTCCTCAGCTGGGAGG - Intergenic
1193176424 X:78400359-78400381 TCCTGGAAATCTCAGCAGGGTGG + Intergenic
1195877145 X:109553450-109553472 TCCTCACCTCCTCAGCAAAGTGG - Intergenic
1197364254 X:125544711-125544733 TGCTTGCTTTCTCAGCAGGGAGG + Intergenic
1197734953 X:129843648-129843670 TCCTGGGCTCGGCTGCAGGGTGG - Intronic
1199586792 X:149423394-149423416 TGCTTGCTTTCTCAGCAGGGTGG + Intergenic
1199998100 X:153039516-153039538 TCCTACCCTCCCCAGGAGGGAGG - Intergenic