ID: 1145979672

View in Genome Browser
Species Human (GRCh38)
Location 17:29004311-29004333
Sequence GAATTCCTAGGGACATCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145979665_1145979672 2 Left 1145979665 17:29004286-29004308 CCCATCAGGACCCAAGATAGGTT 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1145979658_1145979672 28 Left 1145979658 17:29004260-29004282 CCCAGGGGAGCTGTCCAGCGCCA 0: 1
1: 0
2: 2
3: 22
4: 139
Right 1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1145979662_1145979672 14 Left 1145979662 17:29004274-29004296 CCAGCGCCAGGACCCATCAGGAC 0: 1
1: 0
2: 0
3: 18
4: 148
Right 1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1145979663_1145979672 8 Left 1145979663 17:29004280-29004302 CCAGGACCCATCAGGACCCAAGA 0: 1
1: 0
2: 6
3: 17
4: 154
Right 1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1145979668_1145979672 -8 Left 1145979668 17:29004296-29004318 CCCAAGATAGGTTCGGAATTCCT 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1145979669_1145979672 -9 Left 1145979669 17:29004297-29004319 CCAAGATAGGTTCGGAATTCCTA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1145979659_1145979672 27 Left 1145979659 17:29004261-29004283 CCAGGGGAGCTGTCCAGCGCCAG 0: 1
1: 0
2: 2
3: 18
4: 210
Right 1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1145979666_1145979672 1 Left 1145979666 17:29004287-29004309 CCATCAGGACCCAAGATAGGTTC 0: 1
1: 0
2: 2
3: 2
4: 94
Right 1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1145979657_1145979672 29 Left 1145979657 17:29004259-29004281 CCCCAGGGGAGCTGTCCAGCGCC 0: 1
1: 0
2: 2
3: 12
4: 190
Right 1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145979672 Original CRISPR GAATTCCTAGGGACATCCCC AGG Intronic
903199836 1:21726228-21726250 GAATTCCTGCAGACATCCCCTGG - Intronic
911615592 1:100007108-100007130 AAATTACTAGGGACAGCCACTGG - Exonic
913842761 1:123454184-123454206 GAATTCCTAGTAACTTCCCTTGG + Intergenic
917002622 1:170376046-170376068 GAATGGCTTGGGCCATCCCCTGG - Intergenic
923430756 1:233918204-233918226 GAATACCCAGGGCCATGCCCTGG + Intronic
1068155638 10:53194305-53194327 GAACTCCTGGGGACATGTCCAGG + Intergenic
1068901189 10:62270504-62270526 CAATTCCTGGGGACCTCTCCCGG - Intergenic
1071765896 10:88665021-88665043 GCTTTTATAGGGACATCCCCAGG - Intronic
1074130104 10:110566719-110566741 GGACTCCTAGGGAGATACCCTGG + Intergenic
1075462615 10:122628158-122628180 GTATTCCTAGGTATATACCCAGG + Intronic
1075932855 10:126314040-126314062 GCATTCCCAAGGACATTCCCAGG + Intronic
1076648640 10:131971841-131971863 GCTTTCTCAGGGACATCCCCTGG - Intronic
1078377171 11:10806024-10806046 GAGTTCCTGGGGAAAACCCCAGG - Exonic
1080454865 11:32408948-32408970 GAATTCCTAGGGAATACTCCTGG - Intronic
1082741765 11:56918712-56918734 GGATCCTTAAGGACATCCCCTGG - Intergenic
1085721782 11:78918714-78918736 GGATTCGGAGGCACATCCCCAGG + Intronic
1086729169 11:90227191-90227213 GAATGGCTTGGGCCATCCCCTGG - Intergenic
1091060141 11:132453432-132453454 TCATTCCCAGGGGCATCCCCAGG + Intronic
1097266033 12:57745348-57745370 GAATTCCTGGGGACTTCCGTGGG + Intronic
1105852724 13:24349998-24350020 GATATCATAGGGACCTCCCCAGG + Intergenic
1106137810 13:26987378-26987400 GACTTGTTAGGGACATCCACGGG - Intergenic
1107028256 13:35825166-35825188 GCATTCTTTGGGACATCCCTGGG + Intronic
1108600704 13:51991884-51991906 TAATTCCTAGGAACCTCACCAGG + Intronic
1110081456 13:71319157-71319179 GAATTCCAGGGGAAATTCCCTGG + Intergenic
1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG + Intergenic
1111950581 13:94705996-94706018 GGATACCTAGGGGCTTCCCCAGG - Intergenic
1117715049 14:58571935-58571957 AAATTCCTAGGGAGAATCCCAGG + Intergenic
1119710360 14:76817759-76817781 GAAATCCTAGGAACATCATCAGG - Intronic
1125611228 15:40972143-40972165 CCATTCCTAGGTACATACCCAGG - Intergenic
1127272426 15:57413469-57413491 CAACCCCTAGGGACAACCCCTGG - Intronic
1128607421 15:69047331-69047353 GAAGCCCTGGGGACATCCCCTGG + Intronic
1129068890 15:72934763-72934785 GAAATCCTAGGGACATGACAAGG - Intergenic
1129179304 15:73862212-73862234 GCTTTCCTTGGGACATACCCAGG - Intergenic
1133209762 16:4256996-4257018 GAATACCCAGGGTCATCCCAGGG + Intergenic
1142759315 17:2034132-2034154 GAATTCTTAGGGTCCTCCCCAGG - Intronic
1144040107 17:11403117-11403139 GAAGTCTTAGGGATATCCCTTGG - Intronic
1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG + Intronic
1146931615 17:36782190-36782212 GAATTCAGAGGGAGATCCCTAGG + Intergenic
1152266419 17:79297453-79297475 GGCTTCCTCGGGCCATCCCCCGG + Intronic
1153117168 18:1673105-1673127 TCATTCCTAGGTACATACCCAGG + Intergenic
1155084236 18:22440886-22440908 GAATAGCTTGGGCCATCCCCTGG - Intergenic
1158700767 18:59743890-59743912 GAAGTCCAAGGAAAATCCCCAGG - Intergenic
1159005978 18:63012227-63012249 GAATACCTAGGAAAATCCCGTGG - Intergenic
1159797449 18:72862237-72862259 GAATTCCTGGGGAAAGGCCCAGG + Intronic
1160142150 18:76334990-76335012 TGATTCTTTGGGACATCCCCTGG - Intergenic
1160758112 19:768617-768639 GAATTCCTAGTGAAATTTCCAGG + Intergenic
1161919366 19:7254737-7254759 GACTTCCTTGGGTCCTCCCCGGG + Intronic
1166947316 19:46405024-46405046 AAACTCCTAGGGACATGACCAGG + Intergenic
925669572 2:6296803-6296825 GAATTTCTGGGCCCATCCCCAGG - Intergenic
925819172 2:7782848-7782870 GAATTCCTAGGAGTAGCCCCTGG + Intergenic
928381260 2:30820967-30820989 GAATTTCTAGGGAGAGGCCCGGG - Intergenic
931612965 2:64123781-64123803 CAATTCCTAGGTATATACCCAGG + Intronic
938262715 2:129906881-129906903 GTCTTCCCAGGGCCATCCCCAGG + Intergenic
938899985 2:135791648-135791670 GTCTTCCCAGGGACAGCCCCAGG + Intronic
941945337 2:171090590-171090612 GAATACCTAGGAAAATCCCAAGG - Intronic
946310865 2:218881871-218881893 TATTTCCTATGCACATCCCCAGG - Intronic
947294828 2:228618714-228618736 GAATTCCAAGGGCCATCTGCTGG - Intergenic
1169691734 20:8340155-8340177 GAATTCCTAGGTCCGTTCCCAGG - Intronic
1170300761 20:14881811-14881833 GAATTTCCAGGAACTTCCCCTGG - Intronic
1174345793 20:49928843-49928865 GAATTCCTACTGACACCACCAGG - Intergenic
1178598204 21:33973613-33973635 GAATTCCAAGGGTCCTCCCAAGG + Intergenic
1180203713 21:46243964-46243986 GATTTCCTAGGCACAACCACAGG - Intronic
1183034044 22:35127228-35127250 GGATTCCGAGGGACAAGCCCAGG + Intergenic
955596721 3:60598953-60598975 ACATTCCTAGGGAAATCCCTTGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
966233514 3:177674619-177674641 GAGTTCCAACGGACAGCCCCAGG - Intergenic
968948275 4:3676942-3676964 GGATTCCTGGGGACAGCCCAAGG - Intergenic
970561077 4:17282887-17282909 GAATTTGTAGGAACATTCCCTGG - Intergenic
975982189 4:80173639-80173661 GACTTCCTTTGGGCATCCCCAGG - Intergenic
976091237 4:81460333-81460355 GAATTCCTAGGGACGGCACCCGG + Intronic
985927030 5:3026849-3026871 GACTTGCTTGGGACAGCCCCAGG + Intergenic
987001986 5:13668993-13669015 GGCTTCCTAGGAACAGCCCCTGG - Intergenic
996391440 5:122966919-122966941 GAATTCCTGGGGACATTCTGGGG - Intronic
998996851 5:147875262-147875284 TAATTCCTAGAGATATCACCAGG - Intronic
1001742396 5:174064859-174064881 GACTTCCTCGGGGCATTCCCTGG - Intronic
1002054000 5:176588154-176588176 GATTTCCTAAGCACCTCCCCTGG - Intronic
1003978223 6:11364427-11364449 GAATTCCCAAGGCCACCCCCAGG - Intronic
1007272215 6:40646652-40646674 GAGATCCTAGGTACATACCCAGG + Intergenic
1007272309 6:40647656-40647678 GAGATCCTAGGTACATACCCAGG + Intergenic
1007914613 6:45549383-45549405 GAATTCCAAGGGAGACTCCCAGG - Exonic
1010402866 6:75466923-75466945 GATATCCTAGGGAAAGCCCCAGG - Intronic
1012556328 6:100517101-100517123 TAGTTTCTAGGGACATCCCATGG + Intronic
1012779366 6:103537006-103537028 GACCTCCTAGGGACATCAGCTGG - Intergenic
1022043566 7:26603809-26603831 GAATTCCAAGGGAGAACACCTGG + Intergenic
1022850387 7:34255675-34255697 TAATTCCTTAGGGCATCCCCGGG + Intergenic
1026151163 7:67789175-67789197 GAATCCCTGGGAACATCCTCAGG - Intergenic
1026938765 7:74274580-74274602 GATTTCCCAGGGAGTTCCCCGGG + Intergenic
1030754187 7:113268603-113268625 TCATTCCCAGGGACATCTCCAGG + Intergenic
1032402173 7:131631025-131631047 GATGTCCCACGGACATCCCCAGG + Intergenic
1033261691 7:139849578-139849600 AAATTCCTAGGTACGTCCCCAGG - Intronic
1037851087 8:22329562-22329584 GAATGGCTTGGGCCATCCCCTGG - Intronic
1044731037 8:95228944-95228966 CAATTACTAAGGACATCCTCGGG - Intergenic
1049353296 8:142175596-142175618 GAGATCCTGGGGACCTCCCCTGG - Intergenic
1062553257 9:137100125-137100147 GACGTCCAAGGGACATTCCCAGG + Intronic
1188173054 X:26951958-26951980 GAATTCCTAGAGAAATCCATAGG + Intergenic
1189134417 X:38533817-38533839 GAATTCCTTGGGAAATCTGCAGG + Intronic
1192564437 X:72151853-72151875 GATTTCCTAGGGAAATCACCAGG + Intergenic
1193972557 X:88073920-88073942 GAATTCCTTGGTAAATCACCAGG + Intergenic
1195673411 X:107487711-107487733 GACTCCCTGGGGGCATCCCCAGG + Intergenic
1199823014 X:151469825-151469847 GTATTCCTAGGTACATACCCAGG - Intergenic