ID: 1145979814

View in Genome Browser
Species Human (GRCh38)
Location 17:29004947-29004969
Sequence AGAATCCCCGCGCCCCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145979814_1145979823 23 Left 1145979814 17:29004947-29004969 CCTAGAGGGGGCGCGGGGATTCT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1145979823 17:29004993-29005015 CAGAGACAAATCTGCCTTGCAGG 0: 1
1: 0
2: 3
3: 27
4: 192
1145979814_1145979820 -5 Left 1145979814 17:29004947-29004969 CCTAGAGGGGGCGCGGGGATTCT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1145979820 17:29004965-29004987 ATTCTCAGGGTGTGGGGAACAGG 0: 1
1: 0
2: 0
3: 36
4: 253
1145979814_1145979826 28 Left 1145979814 17:29004947-29004969 CCTAGAGGGGGCGCGGGGATTCT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1145979826 17:29004998-29005020 ACAAATCTGCCTTGCAGGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
1145979814_1145979824 26 Left 1145979814 17:29004947-29004969 CCTAGAGGGGGCGCGGGGATTCT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1145979824 17:29004996-29005018 AGACAAATCTGCCTTGCAGGTGG 0: 1
1: 0
2: 2
3: 22
4: 147
1145979814_1145979825 27 Left 1145979814 17:29004947-29004969 CCTAGAGGGGGCGCGGGGATTCT 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1145979825 17:29004997-29005019 GACAAATCTGCCTTGCAGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145979814 Original CRISPR AGAATCCCCGCGCCCCCTCT AGG (reversed) Intronic