ID: 1145982239

View in Genome Browser
Species Human (GRCh38)
Location 17:29019911-29019933
Sequence CCAGGTGACCAGAAGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 1, 2: 0, 3: 59, 4: 368}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145982222_1145982239 17 Left 1145982222 17:29019871-29019893 CCCAGCTCCTGTCCCCCGCCACC 0: 1
1: 0
2: 5
3: 41
4: 526
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982227_1145982239 4 Left 1145982227 17:29019884-29019906 CCCCGCCACCTCGAGGCTGAGCG 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982220_1145982239 28 Left 1145982220 17:29019860-29019882 CCGCCTCAGTTCCCAGCTCCTGT 0: 1
1: 0
2: 8
3: 42
4: 494
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982223_1145982239 16 Left 1145982223 17:29019872-29019894 CCAGCTCCTGTCCCCCGCCACCT 0: 1
1: 0
2: 4
3: 68
4: 697
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982231_1145982239 -4 Left 1145982231 17:29019892-29019914 CCTCGAGGCTGAGCGCCGCCCAG 0: 1
1: 0
2: 1
3: 14
4: 115
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982229_1145982239 2 Left 1145982229 17:29019886-29019908 CCGCCACCTCGAGGCTGAGCGCC 0: 1
1: 0
2: 1
3: 23
4: 151
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982221_1145982239 25 Left 1145982221 17:29019863-29019885 CCTCAGTTCCCAGCTCCTGTCCC 0: 1
1: 0
2: 11
3: 80
4: 605
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982228_1145982239 3 Left 1145982228 17:29019885-29019907 CCCGCCACCTCGAGGCTGAGCGC 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982230_1145982239 -1 Left 1145982230 17:29019889-29019911 CCACCTCGAGGCTGAGCGCCGCC 0: 1
1: 0
2: 1
3: 11
4: 109
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982219_1145982239 29 Left 1145982219 17:29019859-29019881 CCCGCCTCAGTTCCCAGCTCCTG 0: 1
1: 0
2: 6
3: 91
4: 702
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982225_1145982239 10 Left 1145982225 17:29019878-29019900 CCTGTCCCCCGCCACCTCGAGGC 0: 1
1: 0
2: 2
3: 13
4: 213
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368
1145982226_1145982239 5 Left 1145982226 17:29019883-29019905 CCCCCGCCACCTCGAGGCTGAGC 0: 1
1: 0
2: 1
3: 11
4: 207
Right 1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG 0: 1
1: 1
2: 0
3: 59
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145982239 Original CRISPR CCAGGTGACCAGAAGGGAGA GGG Intronic
900482838 1:2907673-2907695 CCAGATGCTCAGAGGGGAGATGG + Intergenic
901034152 1:6326223-6326245 CCATGTGTGCAGTAGGGAGAGGG + Intronic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902434742 1:16391175-16391197 CCATGGGGCTAGAAGGGAGATGG + Intronic
903040000 1:20522516-20522538 CCAGGAGCACAGAATGGAGAAGG + Intergenic
903343200 1:22667847-22667869 GCAGGAGACCAGAAAGGCGAGGG - Intergenic
904390970 1:30185740-30185762 CTATATGACCACAAGGGAGAGGG - Intergenic
904772934 1:32890960-32890982 CCAGGTGGCCAGAATGGTGGAGG + Intronic
905006582 1:34714747-34714769 CCAGGAGACAAGGAGGTAGAAGG - Intronic
905408055 1:37750692-37750714 CCAGGTGCTCAGGAGGGTGAAGG - Intronic
905773898 1:40655527-40655549 CAAGGTGAGCAGAAGAGAGCAGG + Intronic
906093101 1:43199572-43199594 ACAGGTGAACAAAAGAGAGATGG + Intronic
907321685 1:53606613-53606635 CCCAGAGACCAGCAGGGAGATGG + Intronic
908607454 1:65814074-65814096 CCAGGTGAACAGAAGGGCTGGGG + Intronic
910173531 1:84403515-84403537 TCAGCTGAGCAGAAGGAAGAAGG + Intronic
910285742 1:85552204-85552226 CCAGGTGAATGGAAAGGAGAGGG - Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
910625885 1:89305920-89305942 CCAGGTGGCCAGATGGGATCAGG + Intergenic
911568357 1:99491963-99491985 CCAGCTGATGAGAAGGGAGGAGG - Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
916723325 1:167501745-167501767 CAAGGAGACCAGAAGGCAGGAGG + Intronic
917631865 1:176898310-176898332 CGAGGGGACCAGAAGGCAGTGGG - Intronic
918120665 1:181536954-181536976 CCAGGTGACCAACAGGGTGATGG - Intronic
919139869 1:193557169-193557191 CCAGGTCAGCAAAATGGAGATGG - Intergenic
920299201 1:204978051-204978073 CCAGGTGATGTGAAGGGAGCAGG - Intronic
920299587 1:204980384-204980406 CCTGGTGACGTGAAGGGAGAGGG + Exonic
921347958 1:214206658-214206680 CCATGTGACCAGAAGCAAAAGGG - Intergenic
921894077 1:220380639-220380661 AGAGGTGACTAGCAGGGAGAAGG - Intergenic
921901779 1:220458460-220458482 GCAGCTGAGCAGAAGGGACAAGG + Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923291854 1:232553311-232553333 GCAGATGAACAGAAGAGAGAAGG - Intronic
923325332 1:232875467-232875489 CCAGGGGACCAGGAGGTTGATGG - Intergenic
923715532 1:236421949-236421971 GCACTTGACCAGGAGGGAGAGGG + Intronic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1063650946 10:7936130-7936152 CCAGGGGACAACAAGGAAGACGG + Intronic
1064093062 10:12401719-12401741 CCAGGTGAGCAAGAGAGAGAGGG + Intronic
1064868543 10:19910536-19910558 TCAGGTGACCAAAAGGGAAAGGG - Intronic
1067238252 10:44469479-44469501 CCAGGTGACCCTAAAGGAGCTGG - Intergenic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1067363991 10:45608098-45608120 CCAGGGGACTAGATGGGGGAGGG + Intergenic
1068839010 10:61589385-61589407 CCAGGAGACAGGAAGAGAGATGG + Intergenic
1069230640 10:66005143-66005165 ACAGGAGAACAGAAAGGAGAAGG - Intronic
1070759403 10:79014387-79014409 CCAGTTGCCTAGAAGGGATATGG - Intergenic
1070921081 10:80186726-80186748 CCAGGTGCTGAGAAGGGGGATGG + Intronic
1071471069 10:85984384-85984406 CCAGGTGGCCAGGTGGTAGATGG - Intronic
1072274004 10:93804429-93804451 CCAGGTTACCAGTGGGGAGCTGG - Intergenic
1072415721 10:95245288-95245310 CCAGGTGACAGGGAGGAAGAAGG - Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073129647 10:101179103-101179125 CCAGGGGGCCAGAAAGGAGGAGG + Intergenic
1073323849 10:102631323-102631345 CCAGGATGCCAGAAAGGAGAGGG - Exonic
1076274126 10:129182235-129182257 CCAGGGGAAGGGAAGGGAGAGGG - Intergenic
1076328518 10:129646944-129646966 CCAGGTGTTCAGATGCGAGACGG - Intronic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077819704 11:5725022-5725044 CCAGGAGAGCAGAAAAGAGAAGG - Intronic
1078139205 11:8679751-8679773 GCATGTGACCAGCAGGAAGAGGG - Intergenic
1078356734 11:10637739-10637761 CCAGGGGACCAGAAGAGAAGTGG + Intronic
1078962648 11:16296424-16296446 GCAGCTGAGCAGAAGGAAGATGG + Intronic
1079120453 11:17680394-17680416 CCAGGTGAGCAGAAGCCATATGG - Intergenic
1080680234 11:34469107-34469129 CCAGGAAACCAGAAGTGAGAGGG - Intronic
1081658847 11:44875444-44875466 CCTGGTGACCTGGAGGGAGGTGG - Intronic
1081808918 11:45904574-45904596 CCAAGGGAGGAGAAGGGAGAGGG - Intronic
1082743425 11:56936699-56936721 CCAGGTGGTCATCAGGGAGAAGG - Intergenic
1083758070 11:64801985-64802007 CCAGATGACCAGCAGGGAGGCGG - Intronic
1084010608 11:66346471-66346493 CCAGGTGCTCATAAGGGAGAGGG - Exonic
1084150073 11:67284008-67284030 ACAGGTGATAAGAAGGGAGAGGG - Intronic
1084927041 11:72522278-72522300 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1084972609 11:72780173-72780195 CCAGGGGACCAGATGGGGCAGGG - Intronic
1087208994 11:95427073-95427095 CTATGAGACCCGAAGGGAGAGGG - Intergenic
1088182323 11:107126841-107126863 GCAGGAGATCAGAAGGGGGAAGG - Intergenic
1089773160 11:120817592-120817614 AGAGGTGAGCAGAATGGAGAGGG - Intronic
1089793271 11:120959598-120959620 ACTGTTGACCAGATGGGAGAAGG + Intronic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1090941217 11:131389900-131389922 AAAGGAGACCAGAAGGGTGAGGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092202898 12:6597868-6597890 CCAGCTGAGCACACGGGAGACGG - Intronic
1093103169 12:15052647-15052669 CCAGTTGCTAAGAAGGGAGAAGG + Intergenic
1093182974 12:15988192-15988214 GCAGGTAACGAGAAGGAAGAAGG - Intronic
1093669302 12:21853760-21853782 CAAAGTGACCTGAAGGGAGGAGG + Intronic
1094133303 12:27098022-27098044 TCAGGTCACCAGATGGAAGATGG - Intergenic
1094183126 12:27613253-27613275 TCAGGTCACCAGATGGAAGATGG - Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1096812611 12:54181275-54181297 CAAGGTATCCAGAATGGAGAGGG + Exonic
1096839305 12:54370804-54370826 CCAGGGGGCCAGATGGGAGGGGG - Intronic
1097908815 12:64947698-64947720 CAAGGAGACCTGAATGGAGAAGG - Intergenic
1098769264 12:74533139-74533161 CCAGGTGACCATGAGCAAGAGGG - Intergenic
1098991136 12:77065753-77065775 CCAGGTACCCGGAAGGGGGAGGG - Intergenic
1099814297 12:87625406-87625428 GCAGCTGACCTGACGGGAGATGG - Intergenic
1100261676 12:92938035-92938057 TCAGATGTCCAAAAGGGAGATGG - Intergenic
1100591482 12:96034749-96034771 CCAGGGAACTAGGAGGGAGACGG + Intronic
1101647785 12:106647103-106647125 ACAGTTTACCAGAAGGAAGATGG - Intronic
1102167021 12:110814845-110814867 CCAGGTGCCCAGAAAGTGGAAGG - Intergenic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102817007 12:115874580-115874602 GTGGTTGACCAGAAGGGAGAAGG + Intergenic
1103351614 12:120287568-120287590 CCAGGTGGAGAGAAGGGAGAAGG - Intergenic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1103992636 12:124809576-124809598 CCAGGTGCCCGGTAGTGAGAGGG - Intronic
1104630803 12:130400471-130400493 GCAGATGACCAGCAGGCAGATGG - Intronic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284689 13:18994482-18994504 CCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284940 13:18996008-18996030 CCAGATGAGCGGAAGGCAGAAGG + Intergenic
1105474360 13:20718017-20718039 CCAGGTGACGAGAACTCAGAGGG + Intronic
1106110316 13:26771431-26771453 CCAGGTGACCAGGAAGGGCAGGG - Intergenic
1106174827 13:27321195-27321217 GCAGGTGACCGGGAAGGAGAAGG + Intergenic
1106405824 13:29471922-29471944 CCTGGTGACCAAAAGGGAGCTGG - Intronic
1107074542 13:36308855-36308877 ACAGGTGACAAGAAGTGAGTTGG + Intronic
1107564058 13:41583812-41583834 CTAGGTGGACAGCAGGGAGAGGG + Intronic
1107604940 13:42048315-42048337 CCTGCTGTCCAGAAGTGAGAGGG + Intronic
1108556183 13:51595192-51595214 CCAGGAGACCAGTGGGGACAAGG - Intronic
1109152430 13:58860916-58860938 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1110750792 13:79113284-79113306 CCATGTGAAGACAAGGGAGAAGG - Intergenic
1110809284 13:79793474-79793496 CCAGGTAAACAGGAAGGAGAAGG + Intergenic
1112463749 13:99625216-99625238 CCAGGTTCCCAGAAGGGACAGGG - Intronic
1112794548 13:103041933-103041955 CAAGGTAACCAGAAGTGAAAGGG - Intergenic
1112816760 13:103281854-103281876 CCATGTGATCACTAGGGAGAAGG - Intergenic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117288974 14:54314458-54314480 TCAGGTGAGCAGAAGCGGGAAGG - Intergenic
1117820691 14:59645618-59645640 CCTGGAGACAAGAAGGGTGAGGG - Intronic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1118974137 14:70663036-70663058 TCAGGTGACCAGAGTGGAGGCGG - Intronic
1119484457 14:74978689-74978711 CCAGGAGACAAGGAGGGACAAGG + Intergenic
1119740723 14:77012256-77012278 CCCGGTGTCCAGAGGGGAGCTGG + Intergenic
1120258656 14:82153968-82153990 CCAGTTGACCAGGAGACAGAAGG + Intergenic
1120672816 14:87383970-87383992 CCAGGTGATAAGAAGCTAGAAGG - Intergenic
1121668527 14:95690964-95690986 CCAGGGGCACAGAAGAGAGAGGG - Intronic
1121916431 14:97840272-97840294 CCAGGAGACCAGAAGGCATCTGG - Intergenic
1122319749 14:100846964-100846986 ACAAGTGATCAAAAGGGAGAAGG + Intergenic
1122837092 14:104435692-104435714 CCTGGTCACCAGCAGTGAGAAGG + Intergenic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1124468457 15:29961716-29961738 TCAGGTGAAGAGAAGGGAAATGG - Intronic
1125520563 15:40345837-40345859 GCAGGAGACCTGAAGGGAGGTGG - Intergenic
1125641097 15:41231281-41231303 CTAGGGGTCAAGAAGGGAGAGGG - Exonic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1127871346 15:63076442-63076464 CCAGCTCACCAGAAGGCCGAAGG - Intergenic
1128129040 15:65213376-65213398 GCTGGTGGCCAGGAGGGAGACGG - Intergenic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1129608112 15:77034642-77034664 GCAGGTGACCAGGAGAGGGAGGG - Intronic
1130059997 15:80562893-80562915 CCATTTCACCAGAAGGTAGACGG + Intronic
1131858624 15:96627026-96627048 CCAGCTGACAAGAAGAGAAAGGG - Intergenic
1132760995 16:1508672-1508694 CCAGGTGGGGAGAGGGGAGATGG - Intronic
1134411319 16:14004881-14004903 CCAGGTGGACAGATGGGAGCTGG - Intergenic
1134849314 16:17468121-17468143 CCAGGAGACCAGAAGGGGGCAGG - Intronic
1135149899 16:19996283-19996305 CCAGTTGACAAGGAGGGAGAGGG - Intergenic
1135563891 16:23497134-23497156 CCAGATGGCCAGAGGGGAGTTGG - Intronic
1136230439 16:28882673-28882695 CCAGGTGTCCAGGAGGATGACGG + Intronic
1137540920 16:49361076-49361098 CAAGGGGACTAGAAGGGAGAGGG - Intergenic
1137677128 16:50309256-50309278 CCAGGTGACCCTGAGGGAGGTGG - Intronic
1140636733 16:76923751-76923773 ACAGCTAACCAGAAGGGTGAAGG - Intergenic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1142138694 16:88463042-88463064 GCAGGTGCCCAGAAGGAAGTGGG - Intronic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143181519 17:4987042-4987064 CCAGGTGTCCAGGATGGAGATGG + Exonic
1143780291 17:9225642-9225664 GAAGGTGACCAGTAGGGGGAGGG + Intronic
1144753745 17:17667481-17667503 CCAGGTTCCCAGAAGCCAGAGGG + Intergenic
1144997365 17:19279371-19279393 CAAGGTCACCAGATGGGGGAGGG + Intronic
1145249594 17:21289913-21289935 GCAGGGGACCAGCTGGGAGAGGG - Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1147994034 17:44351636-44351658 CCAGGTGCCCTGGATGGAGAAGG + Exonic
1147998914 17:44376277-44376299 CCAGGGGTGGAGAAGGGAGATGG - Intronic
1148550912 17:48550477-48550499 CCAGGTTCCCGGAAGGGTGATGG + Exonic
1148611680 17:48968835-48968857 CCCTGTGCCCAGAAGGGAGGAGG - Intergenic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1150213450 17:63454086-63454108 CCAGCTGACCATCAGAGAGAAGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151524237 17:74652966-74652988 CCAGGTGACCAAAAGAGCAAAGG - Intergenic
1152148916 17:78586811-78586833 CGTGGTGACCTGAAGGGAGTTGG + Intergenic
1152271755 17:79329038-79329060 CCACGTGGCCAGGAGGGACAGGG + Intronic
1153286414 18:3459066-3459088 CCAGATGGCCAGAAGGGAATTGG + Intronic
1153598890 18:6758648-6758670 CCAGAAAACCAGAAGGGAAAGGG + Intronic
1154194990 18:12258946-12258968 CCTGGTGACCCGGGGGGAGAGGG - Intronic
1157594012 18:48852938-48852960 CCCTGTCACCAGAAGGGACATGG - Intronic
1157725198 18:49958792-49958814 CCAGGAGCTCAGCAGGGAGAGGG - Intronic
1158398375 18:57097710-57097732 CTAGGTAACAAGAAGGGAGGAGG + Intergenic
1160556728 18:79730371-79730393 CCAGGAAACCAGGAGGGAGACGG - Intronic
1161576865 19:5059188-5059210 TCAGCTCCCCAGAAGGGAGATGG + Intronic
1161935424 19:7368893-7368915 CCTGGTGATCAAAAGGCAGAGGG + Intronic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1163667763 19:18611096-18611118 CCAGGTCGCCTGAGGGGAGAAGG - Intronic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1164251507 19:23481268-23481290 ACAGGTGGACAGGAGGGAGAGGG + Intergenic
1164824347 19:31273510-31273532 CCATGTGGCTTGAAGGGAGATGG - Intergenic
1165071720 19:33259665-33259687 CCTTGTGACCGGAAGGGAGATGG - Intergenic
1165096461 19:33412422-33412444 CCTGGTGGCCAAAGGGGAGAGGG + Intronic
1165097270 19:33416521-33416543 CCAGGTGAGCAGGAGGGAGCAGG - Intronic
1165216083 19:34273836-34273858 CCAGGTGGCGAGAAGGAAGATGG + Intronic
1166231578 19:41428013-41428035 GAAGGTGGCCAGGAGGGAGAGGG + Intronic
1166459946 19:42978288-42978310 CAAGGTGAAAGGAAGGGAGATGG + Intronic
1166477271 19:43138344-43138366 CAAGGTGAAAGGAAGGGAGATGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167320834 19:48796409-48796431 CCAGGTGAGCTGCAGGGAGCTGG - Exonic
925154653 2:1640023-1640045 CCCGGGGACCAGGAGGGACACGG - Intronic
925154668 2:1640066-1640088 CCCGGGGACCAGGAGGGACACGG - Intronic
925154683 2:1640109-1640131 CCCGGGGACCAGGAGGGACACGG - Intronic
925154698 2:1640152-1640174 CCCGGGGACCAGGAGGGACACGG - Intronic
925189530 2:1871579-1871601 CCAGGTGGCTAGAGGGGTGAAGG + Intronic
925631560 2:5899062-5899084 CTAGGTTAGCAGATGGGAGAAGG - Intergenic
925785791 2:7430697-7430719 CAAGGGGACCCAAAGGGAGAAGG + Intergenic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
927538775 2:23887943-23887965 CGAGGGGAAAAGAAGGGAGATGG - Exonic
928726457 2:34179416-34179438 CCAAGTGAATAGAAAGGAGAGGG + Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
931960549 2:67477757-67477779 CCATGTGACCAGATGAGAGCAGG - Intergenic
932189506 2:69728663-69728685 TCAGGTGACCAGAAAGGTGAGGG + Intronic
932222635 2:70011480-70011502 CCAGGTGAGCAGATGAGGGAAGG + Intergenic
934076954 2:88436711-88436733 CCAGGAGACAGGAAGGGAAAGGG - Intergenic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
937952808 2:127401435-127401457 CCAGGTGAGAAGCAGGGAGCTGG - Intergenic
937955096 2:127417670-127417692 CCGGGGTGCCAGAAGGGAGAAGG - Intergenic
939974049 2:148695927-148695949 TCAGGTGATTAGAAGGGACAGGG + Intronic
941790407 2:169546625-169546647 CCAAGTGAGGAGAAGGGAGCAGG + Exonic
943953442 2:194158393-194158415 CCAGTTTACCAGAGAGGAGAAGG - Intergenic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
945601826 2:211877179-211877201 CCAGCTGACAAGAAGCAAGAAGG - Intronic
946284407 2:218692290-218692312 CAAGGTAACCAGAGTGGAGAAGG + Exonic
946321453 2:218956928-218956950 CCAGAGGAACATAAGGGAGATGG + Intergenic
946369149 2:219270108-219270130 CCAGGGGACCTGAAGGGAGTGGG - Intronic
946861497 2:224003890-224003912 ACAGGTGACCTGGAGGGAGGGGG + Intronic
947115115 2:226761540-226761562 ACAGTTGACCAGAGTGGAGAAGG - Intronic
947232652 2:227903526-227903548 GCAAGTGACCAGAGGGGAAAAGG + Intronic
947485132 2:230541021-230541043 CCAGGTGAACAGAAAGGAAGAGG - Intronic
947566364 2:231196476-231196498 GTATGTTACCAGAAGGGAGAGGG + Intergenic
948802705 2:240440082-240440104 GAAGGTGGCCAGGAGGGAGAAGG + Intronic
1169276581 20:4237147-4237169 CCAGAGGACCAGGAGGGAGATGG + Intronic
1172036969 20:32018040-32018062 CCAGGTGAGCAGCAGGCAGCGGG - Exonic
1172173977 20:32961270-32961292 CCTGGTGCCCAGCAGGGAGCAGG + Intergenic
1173323607 20:42011958-42011980 CAAGCTGACCAGGAAGGAGAGGG - Intergenic
1173521815 20:43705491-43705513 CGTGGTGGCCAGAAAGGAGAGGG - Intronic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1173643755 20:44621047-44621069 CCAGATGACCAAACGGGACATGG - Exonic
1174164732 20:48576683-48576705 CCAGGTCCACAGCAGGGAGAGGG - Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175772006 20:61629875-61629897 CCAGCTGAACAGGAGGCAGAGGG + Intronic
1176073320 20:63237778-63237800 CCAGGTGGCAAGAAGGAGGAGGG - Intronic
1177344581 21:19853529-19853551 GCAGGCGATCAGAAGAGAGAAGG - Intergenic
1177564109 21:22796209-22796231 TGGGGAGACCAGAAGGGAGATGG + Intergenic
1178007404 21:28237090-28237112 CCAGGTAACCAGGAAGGAGGAGG + Intergenic
1178517901 21:33264265-33264287 CCAGGTGAGCAGTGGAGAGAAGG + Exonic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1179245502 21:39630730-39630752 AGTGGTGACCAGAAGAGAGAAGG + Intronic
1179419695 21:41225601-41225623 TCTGGGGACCAGAAGGGAAAGGG + Intronic
1179913217 21:44461006-44461028 ACAGGAAACCAGCAGGGAGAGGG - Exonic
1181317333 22:21979137-21979159 CCAGGTGAGTAGGAGGGAGAGGG + Intronic
1181405146 22:22679129-22679151 CCAGGTGTCCATGAGGTAGACGG - Intergenic
1181408303 22:22700773-22700795 CCAGGTGCCCATAAGGTGGAGGG - Intergenic
1181442735 22:22945031-22945053 CCAGGTGACCAGGAAGGAGGAGG + Intergenic
1183233284 22:36596511-36596533 CTAGGGGTCAAGAAGGGAGAGGG + Intronic
1183354522 22:37351089-37351111 CCAGGGGACCGCAAGGGAGGAGG - Intergenic
1183686677 22:39365040-39365062 CCAGGTCACCAGCAAGCAGAGGG - Intronic
1183751438 22:39723260-39723282 CAAGGTCATCAGAAAGGAGAAGG - Intergenic
1183751545 22:39723767-39723789 CCAGCTGAGCAGGAGGAAGACGG + Intergenic
1184456954 22:44616307-44616329 GGACTTGACCAGAAGGGAGAGGG - Intergenic
1184495768 22:44840438-44840460 TCTAGTGAGCAGAAGGGAGAGGG - Intronic
1184504914 22:44894780-44894802 CCAGGGGACATAAAGGGAGAGGG + Intronic
1184855014 22:47142111-47142133 CCAGGTTCCCAGTAGGAAGATGG + Intronic
1185382895 22:50518263-50518285 CCAGGGACCCAGAAGGGTGAGGG + Exonic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
949554926 3:5144615-5144637 CCAGTTTACCAGAAAGGAGAAGG - Intronic
949891432 3:8736501-8736523 CCAGGTGGGCTGCAGGGAGATGG + Intronic
950590788 3:13934724-13934746 GCAGGTGTCCAGAAGTGAGGAGG + Intergenic
950711982 3:14819545-14819567 GCAGGTGTCCAGAAGTGAGGAGG + Exonic
951891998 3:27576102-27576124 CCTGGTCACCAGAAGGAACAAGG - Intergenic
953024898 3:39139155-39139177 CCTGGAGACCAGACAGGAGAGGG - Intergenic
953811240 3:46114656-46114678 CCAGTTTACCAGAGAGGAGAAGG - Intergenic
954373876 3:50184242-50184264 CCAGCTGTGCAGGAGGGAGACGG + Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955857342 3:63287323-63287345 AAAGGTGAGCAAAAGGGAGAGGG - Intronic
955931018 3:64056975-64056997 CCAGGTGACTAAGAGGGAAATGG - Intergenic
956223749 3:66933344-66933366 CAAGGTAAGCAGAAGGGACAAGG - Intergenic
957637680 3:82807866-82807888 CCAGGTGGCCGGCAGCGAGACGG + Intergenic
958844514 3:99249942-99249964 CCAGGTGGTCTGAAGGGAGAGGG + Intergenic
959676937 3:109046244-109046266 CGTGGAGACTAGAAGGGAGAGGG + Intronic
960584452 3:119308109-119308131 CAAGGTGATCAGAAGAGTGAAGG + Intronic
961540839 3:127598321-127598343 ACTGGCGACCAGAAGGGACACGG - Exonic
962203108 3:133415990-133416012 CGGGGTGAATAGAAGGGAGAGGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962632192 3:137289507-137289529 CCAGGTGACAAGGTGGGGGAGGG + Intergenic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
968027137 3:195451853-195451875 CCAGGTCCACAAAAGGGAGAAGG - Intergenic
968791135 4:2663190-2663212 CCAGGGGCCCCGAAGGAAGATGG + Exonic
969518936 4:7664690-7664712 CGTGGTGGCCAGAAGGGAGGTGG - Intronic
975177115 4:71301020-71301042 CCAGCCCACTAGAAGGGAGAAGG + Intronic
975395696 4:73870529-73870551 CCAACTGACCAGAAGGGAGGAGG + Exonic
975415170 4:74097741-74097763 CCAACTGACCAGAAGGAAGGAGG - Exonic
981321100 4:143392579-143392601 CCAGATGACCAGAAAGAATATGG + Intronic
981633296 4:146846583-146846605 CAAGGTGGCCAAAAGGAAGAAGG - Intronic
983442896 4:167810082-167810104 CCAGGTGAAGGGAATGGAGAGGG - Intergenic
983921433 4:173349818-173349840 CCAGGTGTTCAGAAGGCAGTGGG + Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
985260043 4:188106596-188106618 CCAGGTGACCGGCCAGGAGACGG + Intronic
985726640 5:1519764-1519786 CCAGGTCATCAGAAGGCAGCTGG + Intronic
986394506 5:7315096-7315118 CCAGGTGGTCAGATGGGAAAGGG + Intergenic
986482979 5:8207518-8207540 CCAGATAACCATAAGGAAGATGG - Intergenic
987290684 5:16505628-16505650 CCAGCTGTCCTGAAGGGAGAGGG - Intronic
987634738 5:20525516-20525538 CCAGGTGAACTGCAGGAAGAAGG - Intronic
987793973 5:22604961-22604983 CAAGGAGCCCAGAAGAGAGAGGG - Intronic
988092697 5:26563309-26563331 CCACGTGACCAGCAGGAACAAGG + Intergenic
988650420 5:33142794-33142816 CCAGTTTACCAGAAGGAACAAGG + Intergenic
989541944 5:42628127-42628149 CCAGCTGACCAGCAGACAGATGG - Intronic
989772490 5:45161401-45161423 CAAGGTGACCAGAAGACAGTGGG - Intergenic
990518420 5:56552954-56552976 CCAGTTCACCAGAAGGCTGATGG - Intronic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
993573969 5:89578553-89578575 ACAGGTGATCAGAAGAAAGATGG + Intergenic
996367506 5:122718768-122718790 CAAGGAGACCAGAAGTTAGATGG - Intergenic
998253384 5:140567366-140567388 CCAGCCTACCAGAAGGGAGAAGG - Exonic
998613377 5:143713309-143713331 GCAGATGACCAGAAGGTGGAGGG - Intergenic
1001815875 5:174669089-174669111 CCAGGTGACCAGATGGATGGTGG + Intergenic
1002038409 5:176491571-176491593 CCAGGAAAACAGAAAGGAGAAGG + Intronic
1002762764 6:214652-214674 CTAGGGGCCAAGAAGGGAGAAGG + Intergenic
1003640056 6:7868892-7868914 GCAGGTGAGAAGGAGGGAGAGGG - Intronic
1003669064 6:8139123-8139145 CAAAGTGACCAGGAAGGAGAGGG - Intergenic
1004661810 6:17717410-17717432 GAATGTGACCTGAAGGGAGAAGG + Intergenic
1005730652 6:28693819-28693841 TGAGGAGACCAGAAGGGAAAGGG - Intergenic
1005995022 6:30925716-30925738 GCAGGTGACCAGAGGGGATGGGG + Exonic
1006382970 6:33711530-33711552 CCAGGTGACCGGCGGGGAGGCGG - Exonic
1006513544 6:34534075-34534097 CCAGGTGTGCAGGAGGGAGGAGG - Exonic
1006580206 6:35072716-35072738 AAAGGTGGCCAGGAGGGAGAGGG + Intronic
1007344401 6:41217209-41217231 CCAGGGGCCCAGAAGTGAGCAGG + Intergenic
1007345942 6:41229467-41229489 CCAGGGGCCCAGAAGAGAGTAGG - Intronic
1007397341 6:41585351-41585373 CCAGGAGCCCAGATGGGACAGGG + Intronic
1007415221 6:41687700-41687722 CCAGGTGAGAACAAGGAAGAGGG + Intronic
1007811119 6:44486313-44486335 CCAGGTCCTGAGAAGGGAGAGGG + Intergenic
1007930657 6:45687566-45687588 TCAGGCGACCACAAGGAAGATGG - Intergenic
1008330587 6:50240295-50240317 GCAGGTGATGAGAAGCGAGAAGG - Intergenic
1008508496 6:52254168-52254190 CCAGGTGAGCAGAACTGAAATGG - Intergenic
1011656571 6:89557280-89557302 GCATGTGAGCAGAAGGGAGGGGG + Intronic
1011747770 6:90423165-90423187 CCAGGTCACCAGGAGGAATAAGG - Intergenic
1012384190 6:98658885-98658907 CCAGGTGAGCACAAAGGAGATGG + Intergenic
1013429092 6:110040094-110040116 TCATGAGACCAGCAGGGAGAAGG + Intergenic
1013608405 6:111772224-111772246 CCAGGTGACCATCAAGGAAATGG + Intronic
1014018703 6:116564289-116564311 CCAAGTGGGAAGAAGGGAGAAGG - Intergenic
1014193476 6:118524919-118524941 CCAGGTGAGCTGAAGAGAGCAGG - Intronic
1014223817 6:118825244-118825266 CCAGGAGACCAAAAGAAAGAGGG + Intronic
1016634602 6:146273155-146273177 CCAGAGGACCAAAAAGGAGAGGG - Intronic
1017634530 6:156430907-156430929 CCTGTTGGCCAGAAGGGAAAAGG + Intergenic
1018214619 6:161514761-161514783 CCAGGAGACCAGAAGGGCTCTGG + Intronic
1019357812 7:590101-590123 CCTGGAGACCAGAAGACAGAGGG + Intronic
1019484889 7:1284915-1284937 CCAGGGGACAAGCAGGGAGAAGG + Intergenic
1022300830 7:29100534-29100556 CCAGGTCACAGGAAGGGACATGG - Intronic
1022404056 7:30070223-30070245 CCAGATGACCTAATGGGAGAAGG - Intronic
1022529457 7:31057868-31057890 CCTGGATACCAGAAAGGAGATGG - Intronic
1023805051 7:43866974-43866996 CCAGGTTACCTGAAGAGGGAAGG + Exonic
1023818653 7:43968445-43968467 CCTGGTGCCCAGAAAGGATAAGG + Intergenic
1024053132 7:45642150-45642172 CCAGGTCATCAGCAGGCAGAAGG + Intronic
1024340195 7:48249999-48250021 CCAATTGATCAGAAGTGAGAAGG - Intronic
1024472175 7:49775473-49775495 GCAGGTGACCAGGAGGGAACTGG - Exonic
1025250921 7:57350863-57350885 CCAGGTGTCCAGCAGAGAGTGGG + Intergenic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1029102137 7:98140006-98140028 CCAGTTCACCAGAATGGTGACGG + Intronic
1029419990 7:100467420-100467442 CCAGCAGCCCAGCAGGGAGAGGG + Intronic
1030098899 7:105926992-105927014 CCAGATGAACACAAGGGAGGAGG - Intronic
1032069428 7:128794680-128794702 CCAGGAGCCCTGCAGGGAGAGGG - Exonic
1032760045 7:134932161-134932183 CTAGGTGCAAAGAAGGGAGAGGG + Intronic
1032792595 7:135253422-135253444 CCAGCTGACCTGGAAGGAGAAGG + Intronic
1034475401 7:151278678-151278700 CCAGGGGACAGGAAGGGGGAAGG - Intergenic
1034627338 7:152503627-152503649 CCAGGTGGCCAGGTGGGAGTGGG + Intergenic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037247772 8:16856254-16856276 TCAGGAGATCAGGAGGGAGAAGG + Intergenic
1037603141 8:20415714-20415736 CCAGGTGGTAAGAAGGGAGAGGG + Intergenic
1038484384 8:27923276-27923298 GCACGTGAGCAGAAGGGAAAGGG - Intronic
1038525224 8:28267470-28267492 CCAGGTACCCAGCATGGAGAGGG + Intergenic
1038822011 8:30961009-30961031 TAAGGTGACCGGAAGGTAGAAGG + Intergenic
1038893671 8:31756325-31756347 CCAGGTGACTAGCAGGAAGCAGG + Intronic
1040870805 8:52098686-52098708 CCACGTGTCCTGAAGGGAGGAGG + Intergenic
1041278261 8:56186116-56186138 GCAGGAGACAAGAAGGGTGAAGG + Intronic
1041807257 8:61865543-61865565 GCTGAAGACCAGAAGGGAGAAGG + Intergenic
1042434007 8:68742918-68742940 CCAGATGATCAGAAGGGAATGGG - Intronic
1044537646 8:93375612-93375634 CCTGGTGAGGAGATGGGAGAAGG - Intergenic
1045023476 8:98064376-98064398 CCAGGAGACAGGAGGGGAGACGG - Exonic
1045363403 8:101453664-101453686 CCAGCGGACCAGAAGAGAGGGGG - Intergenic
1046744824 8:117865542-117865564 CCAGGTTACAAGAAGGATGAAGG - Intronic
1046780649 8:118211086-118211108 CCAGGGGAGCAGAAGGGAGGGGG + Intronic
1047321785 8:123792838-123792860 ATAGGTGAACAGAAGGGAGTGGG - Intronic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1048590477 8:135816590-135816612 ACAGGGGCACAGAAGGGAGAAGG + Intergenic
1049799279 8:144510290-144510312 CCAGGTGGGGAGAAGGGAGGTGG + Intronic
1049849435 8:144822937-144822959 CCAGGGGTCCTGAGGGGAGATGG - Intergenic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1051106639 9:13587893-13587915 CAAGGAGACCAGAAGTGGGATGG - Intergenic
1051742314 9:20263827-20263849 CCAGGAGGGCACAAGGGAGAGGG - Intergenic
1052356651 9:27511900-27511922 TCAGGTGCCCAGGAAGGAGAGGG - Intronic
1053306797 9:36990084-36990106 CCAGGTAAACAGTAGGGTGAGGG + Intronic
1056127392 9:83549089-83549111 GCAGGTTACAAGGAGGGAGAAGG - Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056992686 9:91425119-91425141 CAAGGAGACCAGGAGGGAGCTGG - Intergenic
1059263233 9:112999728-112999750 CAAGGTGGGCAGAAGGGAAAGGG + Intergenic
1059356068 9:113700403-113700425 CCAGGTGATAACAAGGGAGAAGG + Intergenic
1059615517 9:115946711-115946733 CCAGGTGACCAGGAAGGGGGAGG + Intergenic
1060738770 9:126083890-126083912 CCAAGTGGCCAGAAAGAAGAAGG - Intergenic
1060741039 9:126097760-126097782 CCCGGGGACCAGAACAGAGAAGG - Intergenic
1061596703 9:131635174-131635196 CTAGGTGACCAGGAGGCAGTGGG - Intronic
1062372450 9:136247111-136247133 GAAGGTGACCCGAATGGAGAAGG + Intergenic
1062471881 9:136709745-136709767 CCAGGCTGCCAGGAGGGAGATGG - Intergenic
1203625226 Un_KI270750v1:11589-11611 TGAGGTAGCCAGAAGGGAGACGG - Intergenic
1186187327 X:7033944-7033966 CAAGGTGAAAGGAAGGGAGATGG + Intergenic
1186576787 X:10775198-10775220 AAAGGTCACCAGAAGGGAGTTGG + Intronic
1189268875 X:39736470-39736492 GGAGGTGACCAGCAGGCAGAAGG + Intergenic
1189282768 X:39830545-39830567 CCAAGTGACCAGCTGGGACATGG - Intergenic
1190278959 X:48917348-48917370 CCATGGGACCCAAAGGGAGAGGG - Intronic
1191861433 X:65668705-65668727 CCGGATGCCCAGGAGGGAGAGGG + Intronic
1192502446 X:71662862-71662884 CCAGGCGCCCCGCAGGGAGAGGG + Intergenic
1192504301 X:71671626-71671648 CCAGGTGCCCTACAGGGAGAGGG - Intergenic
1192509644 X:71714238-71714260 CCAGGTGCCCCGCAGGGAGAGGG + Intergenic
1192511116 X:71720922-71720944 CCAGGCGCCCCGCAGGGAGATGG - Intergenic
1192515581 X:71760631-71760653 CCAGGCGCCCCGCAGGGAGATGG + Intergenic
1192517053 X:71767315-71767337 CCAGGTGCCCCGCAGGGAGAGGG - Intergenic
1193492955 X:82171917-82171939 GGAGCTGACCAGAAGGTAGATGG + Intergenic
1193773941 X:85620512-85620534 CCTGGTGACTAGCAGGGAGCAGG - Intergenic
1194532188 X:95064116-95064138 CCAGGTGATCACAAGGAAGTGGG + Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195116771 X:101707164-101707186 GCAGATAACCAGAAGGGAGATGG + Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1196980909 X:121212844-121212866 CCAGCTGTCCAGAATGGAGGAGG + Intergenic
1199164623 X:144656841-144656863 CCAAGTGACAACAAAGGAGACGG + Intergenic
1199580063 X:149351857-149351879 TGAGGAGGCCAGAAGGGAGATGG + Intergenic
1200019028 X:153186596-153186618 CCATGTGTCCAGAAAGGGGAAGG - Intergenic