ID: 1145982714

View in Genome Browser
Species Human (GRCh38)
Location 17:29023330-29023352
Sequence TTGGGGAAGAATAATGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145982714 Original CRISPR TTGGGGAAGAATAATGAGAT TGG Intronic
901939758 1:12652997-12653019 TGAGGGAAAAAAAATGAGATAGG - Intronic
903464700 1:23543959-23543981 TTGGGGAGGAATAATCACAGGGG - Intergenic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
905406149 1:37733725-37733747 TTGGGGGAGAGGAATGAGAAGGG - Intronic
906987373 1:50698178-50698200 TTGGGGAGGAATGAAGAGGTTGG + Intronic
908570597 1:65406130-65406152 TTGGGTAAGGATAATGGTATGGG + Exonic
909805037 1:79863879-79863901 GAGGGGAAGAATAATTAGAATGG + Intergenic
910830162 1:91452984-91453006 TGGGGGTGGAATAATGAGAATGG - Intergenic
910853860 1:91674455-91674477 TTAGGGAAGAACAATGCTATAGG + Intergenic
910990088 1:93047021-93047043 ATGGGGTAGAATATTTAGATGGG - Intergenic
911246741 1:95526204-95526226 TTGTGGTAGAATTAAGAGATGGG + Intergenic
912067108 1:105757612-105757634 TTGGGGAAGAAGTATGTGGTTGG + Intergenic
912424005 1:109569838-109569860 TAGGGTAGGATTAATGAGATAGG + Intronic
912687136 1:111776426-111776448 TTTGGGAATAATAATTAGAATGG - Intronic
915062046 1:153194346-153194368 TTGGTGGAGAATAATTTGATGGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917508613 1:175650944-175650966 GTGGGGGGGAGTAATGAGATGGG - Intronic
917508650 1:175651068-175651090 GTGGGGGGGAGTAATGAGATGGG - Intronic
918662777 1:187109504-187109526 ATGGGAAAGCATAAGGAGATAGG - Intergenic
918695204 1:187537596-187537618 TAGGGGAAAAATTATGACATTGG - Intergenic
918783375 1:188731914-188731936 TTGGGGAAGACTTATGAGGATGG - Intergenic
919543793 1:198885819-198885841 TATGGGAAGAAAAATGAAATGGG + Intergenic
919861343 1:201740940-201740962 TGGGGTGAGAATAGTGAGATGGG - Intronic
920867310 1:209763636-209763658 TGTGGAAAGAAAAATGAGATGGG - Intronic
920870429 1:209789700-209789722 TTGGGGAAGAATGGCCAGATGGG - Exonic
921115792 1:212089851-212089873 TTGGGGAAGAAGGAAGAGCTGGG - Intronic
921488552 1:215745801-215745823 TTGGGGAAAAATGACAAGATAGG + Intronic
921519288 1:216139790-216139812 ATTGGGAAGAATGAAGAGATAGG - Intronic
923267372 1:232327768-232327790 TTGGGGAACAATAAGGAGGGAGG - Intergenic
923546027 1:234923825-234923847 CTGGGGATGAGGAATGAGATGGG - Intergenic
1063233477 10:4088717-4088739 TTAGGGAAGAATGCTGAGAGAGG + Intergenic
1065311546 10:24420940-24420962 TTGAGGAATAATAATAAGAGGGG - Intronic
1066025623 10:31356762-31356784 TAGGGAAATAATAATGAGACTGG + Intronic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1067910176 10:50338650-50338672 TTGTGGAAGGGTAATGAGAAGGG - Intronic
1068416650 10:56732845-56732867 TTGGGCAAGGATCATGACATTGG - Intergenic
1069536513 10:69257621-69257643 TTGAGGAAGGATAATGACACAGG + Intronic
1069704509 10:70449702-70449724 TTGAAGAAGGACAATGAGATGGG - Intergenic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1069939031 10:71940812-71940834 TTGGGGAAGAGGAAGGAGAGAGG + Intergenic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1071780532 10:88839515-88839537 TTGGAGATGAACCATGAGATGGG - Intronic
1072763154 10:98074969-98074991 ATGGGGAATTATAATGATATAGG - Intergenic
1074871858 10:117583231-117583253 TTGGGGAAGAATCATAAGGAAGG - Intergenic
1075016237 10:118911898-118911920 TTGGGGGAAAATAAAGAGTTCGG - Intergenic
1077471641 11:2764885-2764907 TTTGGGAAGACTGATCAGATGGG - Intronic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081493886 11:43586971-43586993 GGGAGGAAGAAAAATGAGATGGG + Intronic
1082899706 11:58233982-58234004 TTGTGGAAAAATAAGCAGATTGG + Intergenic
1084677819 11:70646572-70646594 TTTGGGAAGAAGGATCAGATAGG + Intronic
1085753313 11:79182143-79182165 TTGGAGAAGAATAAAGACAGAGG + Intronic
1087984365 11:104659027-104659049 TTGGGAAAGTATAATAATATAGG + Intergenic
1089822355 11:121240098-121240120 GTTGGGAAGAATGCTGAGATGGG + Intergenic
1091161742 11:133428890-133428912 TTAAGGAAGAATAATAAGAAAGG + Intronic
1091229615 11:133979667-133979689 TTGGGTAACAATAATGACTTAGG - Intergenic
1092160984 12:6315505-6315527 TTGGGGAATGATAATTAGAATGG - Intronic
1093040065 12:14368312-14368334 TTTTAGAAGAATAATGAAATGGG - Intronic
1093711848 12:22336290-22336312 TTGAGGAAGAAAAATGGGAATGG - Intronic
1094152581 12:27301805-27301827 TTGGGAAATATTAATGATATTGG + Intronic
1094590976 12:31820229-31820251 TTGTGGAAAAATAATGCTATAGG + Intergenic
1095240353 12:39851313-39851335 TTTGTGAAGACTAATGAGAATGG + Intronic
1097336647 12:58391082-58391104 TTTGGGATGGATTATGAGATGGG - Intergenic
1097539866 12:60927447-60927469 TTGGGGAAGAATGTTGAAAAAGG + Intergenic
1097761206 12:63466624-63466646 TTTGGAAAAATTAATGAGATAGG - Intergenic
1097805502 12:63960669-63960691 TAGGTGAAGAATCTTGAGATAGG + Intronic
1098656984 12:73044504-73044526 TTGTGGAATCATGATGAGATAGG + Intergenic
1101821547 12:108188139-108188161 TTGGGGAAGATAAATGAAAATGG + Intronic
1102830215 12:115991373-115991395 TTTGGGAAGAATTCTGATATTGG - Exonic
1103802253 12:123546231-123546253 TTTGGGGAGAATAAAAAGATGGG - Intergenic
1105829286 13:24149899-24149921 TTGGGGAGGAACACAGAGATGGG + Intronic
1106362186 13:29041153-29041175 ATTGGCAAGAATAATGAAATTGG - Intronic
1106773282 13:32983749-32983771 TAGGGGATGAATCATGAGTTTGG - Intergenic
1108546258 13:51497983-51498005 CTGGGGAAAAATAATGACTTGGG + Intergenic
1109704178 13:66067743-66067765 TTGTTGATGAATAATGAGAGAGG + Intergenic
1109937659 13:69312799-69312821 GTGGGCAAGAATAATTAGACAGG + Intergenic
1111117912 13:83804918-83804940 TTGAGGAAGAATAAAGGGGTGGG + Intergenic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1113226665 13:108167497-108167519 TAGAGGAAGAATATTTAGATTGG - Intergenic
1115461495 14:33666034-33666056 CTTGAGAAGAAAAATGAGATAGG + Intronic
1116276392 14:42839058-42839080 TAAGGGAAGAATCATGAGAAAGG + Intergenic
1117239866 14:53819383-53819405 TTGCTGAAGAATAAAGAGCTGGG - Intergenic
1117260287 14:54025832-54025854 TGGTGGCAGAATAATGATATTGG - Intergenic
1118893530 14:69927936-69927958 TTGAGGAAGAATAAACAGAGGGG + Intronic
1119371264 14:74146105-74146127 TTGGGAAAAAATAATGAAAGGGG - Intronic
1119437548 14:74607672-74607694 TTGCAGAAGAATAATGAAATAGG + Intronic
1120080134 14:80206851-80206873 TTGCGGAAGAGTAATTAGGTCGG + Intronic
1120103189 14:80467194-80467216 TAGGGGAAGAATAATAACAGTGG - Intergenic
1120848172 14:89144593-89144615 TAGAGGAAGAATAATGGGATTGG - Intronic
1121538869 14:94710585-94710607 TTGGTGAAGATTAATGAGGCGGG - Intergenic
1126811495 15:52410409-52410431 TTTGGGAAGTATATTGAGATTGG - Exonic
1127067934 15:55259699-55259721 TAAGGGAAAAATAATGAAATTGG - Intronic
1127449441 15:59102476-59102498 TTGGGGACGAATAATCAGTGTGG - Intergenic
1127451945 15:59125009-59125031 TTGAGGAAAAATAAAGCGATTGG + Exonic
1128194834 15:65743276-65743298 TATGGGGAGAATAAAGAGATTGG - Intronic
1129430895 15:75501114-75501136 GTTGGGGAAAATAATGAGATAGG - Intronic
1129667357 15:77587048-77587070 TTTGGCAAAAATCATGAGATGGG + Intergenic
1129928742 15:79390126-79390148 TTAGGGAAGAATGGTGAGAGTGG + Intronic
1130622398 15:85477323-85477345 TTGGGGAAGAAGAATGATCTGGG + Intronic
1132437442 15:101820418-101820440 TTGGGAAACAAAAATGTGATTGG + Intergenic
1133114422 16:3568358-3568380 TTGGGGCAGCATAAGGAGACTGG - Intronic
1134598649 16:15515840-15515862 ATGGGGAAAAATAACAAGATGGG + Intronic
1134869849 16:17642238-17642260 TAGGGGAAGAGAAATGAAATGGG + Intergenic
1135231559 16:20713041-20713063 TTGGGAAAGAATTTTGGGATTGG - Intronic
1135375964 16:21947761-21947783 TAAGGGAAGAATCATGAGAAAGG - Intergenic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1138470123 16:57227958-57227980 TTGGGGTAGCAAAATGAGAGAGG - Intronic
1138477517 16:57280846-57280868 TCTGTGAAGAATACTGAGATTGG + Intronic
1140951866 16:79825894-79825916 ATGGGGTGGAATCATGAGATTGG + Intergenic
1141803847 16:86329632-86329654 CTGGGGAAGACCAATGTGATGGG + Intergenic
1143873461 17:9974445-9974467 TGGGGGAAGAAAAATGAAATTGG + Intronic
1144516230 17:15919142-15919164 TTGGGGAAGGAAACTGTGATGGG + Intergenic
1145177087 17:20710115-20710137 TTGGGGGAGGGGAATGAGATAGG - Intergenic
1145982714 17:29023330-29023352 TTGGGGAAGAATAATGAGATTGG + Intronic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1148883470 17:50752217-50752239 TTTTGGAAGAATACTGAGAACGG + Exonic
1149841434 17:59968410-59968432 TTCAAGAAGAAGAATGAGATTGG + Intronic
1152288903 17:79427673-79427695 TTGGGGAAACATCCTGAGATAGG + Intronic
1155418180 18:25624259-25624281 CTGGAGAAGAATAATAAAATAGG + Intergenic
1155438403 18:25836333-25836355 TTGGAGAAGAGTAAGGAGATGGG + Intergenic
1155617016 18:27734124-27734146 TTAGGGAAAGAAAATGAGATAGG + Intergenic
1156413693 18:36864046-36864068 GTGAGTAAGAATAATGAGAGAGG + Intronic
1156574113 18:38293919-38293941 TTGGAGAAGATTACTGAAATAGG - Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1156728050 18:40153908-40153930 TTGGGGTAGAAAGATGAGAGAGG + Intergenic
1157097209 18:44696857-44696879 TTTAGAAAGAATACTGAGATAGG - Intronic
1157598558 18:48878632-48878654 GTGGGGAACAATACTGAGAAAGG + Intergenic
1158323451 18:56289048-56289070 GTGGGGAAGGATAAACAGATGGG + Intergenic
1158391630 18:57049855-57049877 TTGGGGAGGAGAAATGATATGGG - Intergenic
1158761918 18:60400271-60400293 TTGGGCAAGAAGAATGTGATGGG + Intergenic
1159024546 18:63170634-63170656 TTGCAGAAGGATAATGAAATGGG - Intronic
1163965288 19:20740975-20740997 TTGTAGAAGAATAATAAAATTGG - Intronic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1168214707 19:54917038-54917060 TGGGGGAGCAATAATGAGAAGGG - Intergenic
1168303518 19:55420525-55420547 TGTGAGAAGAATAATGAGTTTGG + Intergenic
925491529 2:4400348-4400370 TTTGGGATAAATAATTAGATTGG + Intergenic
925624043 2:5824475-5824497 TTGGAGAAGAGTAGAGAGATGGG - Intergenic
927268411 2:21179583-21179605 GTGTGGGAAAATAATGAGATTGG + Intergenic
927292841 2:21421608-21421630 TTGGGGAAGGATGAGGAGATGGG - Intergenic
928003631 2:27543566-27543588 TTGGGGAGGAAAAATGATACTGG - Intronic
929687293 2:44045707-44045729 TTGGGGAATAATATTGTTATGGG + Intergenic
930044792 2:47160036-47160058 GTGGGGAAGCATATGGAGATGGG - Intronic
930806256 2:55493530-55493552 TTGGGAAAAAATAATGGGTTTGG - Intergenic
931435789 2:62245065-62245087 TTGGCAAAGAATAATTAGAAGGG + Intergenic
931467500 2:62504408-62504430 TTGGGAAAGAATAATAAATTGGG + Intronic
931674770 2:64683366-64683388 TTGGAGAAAAAGAAAGAGATAGG + Intronic
932178975 2:69628346-69628368 TTTGGGAGGGAGAATGAGATTGG - Intronic
932843907 2:75115284-75115306 ATGGGGGAAAATAATGAGAATGG - Intronic
932891839 2:75604266-75604288 CTGGGGAAAAAAAGTGAGATGGG - Intergenic
933352632 2:81174613-81174635 TTGGGGAAGACTTTTCAGATAGG - Intergenic
933594729 2:84271963-84271985 TCAGGGAAAAATAAGGAGATAGG - Intergenic
935794749 2:106630282-106630304 TTGGGGAATATTAATGAGATGGG + Intergenic
936105823 2:109623626-109623648 ATTGGGAAGAATAATCAGAGTGG - Intergenic
936628190 2:114171407-114171429 CTGGGTAAAAATAATGAAATGGG - Intergenic
937113775 2:119388493-119388515 TTGGGGAAGCATACTGACATCGG - Intergenic
937336340 2:121064582-121064604 TTGGGGGAGACTAATGAGGTTGG + Intergenic
937379081 2:121359997-121360019 TTTGGGAAGATGGATGAGATAGG - Intronic
937688924 2:124731676-124731698 TTGGGTAAGAAAAATCATATAGG + Intronic
938991116 2:136631033-136631055 TTGGGGAAGTATATCGAGTTAGG + Intergenic
939164787 2:138628763-138628785 TTTGGGAAGACAAATGAGAAGGG - Intergenic
939201385 2:139039729-139039751 TTAGGTAAGAAGAAGGAGATAGG + Intergenic
939219860 2:139287890-139287912 TCTGGGAAGAATAATAAGAATGG - Intergenic
939481254 2:142749805-142749827 TTTGAAAAGACTAATGAGATAGG - Intergenic
939535073 2:143417414-143417436 TGGGGGAAGTAAAATGAGAGGGG + Intronic
939588119 2:144030220-144030242 TTGGGAAAGAAGATTTAGATGGG - Intronic
939728242 2:145750451-145750473 TTTGGTAAGAATATTGTGATAGG + Intergenic
939900182 2:147842186-147842208 TTTGGGAAGGAAAATGAGAAAGG - Intergenic
940004751 2:149000145-149000167 CAGGGGAAAAATAATGAGATGGG - Intronic
940127273 2:150340649-150340671 TTGGGGAAGTAAAAAGAGACAGG - Intergenic
940540733 2:155012728-155012750 TTGAAGGAGAATAATGACATTGG + Intergenic
942247599 2:174022258-174022280 TTGGTGAAGACTAAGGAGACAGG + Intergenic
942719956 2:178940212-178940234 TTAGGAAAGAATAAAGAAATGGG + Intronic
942850065 2:180473845-180473867 TTGGGAAAGAATACCAAGATGGG - Intergenic
944143301 2:196480068-196480090 TTGGGGAAGAATATACAGATTGG - Intronic
946196410 2:218035058-218035080 CTGGGGCAGAATGGTGAGATGGG - Intronic
946200668 2:218069112-218069134 CTGGGGCAGAATGGTGAGATGGG - Intronic
946595296 2:221299547-221299569 TTAGGGAAAAATAATGAAAAAGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947309356 2:228783461-228783483 TTTAGGAGGAAAAATGAGATTGG - Intergenic
1169573152 20:6927998-6928020 TTAGGGAAGACTAATCAGGTGGG + Intergenic
1169634650 20:7675796-7675818 TTTGTTAAAAATAATGAGATGGG + Intergenic
1170223872 20:13969566-13969588 TTGGCTAAGAAAAATAAGATTGG - Intronic
1170444344 20:16409819-16409841 GTGGGGAAAAATCATGAGTTTGG + Intronic
1170980689 20:21209305-21209327 TTGTGGAAAAAAAATGAGTTGGG + Intronic
1171002928 20:21433122-21433144 TTGGGGGAGAGGAATGAGAGGGG + Intergenic
1171204211 20:23266618-23266640 TTTGGGAAGGAAAGTGAGATAGG + Intergenic
1172084205 20:32366683-32366705 TTAAGGAAGAACAAGGAGATGGG - Intronic
1172292194 20:33784285-33784307 ATGGGGAAGAAGAGGGAGATGGG - Intronic
1172864867 20:38088252-38088274 TCTGGGAAGAATAATGAGGCAGG - Intronic
1173038712 20:39439013-39439035 TTGAGTAAGAATGATGAGAGTGG + Intergenic
1173638501 20:44582163-44582185 TTGGGCAGGAAGAAAGAGATGGG + Intronic
1175671159 20:60903669-60903691 CTGGGGAAGAATAATATGCTTGG - Intergenic
1176984591 21:15421358-15421380 TTGGCGAAGAAGACAGAGATTGG - Intergenic
1177875657 21:26627915-26627937 TTGGGGGAGACAAAGGAGATTGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1179359928 21:40696287-40696309 TTGGGGTCGAATAAGGAGAAGGG - Intronic
1182262981 22:29089242-29089264 TTGGGGTAGAATTAAGAGTTTGG - Intronic
1182985470 22:34712262-34712284 TTGGGGGAGCATCATGAGAAAGG - Intergenic
1183141466 22:35945018-35945040 AAGGGGAAGAATAATGAAAATGG + Intronic
950033729 3:9869127-9869149 TCCAGGAAGAATGATGAGATAGG - Intronic
951150221 3:19279533-19279555 TTGGGGCAGATGAATGAAATGGG + Intronic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
955481350 3:59393731-59393753 TTGGGGAAGGAAAATGAAAAAGG - Intergenic
955661549 3:61304772-61304794 TTGGGAAAGAAGACAGAGATTGG + Intergenic
956517058 3:70061181-70061203 TTGGGGGAGAAAAATGAATTTGG + Intergenic
957237176 3:77608539-77608561 TTGGGAAAGAATAAGGAAACTGG - Intronic
958061356 3:88485841-88485863 TTGGAGGAGACTAAAGAGATAGG + Intergenic
958487591 3:94731845-94731867 TTGGGGAAGAGGTATGAGAATGG - Intergenic
959212166 3:103399144-103399166 CTGTGGTAGAATAATGAGAATGG + Intergenic
959551316 3:107662004-107662026 TTGGGGAAGAAGAATTTGTTAGG + Intronic
959997950 3:112698950-112698972 TTGGGGAAGAAGTATGTGAATGG + Intergenic
960044882 3:113187035-113187057 TTGGGGAAGAATGAGGGGAATGG - Intergenic
960449709 3:117791255-117791277 TTTGGGAAGAATAATGCTGTTGG + Intergenic
963789800 3:149572427-149572449 TTGGGGTAGAAAAATCAGTTAGG - Intronic
963965180 3:151360362-151360384 TTGGGTAAGAAAAAGGATATTGG - Intronic
964002092 3:151787207-151787229 TAGGGGAAGGAGAAAGAGATGGG - Intergenic
965746833 3:171935127-171935149 TGGGGGAAGATGAATGAGAATGG + Intronic
967118744 3:186364165-186364187 TTGGGGAAGGGTAACGAGAGGGG + Intergenic
968010220 3:195269666-195269688 TTGGGGAAGCATGCTGAGACAGG - Intronic
969215130 4:5715675-5715697 TTTGGTAAGAATAATTAGATTGG + Intronic
969631103 4:8337560-8337582 ATGGGGAAGAATAATTTGAGTGG + Intergenic
969871349 4:10106996-10107018 TTGGGGAAGAAGAATGAGATTGG + Intronic
969942574 4:10749068-10749090 CTGGGTAAGGAAAATGAGATAGG + Intergenic
969960262 4:10938016-10938038 TTGGTAAAGAATATTGAGACAGG - Intergenic
970059747 4:12019235-12019257 TTTGGCAAGAATGATGATATTGG + Intergenic
971742381 4:30537383-30537405 TTAGTTAAGAATACTGAGATAGG + Intergenic
971840668 4:31847950-31847972 TAAGGGAAGAATCATGAGAAAGG + Intergenic
971947859 4:33304957-33304979 TTTAGGAAGAAAAATGATATGGG + Intergenic
972237887 4:37155178-37155200 TTTGGGAAGAAAACTGAGCTGGG - Intergenic
974422882 4:61700830-61700852 TTGGGGATCAAGAATGAGCTAGG + Intronic
974686009 4:65230722-65230744 CTAAGGAAGAATAATGAGACTGG - Intergenic
974695050 4:65356482-65356504 TTGGGGAAAAAAAGGGAGATGGG + Intronic
975355343 4:73396087-73396109 TTTGGGAAAAAAAATTAGATGGG + Intergenic
975621221 4:76298758-76298780 TGGGGGAGGAATAAAGAGAGAGG + Intronic
975725678 4:77289491-77289513 TTGGGTAAGAATACTGGGGTGGG - Intronic
976009812 4:80473362-80473384 TTGGGAAGGAATAATGATACTGG - Intronic
976042410 4:80903317-80903339 TTGGGGAAGGATAAAGGGAAAGG + Intronic
977796735 4:101174727-101174749 TTGGCCAAGAATAGTGAGATAGG + Intronic
978182790 4:105820934-105820956 TTTGTTAAGAATAAGGAGATAGG - Intronic
978541431 4:109820330-109820352 TTGGGGGAAGATAATGAGTTGGG + Intronic
979210949 4:118101919-118101941 TTTTGGAAGATTAATGTGATAGG + Intronic
979512878 4:121574197-121574219 TTGGGGGTGATTATTGAGATGGG - Intergenic
980367832 4:131829073-131829095 TTGGGGAAAGAGAAGGAGATTGG - Intergenic
980456056 4:133045185-133045207 TTGGGGGAGCATCATGAAATAGG + Intergenic
980475447 4:133308659-133308681 TAGGCCGAGAATAATGAGATAGG - Intergenic
980629605 4:135414921-135414943 TTGGGGAAGAGTTATGAGGATGG + Intergenic
986510591 5:8502741-8502763 TTGGGTAAGAAGAGTGTGATGGG - Intergenic
987319555 5:16755565-16755587 ATTGGGAAGAATAATGACAGTGG - Intronic
988948310 5:36230206-36230228 ATGGGGAGGAAAAATGAGGTAGG - Intronic
989081420 5:37626159-37626181 TTGAATAAGAATACTGAGATTGG + Intronic
991311630 5:65249428-65249450 TAAGGGAAGAATCATGAGAAAGG + Intronic
992095932 5:73362475-73362497 TTGGGGAAGGATCAGGAGTTTGG - Intergenic
993410722 5:87570022-87570044 TCAAGGAAGAATAATGGGATTGG + Intergenic
994773781 5:104017641-104017663 TTGGGGAAGTATTAAGAGCTGGG - Intergenic
995037503 5:107551641-107551663 GTAGGGAAGAATATGGAGATCGG - Intronic
995460423 5:112397762-112397784 ATGGGGAATAATAATCATATAGG - Intronic
995714201 5:115066140-115066162 TTGGGGAGGATTTATGAGAGTGG - Intergenic
995891523 5:116958129-116958151 TTGGGGAAAAAAAAAGAGAAAGG + Intergenic
995957326 5:117793746-117793768 TTGGGGAAGAATAAGGACTTAGG + Intergenic
997104350 5:131001851-131001873 TTGGTAAAGAATAATTAGATGGG - Intergenic
997153740 5:131528497-131528519 TTTGGTAAAAATAATGAGTTAGG - Intronic
997215947 5:132110770-132110792 TAGAGGAAGAATAATGATCTGGG + Intergenic
998230342 5:140357633-140357655 TTGGGGAAGAACAACAGGATGGG - Intergenic
998650668 5:144118120-144118142 TTGGAGGAGAAAACTGAGATGGG - Intergenic
1000294444 5:159900928-159900950 TTTGAGAAGAATAATGAAAGAGG + Intergenic
1002034141 5:176453185-176453207 ATGGGAAAGAATAAGGACATAGG + Intronic
1003706963 6:8543209-8543231 TTAGGGAAGATTAATTAGGTAGG + Intergenic
1004996600 6:21199412-21199434 CTGGGGTATATTAATGAGATGGG - Intronic
1005768515 6:29039631-29039653 TCTATGAAGAATAATGAGATTGG + Intergenic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1006282770 6:33068806-33068828 TGGGGGAAGAATGAAGAGATAGG + Intronic
1006953548 6:37845770-37845792 TTGGGAAATAATGATGAAATGGG + Intronic
1007900536 6:45407465-45407487 TTGTGGAAGAAGAATAAGAGTGG - Intronic
1008079656 6:47180652-47180674 TTGGAGAAGAGTTATGAGAATGG - Intergenic
1008125082 6:47659018-47659040 TTGGACAAGAAGAAAGAGATGGG - Exonic
1008457465 6:51727556-51727578 TAAGGGAAGAATCATGAGAAGGG - Intronic
1009403558 6:63285417-63285439 TTGGGGAGCAATAATGTGTTTGG + Intronic
1009474154 6:64067028-64067050 GTGGGGATGAAGAATGAGATTGG - Intronic
1009541995 6:64971824-64971846 TTGTGGAAGAATTATAACATTGG + Intronic
1010857816 6:80863861-80863883 ATAGAGAAGAAAAATGAGATAGG + Intergenic
1012179574 6:96135499-96135521 ATGGTGAAGAATAATTAAATTGG - Intronic
1012351713 6:98259632-98259654 TTGGAGAAGAATCTTCAGATAGG + Intergenic
1013391100 6:109687272-109687294 CTGGGGAAGAAGCATGTGATTGG + Intronic
1014936636 6:127393204-127393226 TGTGGGCAGAATAAAGAGATGGG + Intergenic
1014947928 6:127518529-127518551 TTGGGGATGAATGATGGGGTGGG - Exonic
1016079100 6:139833961-139833983 TGGGGGCTGAAAAATGAGATCGG - Intergenic
1016807315 6:148224736-148224758 TTGGGAATGAGTAATGAGATGGG + Intergenic
1017897778 6:158696126-158696148 GTGGGGAAGTATAATAAAATAGG - Intronic
1018358960 6:163045913-163045935 TTGGGGTAGAATCATCAGTTTGG - Intronic
1018570274 6:165202781-165202803 TTGGAGAAAAAAAAAGAGATAGG + Intergenic
1020595295 7:10200214-10200236 TTGTGGAAGAATAATGAAGTGGG - Intergenic
1021422211 7:20458363-20458385 TTGTAGAAGAATAATTATATAGG + Intergenic
1021655849 7:22872978-22873000 TTGGGAAAGAGTGCTGAGATGGG - Intergenic
1021812871 7:24420608-24420630 TTTGGAAACAAAAATGAGATAGG - Intergenic
1021818486 7:24473372-24473394 TGGGGGAATAGTAATGAGAAAGG + Intergenic
1022237842 7:28479034-28479056 TTGGGAAAGTATAAAGAGGTGGG + Intronic
1022682294 7:32560441-32560463 TTAGGGATGAATAAGGAGAGTGG - Intronic
1023785308 7:43701614-43701636 TTGGGGTTCAGTAATGAGATTGG + Intronic
1024115131 7:46185513-46185535 TTGATGAAGATGAATGAGATGGG - Intergenic
1027484123 7:78738804-78738826 TGGGGGAAGAATAAAAAGAAAGG + Intronic
1027624974 7:80533532-80533554 TTGGGGAAAAATACTGAGGCAGG - Intronic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1031145275 7:117990762-117990784 GTGGGGCAGAATAGGGAGATGGG + Intergenic
1031238167 7:119203547-119203569 TTGGTGAACAACAATGACATAGG + Intergenic
1031473731 7:122197923-122197945 TTGGGTAAGAAAAAGGAAATGGG - Intergenic
1032768800 7:135026884-135026906 CTGAGGAATAAAAATGAGATGGG - Intronic
1032881079 7:136091191-136091213 TTTGGGAAGAGTGATTAGATGGG + Intergenic
1033435439 7:141329382-141329404 ATGGGAAAGAATAATGAGAATGG - Intronic
1033490501 7:141838633-141838655 TGGAGGAAGAAGAGTGAGATTGG + Intronic
1033578526 7:142710145-142710167 TAAGGGGAGAATAATGAGAAAGG + Intergenic
1034035175 7:147812148-147812170 TGGGGGAAGAACATTCAGATAGG + Intronic
1034052992 7:148002974-148002996 CTGGGGAAGAAAGATGAAATGGG + Intronic
1035629176 8:1095265-1095287 TTGGGAAAGAACAGAGAGATGGG + Intergenic
1036030058 8:4960400-4960422 GTGGGAAAGAAGAGTGAGATCGG - Intronic
1037378490 8:18258708-18258730 TGGGAGAAGGATAGTGAGATGGG + Intergenic
1040570361 8:48603412-48603434 TTTGTGAAGGATAATGTGATCGG + Intergenic
1040619811 8:49078982-49079004 TTGTGGGAGAGTGATGAGATAGG + Intergenic
1040855152 8:51941462-51941484 TTGGGGAAACATAATGAGTTTGG - Intergenic
1042201807 8:66285883-66285905 TTGGGGAATAAAGTTGAGATGGG - Intergenic
1042973783 8:74441539-74441561 TTTGAAAAGATTAATGAGATAGG + Intronic
1043273595 8:78365492-78365514 GTGGGGAAGAATCATGGGAGTGG - Intergenic
1043768974 8:84173125-84173147 TTGGGGCAGAATAGTGTGAGAGG + Intergenic
1044421488 8:92001017-92001039 TTGTGCAAGAATAAAAAGATGGG + Intronic
1044849388 8:96412934-96412956 TTATGGAAGAAGAATAAGATAGG + Intergenic
1045357221 8:101399979-101400001 TTGGTGAGGAATATTGACATTGG - Intergenic
1045560521 8:103257570-103257592 TTGGGGAAGGATTCTGAAATAGG - Intergenic
1046143748 8:110129536-110129558 ATGGGGAAGAATAATTCAATAGG + Intergenic
1046469052 8:114644212-114644234 TTGGGGAAAAATAAGTAAATAGG - Intergenic
1048573043 8:135670562-135670584 TTGGTGAAGGATTGTGAGATGGG + Intergenic
1050075039 9:1854424-1854446 TTTGAGAAGAATAATGACAGGGG - Intergenic
1050097497 9:2081971-2081993 AAGGGGAACAATGATGAGATAGG - Exonic
1050780982 9:9335275-9335297 TTATGGAAGAATGATCAGATTGG - Intronic
1050880044 9:10688190-10688212 CTGGGGAAGAACCATGACATTGG - Intergenic
1051187515 9:14475647-14475669 TTGGGGAAGGTCAAGGAGATGGG - Intergenic
1051546148 9:18278044-18278066 TAGGGGAAGAATAATTAAAGTGG - Intergenic
1051599598 9:18859420-18859442 TTAAGAAAGAATACTGAGATGGG - Intronic
1051877323 9:21806240-21806262 GTGGTGAGGAATAATCAGATTGG + Intronic
1051962870 9:22789580-22789602 TTGGCAAAGAATTCTGAGATTGG + Intergenic
1052025139 9:23565865-23565887 ATGGGGAAGAATGATTAGAAGGG + Intergenic
1052210932 9:25902470-25902492 TTGGGAAAGATTAATTAAATTGG + Intergenic
1052729805 9:32272065-32272087 TTTGGTAAGAAAAATGGGATGGG - Intergenic
1053558234 9:39160610-39160632 TTGGGTAGGAATAATGAGAGAGG - Intronic
1054138881 9:61458316-61458338 TTGGGTAGGAATAATGAGAGAGG + Intergenic
1054704930 9:68452592-68452614 TAGGGGAAGAGGAAGGAGATGGG - Intronic
1055590056 9:77802947-77802969 ATGTGGAAGAATATTGAGCTCGG - Intronic
1056461218 9:86811484-86811506 CTGGGGAAAAATAAAGATATTGG - Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058448085 9:105071463-105071485 TAAGTGAAGAAAAATGAGATGGG - Intergenic
1058766083 9:108184086-108184108 GTGGGGAAGAGTAATGAGGCCGG - Intergenic
1058936485 9:109773977-109773999 TGGGGAATGAATAATGAAATTGG - Intronic
1059369862 9:113820080-113820102 TTGAAGAAAAATAATGAAATGGG + Intergenic
1059709534 9:116854953-116854975 TGGGGGGGGAATAATGAGAAGGG - Intronic
1060394135 9:123303776-123303798 TTGGGGAAGAATAAGAAGGTTGG - Intergenic
1061010158 9:127949958-127949980 TTGGGGAAGAGTTAGGAGCTGGG + Intronic
1185757441 X:2662901-2662923 TAGGGGAAGAATCATGGGAAAGG + Intergenic
1185830687 X:3300104-3300126 TTGAGGAAGAAAAAAGACATTGG + Intergenic
1187146157 X:16639189-16639211 TTTGGGAGGAACAATGAGACTGG - Exonic
1187465113 X:19519998-19520020 ATGTGGAAGAATAATTAAATTGG - Intergenic
1187580187 X:20599178-20599200 TTGGGGAAGTGTAGTGATATTGG + Intergenic
1189208773 X:39265163-39265185 TGGTGGAAAAAGAATGAGATAGG - Intergenic
1190369672 X:49728393-49728415 TTGAAGAAGAATGATGAGAGTGG + Intergenic
1190393095 X:49952161-49952183 ATGGGGAAGAATAAAGAAAGGGG + Intronic
1191790336 X:64965229-64965251 CTGAGGAAGAATAATGAAGTTGG + Intronic
1192198681 X:69049575-69049597 TGGGGGAAAAATAAGGTGATAGG - Intergenic
1192829310 X:74734227-74734249 TTGGGGAAGAAGAAAAAAATGGG + Exonic
1193231596 X:79053245-79053267 TTGGGAAACAATAATAGGATGGG + Intergenic
1193518705 X:82502863-82502885 TTAGGGAAGAATCATGGGAATGG + Intergenic
1193835097 X:86333656-86333678 TTGAGGGAAAGTAATGAGATAGG + Intronic
1195345161 X:103942558-103942580 TTGAGGAATAAGAATGAGGTGGG - Intronic
1195603934 X:106780625-106780647 TTTGGGAAGAATTTTAAGATTGG + Intronic
1197769639 X:130081992-130082014 TTGGGGAAGAATCGTGTGAGGGG + Intronic
1199322897 X:146462371-146462393 TAAGGGAAGAATCATGAGAAAGG - Intergenic
1202048037 Y:20753709-20753731 TTGGGGGAGAATAATAAAAAAGG + Intergenic
1202173842 Y:22079554-22079576 TAGGGGAAGAATCATGGGAAAGG - Intronic
1202217518 Y:22506828-22506850 TAGGGGAAGAATCATGGGAAAGG + Intronic
1202325667 Y:23689231-23689253 TAGGGGAAGAATCATGGGAAAGG - Intergenic
1202545104 Y:25980823-25980845 TAGGGGAAGAATCATGGGAAAGG + Intergenic