ID: 1145985431

View in Genome Browser
Species Human (GRCh38)
Location 17:29042880-29042902
Sequence CTCATTATGATCTTTGTCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145985431_1145985436 -1 Left 1145985431 17:29042880-29042902 CCTGAGACAAAGATCATAATGAG 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1145985436 17:29042902-29042924 GACAGGAAGGTGGCAAAGGAAGG 0: 1
1: 1
2: 7
3: 82
4: 799
1145985431_1145985435 -5 Left 1145985431 17:29042880-29042902 CCTGAGACAAAGATCATAATGAG 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1145985435 17:29042898-29042920 ATGAGACAGGAAGGTGGCAAAGG 0: 1
1: 0
2: 5
3: 57
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145985431 Original CRISPR CTCATTATGATCTTTGTCTC AGG (reversed) Exonic
901145544 1:7062286-7062308 CACAATATTATCTATGTCTCAGG - Intronic
906327676 1:44858012-44858034 CTCATAACGATCTTTCTCTAAGG + Intronic
906578858 1:46917769-46917791 GTGATTATGACCTTTGTCTTTGG + Intergenic
908369842 1:63470713-63470735 ATCATTATGGTATTTGTCTTTGG + Intronic
912877678 1:113378568-113378590 CACATAGTGATCTTTGTGTCAGG + Intergenic
915641676 1:157232335-157232357 CCCAGTTTGATCTTTGACTCAGG + Intergenic
919363979 1:196633420-196633442 GTCATCATGATCTTTGTCTTTGG - Intergenic
920865703 1:209751581-209751603 GTCATTATGATATTTAACTCAGG + Intergenic
921098099 1:211904350-211904372 CTAATTATTTTCTTTATCTCTGG + Intergenic
923676452 1:236084677-236084699 TTTACTATGATCCTTGTCTCAGG - Intergenic
924413139 1:243827943-243827965 TTCATTATGATATTTCTCTTTGG - Intronic
1062816203 10:502502-502524 CTCATTATGATGTCTTTTTCTGG - Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1065894566 10:30152022-30152044 GAGATTATGATCTTTGTCTTTGG + Intergenic
1067678260 10:48406194-48406216 CTAAGTTTAATCTTTGTCTCTGG - Intronic
1071439110 10:85674842-85674864 CTCACTATGTCCTTTATCTCAGG + Intronic
1074734583 10:116416194-116416216 GTTATTATGACCTTTTTCTCTGG + Intergenic
1076317659 10:129553939-129553961 CTCATGCTGCTCTTTGTATCAGG - Intronic
1077732307 11:4745228-4745250 TTCGTTTTGATCTTTGTCTGTGG - Intronic
1078081227 11:8206128-8206150 CTCAGTGCGGTCTTTGTCTCAGG - Intergenic
1079576440 11:22009105-22009127 ATCTTTATGATCTTTGACTCTGG + Intergenic
1090265933 11:125352931-125352953 CTCCTTCTGAACTTTGTCTCGGG - Intronic
1092023878 12:5224647-5224669 CTCATTATGAGCTTTGTTCCAGG - Intergenic
1092814221 12:12298944-12298966 TACAATATGATCTTTGTGTCTGG + Intergenic
1092931203 12:13317555-13317577 GTAATTATAATATTTGTCTCTGG + Intergenic
1093502804 12:19831792-19831814 ACCATTATGTTCTTTGTCCCAGG + Intergenic
1093743591 12:22714978-22715000 CTGGTTATAAGCTTTGTCTCTGG + Intergenic
1094169161 12:27473406-27473428 CTCATTAGGATGTTTGTCATTGG + Intronic
1099350739 12:81565596-81565618 CTCATTAAAATATTTTTCTCAGG - Intronic
1100143181 12:91643900-91643922 CTCATTATTTTCAGTGTCTCTGG + Intergenic
1103295827 12:119886062-119886084 CTCGTTAAAAGCTTTGTCTCAGG - Intergenic
1105729372 13:23197050-23197072 CTTATTATGATCTGTGTGTATGG + Intronic
1105934475 13:25086408-25086430 CTCATTATGATCTTGGGTACAGG - Intergenic
1106300744 13:28462613-28462635 ATCATTATCATCATTCTCTCTGG - Intronic
1106749188 13:32741131-32741153 CTCACTTTGACCATTGTCTCAGG - Exonic
1107429980 13:40331936-40331958 CTCATTTTGATCTTTGACCTTGG + Intergenic
1109483573 13:62989291-62989313 CTTAATATGTTCTTTTTCTCCGG - Intergenic
1111461995 13:88557108-88557130 GTCATCATGATCCTTTTCTCTGG - Intergenic
1111893523 13:94113075-94113097 TTCATTAAGAACTTTTTCTCAGG + Intronic
1111905997 13:94256777-94256799 GTCATCAAGATCTCTGTCTCTGG - Intronic
1112749652 13:102569046-102569068 GTCATTATGATTTTTATCTCAGG + Intergenic
1113883405 13:113642497-113642519 CTCATTATGATCCTTGCATTTGG - Intergenic
1113897344 13:113774256-113774278 CCCATTATCATGTTAGTCTCCGG + Intronic
1114683898 14:24509513-24509535 CTCACTATGCCCTTGGTCTCAGG + Intergenic
1115450684 14:33543748-33543770 ATCATTCTGCTCTATGTCTCAGG + Intronic
1115803852 14:37029059-37029081 CACATTATGATCTTTCTTTGGGG + Intronic
1118747095 14:68782137-68782159 CTCAATATGACCTTTGTCTAGGG + Intergenic
1118886748 14:69873616-69873638 CTTATTCTGCTCTTTGTTTCTGG + Intronic
1119674950 14:76546658-76546680 CTCTGTATGATTTTTGTCCCCGG - Intergenic
1120400314 14:84022885-84022907 GAGATTATGATCTTTGTCTTTGG + Intergenic
1122748106 14:103911798-103911820 CTGTTTATCATCTGTGTCTCTGG - Intergenic
1126269446 15:46797386-46797408 CTCGTTTTGATCTTTAGCTCAGG - Intergenic
1128225477 15:65998539-65998561 CTCATTGTTATTTATGTCTCTGG + Intronic
1128838775 15:70832604-70832626 CTCGTCATGATTTTTGTCTTTGG + Exonic
1129787045 15:78316431-78316453 CACATTAAGCCCTTTGTCTCTGG + Intergenic
1131345309 15:91642180-91642202 CTCATTCTGATTTTTTTTTCTGG + Intergenic
1131590219 15:93740642-93740664 CTCCTTGGGATCTTTGTCCCAGG + Intergenic
1131755091 15:95550833-95550855 TTCATTATGATCCGTGTCACTGG - Intergenic
1135956413 16:26959968-26959990 CTCCTCTTCATCTTTGTCTCTGG + Intergenic
1139098720 16:63738114-63738136 CACAATATTATCTTTGTCTTGGG - Intergenic
1145985431 17:29042880-29042902 CTCATTATGATCTTTGTCTCAGG - Exonic
1148237556 17:45979143-45979165 CTTATTATGATTTTCTTCTCAGG + Intronic
1149418256 17:56482959-56482981 TTCATTATTATTTTTTTCTCTGG - Intronic
1153417852 18:4869140-4869162 TTCATTATTATGTTTGTTTCAGG + Intergenic
1153552733 18:6279148-6279170 CTCATTTTGCACTTTTTCTCTGG - Intronic
1156294706 18:35778862-35778884 CTCTTGATGATCTTTGACTGAGG - Intergenic
1157774963 18:50386330-50386352 ATAATCATGATCTTTGCCTCAGG - Intronic
1158207039 18:55004818-55004840 GTCATTATGGCCTTTTTCTCTGG - Intergenic
1158411012 18:57206219-57206241 GTGATTATGAGCTGTGTCTCTGG + Intergenic
1158706373 18:59795935-59795957 CTCACTGTGACCTTGGTCTCTGG - Intergenic
1159432698 18:68375591-68375613 GCCATAATGATCTTTGTGTCTGG + Intergenic
1161383298 19:3977726-3977748 CCCATTAGGGTCTCTGTCTCGGG + Intronic
1162676974 19:12306471-12306493 TTCATTTAGATCTTTCTCTCAGG + Intergenic
1163891831 19:20023420-20023442 CTCACTGTAATCTTTGCCTCCGG - Intronic
1166347960 19:42178036-42178058 CTCCTTTTCCTCTTTGTCTCTGG - Intronic
1202647584 1_KI270706v1_random:156627-156649 ATTATTATGATCTCTGTCTTAGG + Intergenic
925230776 2:2232074-2232096 CTCATTGTGTTCTCTGTCGCAGG - Intronic
925279516 2:2672967-2672989 CTGATTTTGTTCTTTGTCGCTGG + Intergenic
925652305 2:6104227-6104249 GAGATTATGATCTTTGTCTTTGG + Intergenic
926169018 2:10539373-10539395 AAAATTCTGATCTTTGTCTCCGG + Intergenic
927071618 2:19536495-19536517 GAGATTATGATCTTTGTCTCTGG - Intergenic
931054965 2:58459218-58459240 CTACTTAGGATCTCTGTCTCAGG - Intergenic
936159435 2:110072496-110072518 CTCAATATGGTTTTTGTCTTTGG + Intergenic
936185226 2:110298836-110298858 CTCAATATGGTTTTTGTCTTTGG - Intergenic
938547881 2:132352089-132352111 ATTATTATGATCTCTGTCTTAGG + Intergenic
939396236 2:141633126-141633148 CTAATTATCATCTTATTCTCAGG - Intronic
941442880 2:165560127-165560149 CTAATTGTAATCTTTGTCTTTGG - Intronic
942003100 2:171669997-171670019 TTCAATATTATCTTTATCTCTGG + Intergenic
944026907 2:195181345-195181367 CAAATTATGATCTTTGTTTATGG - Intergenic
946004751 2:216514128-216514150 TTTATTATGCTCTTTTTCTCTGG - Intronic
946324285 2:218976214-218976236 CCCATTATGATGTCTGTCTATGG + Intergenic
947931247 2:233967000-233967022 ATAATTATGAGCTGTGTCTCTGG + Intronic
948131454 2:235603455-235603477 CCCATTCTGATCTTGGTGTCTGG - Intronic
1168731372 20:84416-84438 CTCTTTATGATCTCTGACTTTGG + Intergenic
1168758792 20:334418-334440 CTCATTATGTTCGTGGACTCTGG - Intergenic
1170586833 20:17741205-17741227 TTCACTGAGATCTTTGTCTCAGG - Intergenic
1171496555 20:25560318-25560340 CTCATTATAACCTTGCTCTCTGG - Intronic
1173276187 20:41585779-41585801 CTTGTTTTGATCTTTGTCTTTGG - Intronic
1176604277 21:8816133-8816155 ATTATTATGATCTCTGTCTTAGG - Intergenic
1180233571 21:46442930-46442952 CTCACTCACATCTTTGTCTCGGG + Intronic
1180346567 22:11707740-11707762 ATTATTATGATCTCTGTCTTAGG - Intergenic
1180354334 22:11825864-11825886 ATTATTATGATCTCTGTCTTAGG - Intergenic
1180383919 22:12166491-12166513 ATTATTATGATCTCTGTCTTAGG + Intergenic
1181473197 22:23153324-23153346 CTCATTTTGGTCATTGGCTCTGG + Intronic
1181496498 22:23290162-23290184 CTCATCATGATTTCTGTCTTGGG - Intronic
1182259785 22:29065243-29065265 TTTGATATGATCTTTGTCTCAGG + Intergenic
949418549 3:3839283-3839305 CTCTTTATGATCTTTGACAAGGG - Intronic
950393330 3:12714163-12714185 CTCACTGCGATCTTTGCCTCTGG + Intergenic
950619962 3:14197046-14197068 CTTAATCTGATCTTTGCCTCAGG + Intronic
953934458 3:47028188-47028210 CTCATTTTGTCCCTTGTCTCAGG - Intronic
955837047 3:63067521-63067543 CTCACTTTGATCTTTGGCTCAGG + Intergenic
957869013 3:86063893-86063915 CTCAATCTGATCTTTGTCATAGG + Intronic
958490058 3:94761325-94761347 CTTATTATGAACTATCTCTCAGG + Intergenic
958507294 3:94996362-94996384 CTCCTTAGTCTCTTTGTCTCTGG - Intergenic
958787399 3:98612948-98612970 CAGATTATGTTCTTTATCTCTGG + Intergenic
959361769 3:105402812-105402834 GAGATTATGATCTTTGTCTTTGG - Intronic
960039700 3:113138196-113138218 TTCAGCATGATCTTTATCTCTGG - Intergenic
960945671 3:122964767-122964789 CTCACTATTCTCTTTTTCTCTGG - Intronic
961229824 3:125294839-125294861 ATCATTAGGATCTTAGTCACTGG - Intronic
962332697 3:134493646-134493668 CTCATTCTCCTCTGTGTCTCTGG + Intronic
962913146 3:139873419-139873441 CTCAATATGTTGTTTGCCTCTGG - Intergenic
963067529 3:141275217-141275239 CTCATTCTGATCTTTATCTGTGG + Intronic
963315557 3:143754711-143754733 ATCATCATGGGCTTTGTCTCAGG - Intronic
963385860 3:144593585-144593607 TTCATGATGATCTTATTCTCAGG + Intergenic
963584903 3:147174968-147174990 CTCCTTGTGATTTTTGTCCCTGG + Intergenic
963932883 3:151022386-151022408 CTCATAAAGCTATTTGTCTCAGG + Intergenic
964299375 3:155271149-155271171 GTGATTATGACCTTTGTCTTTGG - Intergenic
965725025 3:171706481-171706503 TTCTTTATAACCTTTGTCTCCGG + Intronic
965986186 3:174756212-174756234 ATCATTTTGGTATTTGTCTCAGG + Intronic
966694669 3:182777740-182777762 CCCAGTATGAGCTTTCTCTCTGG + Intergenic
968686068 4:1959672-1959694 GTCTTGATGATCTTGGTCTCTGG - Exonic
969844539 4:9909919-9909941 CGCATTTTGCTCTTTGTTTCTGG + Intronic
970117083 4:12709399-12709421 CTTATTCTGATCTTTGCCACCGG - Intergenic
970556488 4:17238798-17238820 AGCAATATGATCTTTGGCTCAGG - Intergenic
970746590 4:19305351-19305373 TTCATTATGGTCTTTGGCTCTGG + Intergenic
971169833 4:24222090-24222112 ATCATCATGATGTTTGACTCTGG + Intergenic
971793998 4:31203253-31203275 CTTTTGATGGTCTTTGTCTCTGG - Intergenic
973301128 4:48585948-48585970 ATCATTATGATCTTTGTAATGGG - Intronic
973373841 4:49274816-49274838 ATTATTATGATCTCTGTCTTAGG + Intergenic
973383571 4:49335423-49335445 ATTATTATGATCTCTGTCTTAGG - Intergenic
973387176 4:49520437-49520459 ATTATTATGATCTCTGTCTTAGG - Intergenic
977131031 4:93237343-93237365 CTCATCATGAACTTTGCATCAGG + Intronic
977266417 4:94861417-94861439 CTCAGTATGATGTTTGTATTTGG + Intronic
977700766 4:100020297-100020319 CTCATTATGATGGTTGGCTCAGG - Intergenic
977976100 4:103268749-103268771 GAGATTATGATCTTTGTCTTTGG + Intergenic
978646570 4:110939918-110939940 CCCACTATTATCTTTCTCTCTGG - Intergenic
979459099 4:120959877-120959899 CTTATTATTATGTTTCTCTCAGG - Intergenic
981863466 4:149384889-149384911 CTCATTATTATCTATTTCTGTGG + Intergenic
987474871 5:18378707-18378729 GGAATTATGATCTTTGCCTCAGG - Intergenic
987962223 5:24824673-24824695 GGCATTCTGATCTTGGTCTCAGG + Intergenic
988254662 5:28806830-28806852 CTCCATATTATCTCTGTCTCTGG - Intergenic
988263301 5:28919046-28919068 CTTATTATTATTTTTCTCTCTGG - Intergenic
991920198 5:71649075-71649097 CTCTTTCTGATCTTTCTCTCAGG + Exonic
992664631 5:78995096-78995118 CTCATTATTACCTTTCTCTCAGG + Intergenic
995925833 5:117372243-117372265 CTCATTCTGATTTTAGTCTTAGG + Intergenic
999000476 5:147916262-147916284 CTCATTCTGATTTTGGCCTCAGG - Intergenic
999016472 5:148111820-148111842 CTCAATAGGATCATTCTCTCTGG - Exonic
1007237192 6:40399192-40399214 CACATTAGGATCTTAGTCACTGG + Intronic
1008404176 6:51100439-51100461 TTCATGGTGATCTCTGTCTCAGG - Intergenic
1009891322 6:69686773-69686795 CTCATTATGATCTGTATCACAGG + Intronic
1009992154 6:70856837-70856859 CTTATTTTGGTGTTTGTCTCAGG + Exonic
1010767630 6:79794454-79794476 CTCAGTATTATCTTTGTTGCTGG - Intergenic
1011240713 6:85268445-85268467 CTAACTTTGACCTTTGTCTCTGG - Intergenic
1012103718 6:95125656-95125678 TTCATTATCATCTTTTTATCTGG - Intergenic
1012855762 6:104499328-104499350 CTCATTCTGTTATTTGTTTCAGG - Intergenic
1015780754 6:136863048-136863070 CTCATTATAATCACTGTCTGTGG - Intronic
1017336649 6:153268874-153268896 CTCAGTGTGATCTCTCTCTCTGG - Intergenic
1017426161 6:154323556-154323578 TGCATTACTATCTTTGTCTCAGG + Intronic
1017820658 6:158046833-158046855 CTATTTATGATCTGTGTCTGTGG + Intronic
1020614794 7:10444863-10444885 ATAATTATTTTCTTTGTCTCTGG - Intergenic
1021887300 7:25152148-25152170 CTCTTTCTGATCTTTTTTTCTGG + Intronic
1022231243 7:28415008-28415030 CTGATTCTGATCTATTTCTCAGG - Intronic
1022271536 7:28812518-28812540 CTCAGTAGGATCTTTTTTTCTGG - Intronic
1023311855 7:38895661-38895683 CTGATGATGTTCTTTGTTTCTGG + Intronic
1023560032 7:41464279-41464301 CTAATTATGCCCTTTGTCCCTGG - Intergenic
1026155293 7:67820886-67820908 ATCATTATGCTCTTGGTTTCTGG + Intergenic
1026391280 7:69905020-69905042 CTCATTATTATATTAGTGTCAGG - Intronic
1026762954 7:73140248-73140270 CTCGTTAAGATCATGGTCTCTGG - Intergenic
1027039419 7:74950036-74950058 CTCGTTAAGATCATGGTCTCTGG - Intergenic
1027084222 7:75252344-75252366 CTCGTTAAGATCATGGTCTCTGG + Intergenic
1027481478 7:78703149-78703171 CTCAATATTTTCTTTGGCTCTGG - Intronic
1027542790 7:79489154-79489176 TACATAATGATCTTAGTCTCTGG + Intergenic
1027809398 7:82874834-82874856 CTCATTTTGGTCTTTGTCATTGG - Intronic
1028062411 7:86339535-86339557 CTCATTATGATATTTGTTATAGG + Intergenic
1028305932 7:89264488-89264510 CTCACTTTGATATTTGACTCCGG + Intronic
1028641590 7:93047815-93047837 CCCACTGTGATCTTTCTCTCTGG - Intergenic
1030642005 7:112016594-112016616 CTAATCATGATGTTTGTCACAGG + Intronic
1030888675 7:114970456-114970478 CAAATAATGATCTTTGACTCTGG + Intronic
1031681289 7:124678126-124678148 CTTTTTCTGTTCTTTGTCTCAGG - Intergenic
1031881340 7:127202251-127202273 CTCACTATGATCTGCCTCTCAGG + Intronic
1032437035 7:131909125-131909147 CTGATGATGATTCTTGTCTCAGG + Intergenic
1038777727 8:30546082-30546104 GTCATTAGGATCTTTGTAGCAGG + Intronic
1041828196 8:62122562-62122584 CTCATCATGACCTTTGTACCTGG + Intergenic
1042474444 8:69231219-69231241 CTCTTAATAATCTTTGTTTCTGG - Intergenic
1042645512 8:70982252-70982274 GACATTATGACCTTTGTCTTCGG + Intergenic
1042933229 8:74033358-74033380 CTCATTATAACCATTGTCTTTGG - Intergenic
1043159875 8:76833053-76833075 CTCATCATGATTTTTGTCATTGG - Intronic
1044015209 8:87042302-87042324 CTCATTTGTATCTTTGCCTCAGG - Intronic
1045869024 8:106904344-106904366 CCCATTCTGGTCTTTGCCTCAGG - Intergenic
1046572937 8:115989553-115989575 CCATTGATGATCTTTGTCTCAGG + Intergenic
1048815290 8:138328028-138328050 CTTATTATCATTCTTGTCTCGGG + Intronic
1050717145 9:8542746-8542768 CTCCTTATCTGCTTTGTCTCAGG + Intronic
1052101467 9:24451394-24451416 CTCATTCTGAACTTTGTCTATGG - Intergenic
1054351149 9:64017578-64017600 ATTATTATGATCTCTGTCTTAGG - Intergenic
1058015846 9:100031217-100031239 CTCATTTTGTTCTATGTCTTTGG + Intronic
1059754532 9:117280466-117280488 CTCATTAGGATGCTTGTCACTGG - Intronic
1061605341 9:131705988-131706010 ATCATGATCATCTTTGGCTCTGG + Intronic
1061725893 9:132581814-132581836 CTCATTAGGAGCTTCGTCACCGG + Intergenic
1203697539 Un_GL000214v1:112789-112811 ATTATTATGATCTCTGTCTTAGG + Intergenic
1203551675 Un_KI270743v1:168230-168252 ATTATTATGATCTCTGTCTTAGG - Intergenic
1187825274 X:23329528-23329550 CCCATTATGATCAATCTCTCTGG + Intergenic
1188550033 X:31353396-31353418 CTCTTTCTGATCTCAGTCTCAGG - Intronic
1188743335 X:33811642-33811664 CTCAGTGTGAGCTTTCTCTCTGG + Intergenic
1189355921 X:40309894-40309916 CTCAATCTGATCTATTTCTCAGG - Intergenic
1191805113 X:65127589-65127611 GAGATTATGATCTTTGTCTTTGG + Intergenic
1192656593 X:73000655-73000677 CTCAGCAAGATCTCTGTCTCTGG - Intergenic
1192665527 X:73082346-73082368 CTCAGCAAGATCTCTGTCTCTGG + Intergenic
1195491170 X:105471678-105471700 CCCTTTAGGATCTTTGTCTATGG - Intronic
1196237389 X:113299321-113299343 CTCCTTTTGACCTTTGGCTCAGG - Intergenic
1197959057 X:131983919-131983941 TTCATTGAAATCTTTGTCTCAGG + Intergenic
1198664760 X:139008225-139008247 GAGATTATGATCTTTGTCTTTGG - Intronic
1198734928 X:139775101-139775123 CTCATTCTGAGTGTTGTCTCGGG + Intronic
1198988594 X:142484198-142484220 CTCATTACATTGTTTGTCTCTGG + Intergenic
1199025973 X:142938614-142938636 CTCATTATGATCTTCATTACAGG + Intergenic
1199867248 X:151863316-151863338 CTCATTTGAATCTTTGTGTCTGG - Intergenic
1201152944 Y:11103807-11103829 ATTATTATGATCTCTGTCTTAGG - Intergenic
1202096799 Y:21259744-21259766 CTCATGATGAACTCTCTCTCTGG - Intergenic