ID: 1145985977

View in Genome Browser
Species Human (GRCh38)
Location 17:29046598-29046620
Sequence TCTGTTCCATTGAGCAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145985973_1145985977 8 Left 1145985973 17:29046567-29046589 CCCTTATTGACCCATTCTGGGTC 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1145985977 17:29046598-29046620 TCTGTTCCATTGAGCAACAGTGG 0: 1
1: 0
2: 1
3: 15
4: 125
1145985975_1145985977 -2 Left 1145985975 17:29046577-29046599 CCCATTCTGGGTCAGCTGCATTC 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1145985977 17:29046598-29046620 TCTGTTCCATTGAGCAACAGTGG 0: 1
1: 0
2: 1
3: 15
4: 125
1145985976_1145985977 -3 Left 1145985976 17:29046578-29046600 CCATTCTGGGTCAGCTGCATTCT 0: 1
1: 0
2: 2
3: 13
4: 239
Right 1145985977 17:29046598-29046620 TCTGTTCCATTGAGCAACAGTGG 0: 1
1: 0
2: 1
3: 15
4: 125
1145985970_1145985977 27 Left 1145985970 17:29046548-29046570 CCTTTCAATAAGGGGCAGTCCCT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1145985977 17:29046598-29046620 TCTGTTCCATTGAGCAACAGTGG 0: 1
1: 0
2: 1
3: 15
4: 125
1145985974_1145985977 7 Left 1145985974 17:29046568-29046590 CCTTATTGACCCATTCTGGGTCA 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1145985977 17:29046598-29046620 TCTGTTCCATTGAGCAACAGTGG 0: 1
1: 0
2: 1
3: 15
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145985977 Original CRISPR TCTGTTCCATTGAGCAACAG TGG Intronic