ID: 1145986910

View in Genome Browser
Species Human (GRCh38)
Location 17:29053170-29053192
Sequence GGACCCAGGACACCCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145986910_1145986918 12 Left 1145986910 17:29053170-29053192 CCTGCTCTGGGTGTCCTGGGTCC 0: 1
1: 0
2: 2
3: 43
4: 316
Right 1145986918 17:29053205-29053227 CCAAGACCCCCCTCTGGATGAGG 0: 1
1: 0
2: 1
3: 11
4: 120
1145986910_1145986924 27 Left 1145986910 17:29053170-29053192 CCTGCTCTGGGTGTCCTGGGTCC 0: 1
1: 0
2: 2
3: 43
4: 316
Right 1145986924 17:29053220-29053242 GGATGAGGCCTTTGCCCTGCAGG 0: 1
1: 1
2: 4
3: 15
4: 246
1145986910_1145986914 6 Left 1145986910 17:29053170-29053192 CCTGCTCTGGGTGTCCTGGGTCC 0: 1
1: 0
2: 2
3: 43
4: 316
Right 1145986914 17:29053199-29053221 GCCAGCCCAAGACCCCCCTCTGG 0: 1
1: 0
2: 1
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145986910 Original CRISPR GGACCCAGGACACCCAGAGC AGG (reversed) Intronic
900108959 1:997750-997772 GGGACCAGGACCCCCAGAGTAGG + Intergenic
900112781 1:1015557-1015579 GGAGCCAGGACACCCCCTGCTGG - Intergenic
900305260 1:2003697-2003719 GGACCCAGGCCAGCCAGAGGTGG - Exonic
900578564 1:3396204-3396226 GCCCCCAGGACACCCCCAGCTGG + Intronic
901192003 1:7418140-7418162 GGACTCTGGAATCCCAGAGCGGG - Intronic
901195742 1:7438926-7438948 GCACCCAGGACTCTCAGAGATGG - Intronic
901880703 1:12192130-12192152 GGAACCAGGAGACCCAGAGATGG + Intronic
902629386 1:17695720-17695742 GGGCCCAGGACAACAAGGGCAGG + Intronic
902653909 1:17854439-17854461 GTACCCTGGACACACAGAGGAGG + Intergenic
902990250 1:20182757-20182779 AGACCAAGGACAGGCAGAGCAGG + Intergenic
903209914 1:21812148-21812170 GGAACCAGGAAACTCAGATCCGG - Intergenic
904401986 1:30262876-30262898 GGAACCAGGACACACAGAGGAGG - Intergenic
904919179 1:33993494-33993516 GGGCCCAGGAGACACAGAGTGGG - Intronic
905345138 1:37306137-37306159 GGAGCCAGGAGACCAAGGGCCGG + Intergenic
907195254 1:52681250-52681272 GGATACAGGACATTCAGAGCTGG - Intergenic
912385021 1:109267195-109267217 TGACCCAGGACACCCAGCCCAGG + Intronic
915236980 1:154491052-154491074 GGAGTCTGGACAACCAGAGCTGG + Intronic
915417494 1:155753244-155753266 GCACTGAGGCCACCCAGAGCAGG - Exonic
915601906 1:156927753-156927775 GGGCCAGGGACAGCCAGAGCAGG - Exonic
917141764 1:171841994-171842016 GGACGGAGGATGCCCAGAGCTGG - Intronic
917569097 1:176245813-176245835 TGACCCAGCAAACCCAGTGCTGG - Intergenic
918720260 1:187843347-187843369 AGAGCCAGGACATTCAGAGCTGG - Intergenic
919922922 1:202177095-202177117 GGACCCAGGATGCCCAGAGCTGG - Intergenic
920006516 1:202837246-202837268 GCATGCAGGAGACCCAGAGCAGG - Intergenic
920192000 1:204199680-204199702 GGGCCCAGGACACCCGGGGCAGG - Intronic
921131234 1:212221743-212221765 GGGCCCAGGACAGCCTGAGAAGG - Intergenic
1064021555 10:11813323-11813345 GTTCCCAGGCCACACAGAGCTGG - Intergenic
1064320180 10:14297576-14297598 GGACCCAGGATACCCAGAATAGG - Intronic
1065046432 10:21750857-21750879 GGGCCCAGGACACCCAGCCTGGG - Intergenic
1065340018 10:24695938-24695960 GGACCCAGGTAAGCCAGACCTGG + Intronic
1067079783 10:43206362-43206384 GGGCCCTGGACACTCAAAGCCGG + Intronic
1067106633 10:43371064-43371086 GGTCCCAGAACCCCCAAAGCTGG + Intergenic
1067553691 10:47253291-47253313 GGACTCAGCACACCAAGTGCAGG + Intergenic
1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG + Intronic
1069830985 10:71282314-71282336 TGGCCCAGGACACCCAGGGTTGG - Intronic
1069831786 10:71286230-71286252 GGACCCAGGTCTGCCAGACCCGG + Intronic
1070953808 10:80451776-80451798 GGACCCAGGGGAACCAAAGCAGG - Intergenic
1072647423 10:97267776-97267798 GGACCCAGGGCACCAAGTCCAGG + Intronic
1072723146 10:97793199-97793221 GGACCCAGGTAACCCAGGCCTGG - Intergenic
1072805898 10:98423966-98423988 GCACCCAGGACAGACAGACCTGG + Intronic
1074763395 10:116683986-116684008 GGACCCAGGGCCCCCTGGGCCGG + Intronic
1075665120 10:124224387-124224409 GGAGCCGGGACCCCCAGGGCTGG + Intergenic
1076133186 10:128027889-128027911 AGTCCCAGGACACCCACAGGAGG + Intronic
1076609068 10:131709390-131709412 GGACCCAGATCACCCAGACAGGG - Intergenic
1076684091 10:132189147-132189169 GGGCCCTGGAAACCCAGAGCAGG + Intronic
1076706097 10:132302446-132302468 GCCCCCAGGACACCCGGTGCTGG + Intronic
1077224588 11:1434561-1434583 TGCCCCCAGACACCCAGAGCCGG - Intronic
1077224608 11:1434616-1434638 TGCCCCCAGACACCCAGAGCCGG - Intronic
1077224626 11:1434671-1434693 TGCCCCCAGACACCCAGAGCCGG - Intronic
1077894492 11:6443511-6443533 GGACCCAGGACCCACAGAAGGGG - Intergenic
1078079628 11:8194416-8194438 GGACCCAGTCATCCCAGAGCTGG - Intergenic
1078528940 11:12121538-12121560 GCACACAGGAAACCCAGGGCAGG - Intronic
1080779856 11:35419769-35419791 GGCCCCAGGTCACCCCGTGCGGG + Intronic
1081862989 11:46344885-46344907 TGATCCAGGCCACACAGAGCTGG + Intronic
1083274315 11:61588122-61588144 GGCCCCAGCACTCCGAGAGCTGG + Intergenic
1083894603 11:65613789-65613811 GGACCACGGGCACCCAGAGAAGG - Exonic
1084008813 11:66336566-66336588 GGACCCCTGACCCCCAAAGCAGG - Intronic
1084387940 11:68855660-68855682 GGACCGAGAACACCCGGAGCAGG - Intergenic
1084455351 11:69265059-69265081 GGCCCCAAGGCACCCAGTGCCGG - Intergenic
1084555896 11:69875601-69875623 GGGGCCAGGGGACCCAGAGCAGG - Intergenic
1085108164 11:73863838-73863860 GGACTCAGAACAAGCAGAGCTGG - Intronic
1085109258 11:73873268-73873290 GGAGGCAGCACAGCCAGAGCGGG + Exonic
1085332720 11:75667379-75667401 GGGCCCAGGATCCCCAGCGCAGG - Intronic
1085353495 11:75815606-75815628 CGAGCCGGGACACCCAGAGCAGG + Intronic
1085451340 11:76635875-76635897 TGTCCCAGGTCACACAGAGCTGG - Intergenic
1085681783 11:78582633-78582655 GGACTTAGTACCCCCAGAGCAGG - Intergenic
1086319357 11:85628553-85628575 GGACCCAGAACGCCCTGGGCGGG - Intronic
1089033643 11:115361261-115361283 GGATTCAGGACATTCAGAGCTGG + Intronic
1089075404 11:115734489-115734511 GCATCCAGGAACCCCAGAGCAGG - Intergenic
1089169686 11:116503316-116503338 ACACCCAGGACACACAGAGGAGG - Intergenic
1089498970 11:118921946-118921968 GGACCCCCCACACTCAGAGCAGG + Intronic
1089603785 11:119630049-119630071 GGACCCAGGAGACAGGGAGCTGG + Intronic
1089776909 11:120844137-120844159 GGACCCAGGGCAGACAGAGAGGG + Intronic
1089848854 11:121479983-121480005 GTCCCCAGGACTCCCAGAGAGGG + Intronic
1089852549 11:121513035-121513057 GGCCAAAGGAGACCCAGAGCTGG - Exonic
1091992695 12:4969085-4969107 GGACTCAGAAAACCCAGAGCAGG + Intergenic
1096490689 12:52011151-52011173 GAGCCCAGGACACCCAGGTCTGG + Intronic
1097727145 12:63088181-63088203 GGAAGCAAGACACCCAGGGCTGG + Intergenic
1099320072 12:81135665-81135687 GGACACTGGAAACCCAGAACGGG + Intronic
1101731251 12:107428372-107428394 GGCCCGAGGACATCCAGGGCAGG - Intronic
1102513815 12:113433633-113433655 GGACCCAAGGCAACCACAGCAGG - Intronic
1102985246 12:117272575-117272597 GGGCCCAGCTCACCCGGAGCAGG + Intronic
1104017283 12:124969474-124969496 GGAGGCAGGACACCCAGCACAGG + Intronic
1104084419 12:125461149-125461171 GTACCCAGGAGAGCCAGAGCTGG + Intronic
1104286198 12:127426928-127426950 GTACCCAGGAGAGCCAGAGCTGG - Intergenic
1104943479 12:132405428-132405450 GAACCCAGGAGAGCCAGGGCTGG - Intergenic
1105421748 13:20258565-20258587 GGAGCCAGGTGACCCAGAACAGG + Intergenic
1108593121 13:51928042-51928064 GGACCCAGGGCACACTGAGGTGG + Intergenic
1110821030 13:79916488-79916510 GGACTTAGGAACCCCAGAGCAGG - Intergenic
1113482013 13:110628178-110628200 GGACGCAGGGAACACAGAGCTGG - Intronic
1114627933 14:24141480-24141502 GGACCCAGGGCGCCGGGAGCCGG - Exonic
1118973859 14:70660701-70660723 TCAGCCAGGGCACCCAGAGCTGG + Intronic
1119703559 14:76770647-76770669 GGACCCAGGACACACAGCTCTGG - Intronic
1120514298 14:85452171-85452193 GGACCCAGAATACACAGACCAGG - Intergenic
1122293870 14:100694196-100694218 TTACCCAGGGCACACAGAGCGGG + Intergenic
1122772892 14:104105115-104105137 GGCCCCTGGAGACCCTGAGCTGG + Intronic
1122787903 14:104172374-104172396 GGACCCAGGACACACGTAGGAGG - Intronic
1122836319 14:104432658-104432680 GGACCAGAGAGACCCAGAGCTGG + Intergenic
1122959459 14:105087792-105087814 GGACCCAGGAAACCCAGCGCTGG - Intergenic
1123047802 14:105527059-105527081 GGGCCCAGGAGACCCAGGACAGG + Intronic
1123759788 15:23423354-23423376 AGCCCCAGGACACCAAGGGCAGG + Intergenic
1124609714 15:31200240-31200262 GGACCCAGGAGTCCCCGAACTGG + Intergenic
1125716886 15:41824405-41824427 GCACCCAAGACACTCAGAACAGG - Intronic
1127346054 15:58100258-58100280 GGACCCAGGAATCCCGGTGCTGG - Intronic
1128108830 15:65063496-65063518 GGGCCAAGGTCACCCAGAGGAGG - Intronic
1128245318 15:66128746-66128768 GGACCCAGGGACCCCAGATCTGG + Intronic
1129262053 15:74374107-74374129 GGATCCAGGAGAGCCAGAACAGG + Intergenic
1130286442 15:82559087-82559109 AAACACAGGTCACCCAGAGCTGG + Intronic
1130651800 15:85766331-85766353 GGGCCCAGGACAGCATGAGCCGG + Intronic
1131013883 15:89041781-89041803 GGGCCCACGGCACCCAGACCTGG + Intergenic
1131625844 15:94119628-94119650 GGACCAAGGACACCAGGAGCTGG - Intergenic
1132552276 16:558479-558501 GGACCAAGGAGCCCCAGAGGGGG - Intergenic
1132567170 16:628862-628884 GGACCCAGGACCCCCCGTGGTGG + Exonic
1132589373 16:720013-720035 GGAGACAGGACACGCTGAGCTGG + Intronic
1132627494 16:898483-898505 GCCTCAAGGACACCCAGAGCCGG - Intronic
1132797494 16:1732395-1732417 TGACCCATGAAGCCCAGAGCTGG - Intronic
1133008679 16:2898290-2898312 GGACCCCGTCCTCCCAGAGCCGG + Intronic
1133076447 16:3284096-3284118 TGCCCCAGGAGATCCAGAGCAGG + Exonic
1133116811 16:3582255-3582277 GGACCTGGGACACCCAGCGTGGG - Exonic
1133202444 16:4212535-4212557 GGACCCAGGACACCCTGGAGAGG + Intronic
1134456552 16:14399541-14399563 AGCCCCAGGACACCAAGGGCAGG - Intergenic
1136228782 16:28875341-28875363 GCACCCACTACCCCCAGAGCTGG - Intergenic
1137037089 16:35576591-35576613 GGCCCCAGGCAACCCTGAGCTGG - Intergenic
1137456724 16:48623358-48623380 GGACCCAAGGCGCCCTGAGCCGG - Intergenic
1137669774 16:50272276-50272298 GGACCCAGGGCACCCTGATCGGG + Intronic
1138223539 16:55273256-55273278 GGGCCCAGGAGAGCCAGTGCTGG - Intergenic
1138583126 16:57954523-57954545 GGAGCCAGGACCCCCAGCTCAGG + Intronic
1139653043 16:68372115-68372137 GGGCCCAGGACACACAGTGCAGG + Exonic
1140420260 16:74813391-74813413 GGGCCCTGCACACCCGGAGCCGG + Intergenic
1140814508 16:78608745-78608767 GGACCCAGGACAACTAAAGCCGG + Intronic
1141700005 16:85638033-85638055 GGGCCCAGGGCACCCAGAGGAGG - Intronic
1141831471 16:86511897-86511919 GGACCCAAGGCTCCCAGCGCTGG + Intronic
1142498408 17:319165-319187 CGAGCCACGAGACCCAGAGCTGG - Intronic
1142684218 17:1568269-1568291 CTCCCCAGGACACCCAGAGATGG - Intergenic
1143747849 17:9006440-9006462 TGAGCGAGGACACCCAGTGCAGG + Intergenic
1143867690 17:9935878-9935900 GCACCCAAGCCACCCAGAGGGGG - Intronic
1144479029 17:15613762-15613784 GGACCCAGAAACCCCAGAACTGG + Intronic
1144919275 17:18749971-18749993 GGACCCAGAAACCCCAGAACTGG - Intronic
1145017257 17:19407570-19407592 GGACCCAGGACCACCACACCTGG + Intergenic
1145301712 17:21645592-21645614 GGATCCAGGACACCTAGGCCTGG + Intergenic
1145302008 17:21647442-21647464 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1145328020 17:21848153-21848175 GGACCCAGGACACTTAGGCCTGG + Intergenic
1145328354 17:21850198-21850220 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1145348598 17:22057732-22057754 GGATCCAGGACACCTAGGCCTGG - Intergenic
1145414985 17:22707623-22707645 AGACCCAGGACACCTAGGCCTGG + Intergenic
1145415279 17:22709488-22709510 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1145694825 17:26779537-26779559 GGATCCAGGACACCTAGGCCTGG + Intergenic
1145695136 17:26781542-26781564 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1145978476 17:28997843-28997865 GGAGTCAGGACACCCAGTGATGG - Intronic
1145986910 17:29053170-29053192 GGACCCAGGACACCCAGAGCAGG - Intronic
1146297302 17:31659926-31659948 GGGCCCAGGAGATCCACAGCAGG + Intergenic
1146846085 17:36182995-36183017 GGAAACGGGACACCCACAGCGGG - Intronic
1146907086 17:36624729-36624751 GAGCCCAGGACCCCCAGGGCCGG - Intergenic
1147721063 17:42539633-42539655 GGACCCAGCACAGCCAGTTCTGG - Intronic
1149137872 17:53391570-53391592 GGACTCTCGACACCCAGAGGTGG + Intergenic
1150273457 17:63881466-63881488 GAAGCCAGGACAGGCAGAGCAGG + Exonic
1150633659 17:66898040-66898062 GGGCACAGGCCACCCCGAGCAGG - Intergenic
1150821508 17:68438136-68438158 GGACTCAGCAAAGCCAGAGCAGG - Intronic
1150830184 17:68512116-68512138 CGACCCAAGACACCCAGAGAGGG + Intronic
1151562801 17:74879630-74879652 GGTCCCAGGACACCTGGAGTGGG - Intronic
1151630006 17:75304127-75304149 GGTCTCAGGACAAGCAGAGCAGG + Intergenic
1151631453 17:75313892-75313914 GGACAGTAGACACCCAGAGCAGG - Intergenic
1151825869 17:76523836-76523858 GGGCCCAGGCAAGCCAGAGCTGG - Intergenic
1152079090 17:78175435-78175457 GAGCCCTGGTCACCCAGAGCTGG + Intronic
1152231684 17:79117135-79117157 GGGCCCAGGACCCCCTGAGCAGG + Intronic
1152429695 17:80241851-80241873 GGACCCTGGAGGCCCACAGCTGG - Intronic
1152552435 17:81036245-81036267 GACCCAGGGACACCCAGAGCAGG - Intronic
1152595748 17:81236838-81236860 GGACACGGGACACCCAGGGCAGG + Intronic
1203192640 17_KI270729v1_random:204374-204396 GGATCCAGGACACCTAGGCCTGG + Intergenic
1203202007 17_KI270730v1_random:3809-3831 GGATCCAGGACACCTAGGCCTGG + Intergenic
1153446028 18:5174049-5174071 GTAGCCAGGAAACCCAGGGCAGG - Intronic
1153893655 18:9540412-9540434 GGAAACAGAACACCCAAAGCAGG + Intergenic
1154316779 18:13310529-13310551 AGAACCAGGAAAGCCAGAGCAGG + Intronic
1156526676 18:37774565-37774587 GGTCCCAGAGCATCCAGAGCAGG + Intergenic
1157598610 18:48879005-48879027 GCACCCAGGGCAGCCTGAGCAGG + Intergenic
1158633006 18:59132346-59132368 GGAGAGAGGACAACCAGAGCAGG + Intergenic
1160030252 18:75250750-75250772 GGCCACAGGTCACCCAGAGCGGG + Intronic
1160694899 19:478795-478817 CCACCCAGGACACCCAGGCCGGG - Intergenic
1160717342 19:582338-582360 GGACCCCCGACCCCCACAGCTGG - Intronic
1160719703 19:591766-591788 GGACCCTGGACCCCCGGAACTGG + Intronic
1160761520 19:787767-787789 GGTCTCAGGTCACCCACAGCCGG - Intergenic
1161236162 19:3199174-3199196 GGAGCCACGGCACCCAGCGCTGG - Intronic
1161280939 19:3445483-3445505 GCACCCAGGACACCCACATGGGG - Intronic
1161988199 19:7669285-7669307 GGAACCAAGAGACCCACAGCTGG - Intronic
1163338411 19:16688405-16688427 GGACCCAGGACCCTCTGAGCTGG + Exonic
1163342934 19:16721458-16721480 GGACCCAGGAAAACGAGAGAAGG + Intronic
1163917790 19:20257715-20257737 GGACGATGGACAGCCAGAGCAGG + Intergenic
1164719844 19:30424162-30424184 AGAAACAGGGCACCCAGAGCAGG - Intronic
1165076284 19:33281559-33281581 GGACCCAGCGCCCACAGAGCTGG - Intergenic
1165104715 19:33462121-33462143 GGAGCCAGCACCCCCAGGGCCGG + Intronic
1165883760 19:39062394-39062416 GGCGCCTGTACACCCAGAGCTGG - Intergenic
1167135410 19:47612663-47612685 GGACCCAGCTCACCCAGTGTAGG + Intronic
1167475903 19:49700874-49700896 GGTCCCAGGAGAGCCTGAGCAGG - Intronic
1168351652 19:55679548-55679570 TGCACCAAGACACCCAGAGCGGG - Intronic
925359607 2:3268201-3268223 GGCCCCAGGCCTCCCGGAGCTGG - Intronic
926341618 2:11909081-11909103 GGACTCAGGACACAGAGCGCTGG + Intergenic
927135650 2:20094345-20094367 GGACCCAGGAGCCTGAGAGCAGG - Intergenic
931653466 2:64489213-64489235 AGAGCCCTGACACCCAGAGCAGG - Intergenic
932325135 2:70854397-70854419 CTACCCAGGAGACCCAGAGTAGG + Intergenic
933236016 2:79865581-79865603 GGAACCAGAACACACAGTGCAGG + Intronic
934985227 2:98880534-98880556 GGACTCAGGATGCCCAGAGAAGG - Intronic
935299598 2:101682462-101682484 GGTCCCAGGAGACTCAGAGCTGG + Intergenic
936008939 2:108912465-108912487 GGTCCCAGGACACCCATAGAGGG + Intronic
936497367 2:113034198-113034220 GAATCCAGTACATCCAGAGCAGG - Intronic
937216882 2:120318603-120318625 GGACCCGGGTCACCCGGACCTGG - Intergenic
937294660 2:120802689-120802711 GGAGCCATGAAACCCAGAGCTGG + Intronic
937751371 2:125479185-125479207 GGACCTGGCACCCCCAGAGCAGG + Intergenic
938422482 2:131155860-131155882 AGACCCAGGACAGCCAGGCCTGG - Intronic
939215846 2:139237222-139237244 GCTCCCAGGGCACACAGAGCAGG + Intergenic
940972648 2:159910180-159910202 GGACCCAGGAGGCCCAGATAAGG + Intergenic
941568544 2:167140577-167140599 GGACCCAGGACTCCCAGCACCGG + Intronic
941666239 2:168246799-168246821 GGGCCCTGGAAACCCAGGGCGGG + Intronic
941998903 2:171627052-171627074 GGAGACAGGAGACCCAGAGTGGG - Intergenic
942317595 2:174709786-174709808 GGACCCAGGGCACCCTCCGCAGG + Intergenic
944531265 2:200670073-200670095 GAACCTAGGACACCCAGTCCAGG + Intronic
945183112 2:207111847-207111869 AGACCCTGGAAACCCAGGGCAGG - Intronic
946158931 2:217824361-217824383 GCTCACAGGACACCCAGAGCTGG + Intronic
946622293 2:221573063-221573085 GGGCCCAGGACGCCCCGAGATGG + Intronic
946689773 2:222301403-222301425 GGTCCCTGGACACCCGGAGAGGG + Intronic
946908942 2:224442243-224442265 GGACGCAGACCCCCCAGAGCCGG + Intergenic
947715011 2:232334943-232334965 GGACCCAGGAACCAGAGAGCAGG + Intronic
947734087 2:232445894-232445916 GGACCCAGGAACCAGAGAGCAGG + Intergenic
948513621 2:238489198-238489220 GGGCTCAGGAATCCCAGAGCTGG - Intergenic
948628384 2:239284626-239284648 GGTCCCAGCACACACAGAGCAGG + Intronic
948651061 2:239444179-239444201 CGAGTCGGGACACCCAGAGCTGG + Intergenic
948806893 2:240456920-240456942 GGCCCCAGGGCTCTCAGAGCCGG + Intronic
1168924246 20:1566392-1566414 GGAGTCAGGAAAGCCAGAGCAGG - Intronic
1170117035 20:12871666-12871688 GGACCAAGGACACCCGTGGCAGG + Intergenic
1171486310 20:25489033-25489055 GGTCCCTGGACACACAGAGGCGG + Intronic
1171518290 20:25756975-25756997 GGATCCAGGACACCTAGGCCTGG + Intergenic
1171518592 20:25758844-25758866 GAACCCAGGTCTCCCAAAGCAGG - Intergenic
1171558264 20:26097365-26097387 GAACCCAGGTCTCCCAAAGCAGG + Intergenic
1171558567 20:26099231-26099253 GGATCCAGGACACCTAGGCCTGG - Intergenic
1172117655 20:32582235-32582257 GGACCCAGGCCTCCCAGTCCAGG - Intronic
1172165222 20:32894641-32894663 GGCTCCAGGTCACACAGAGCTGG - Intronic
1174447564 20:50601074-50601096 GGACCGAGGGAACACAGAGCAGG + Intronic
1174484909 20:50855075-50855097 GGACCCAAGACACCCCTGGCGGG - Intronic
1175221677 20:57420930-57420952 GGACCCCGGACAGGCTGAGCTGG + Intergenic
1175516302 20:59572308-59572330 GGACGCAAGACACCCAGACCTGG - Intergenic
1175916613 20:62428778-62428800 GTTCCCAGGCCAGCCAGAGCTGG - Intergenic
1176273452 20:64248456-64248478 AGGCCCAGGACACCTAGAGCGGG + Intergenic
1176652450 21:9563389-9563411 GGATCCAGGACACCTAGGCCTGG + Intergenic
1179553247 21:42156605-42156627 AGACCGAGGGCAGCCAGAGCTGG - Intergenic
1179630961 21:42678486-42678508 GGACCAAGGACACCCAGTTCTGG + Intronic
1179886380 21:44315944-44315966 GGGCCCAGCACACACACAGCTGG - Intronic
1180092339 21:45539523-45539545 GGTCCCTGGACCCCCAAAGCTGG - Intronic
1180954277 22:19734594-19734616 TGACCTGAGACACCCAGAGCAGG - Intergenic
1181090511 22:20469344-20469366 GGTCACAGGACACACAGAGCAGG + Intronic
1181476007 22:23168267-23168289 GGGCCCAGGACTTCAAGAGCTGG - Intergenic
1181616267 22:24056868-24056890 GGAACCAGGCTCCCCAGAGCTGG + Intronic
1184120131 22:42444642-42444664 GGACCCAGGCCATCAGGAGCGGG - Intergenic
1184686994 22:46100712-46100734 GAACCCAGGGTACCCAGAACAGG - Intronic
1184770478 22:46594190-46594212 GAGCACAGGACACACAGAGCTGG - Intronic
1185097496 22:48819387-48819409 AGAACCATGACACCCAGAGAGGG - Intronic
1185186931 22:49406926-49406948 GGGCATCGGACACCCAGAGCAGG + Intergenic
950110435 3:10415125-10415147 TAACCAAGGTCACCCAGAGCTGG - Intronic
951264892 3:20553185-20553207 GCACCCAGGGCACCCAGGGAGGG + Intergenic
952992484 3:38843894-38843916 GGATCCAGGACACCCTCAGGAGG - Intergenic
953200819 3:40777132-40777154 AGGCCAAGGACAGCCAGAGCTGG + Intergenic
953553979 3:43927763-43927785 GAACCCATGACACCCAGAAGGGG + Intergenic
955377461 3:58410183-58410205 GGGCCCAGGACACAGAGATCAGG + Intronic
957434987 3:80163188-80163210 GGACCCTGGGGACCCAGAGGTGG - Intergenic
959389695 3:105759116-105759138 GCACTCAGGAAACCCAGAGTGGG + Intronic
961319262 3:126061621-126061643 GGACCCTTGACACCCAGCCCTGG - Intronic
961405936 3:126679557-126679579 GGACCCAGCACCTCCAGGGCCGG + Intergenic
964650732 3:159008606-159008628 GTACCCAGGAGTCTCAGAGCTGG + Intronic
966822137 3:183933432-183933454 GGACCCAGGAAACCCAGCCCTGG - Intronic
967219431 3:187236394-187236416 GGATCCAGGACGCAGAGAGCAGG + Exonic
968541991 4:1172508-1172530 GCCCCCGGGACACCCAGAGAGGG - Intronic
969491644 4:7502568-7502590 GGAGCCAGGACATCAAGAGGAGG - Intronic
969589508 4:8113808-8113830 GGTCCCGGCTCACCCAGAGCGGG + Intronic
969593887 4:8137293-8137315 TGACCAGGGACTCCCAGAGCAGG - Intronic
969902536 4:10363097-10363119 TGTCCCAGGAAACCCAGAGGAGG + Intergenic
971453536 4:26822330-26822352 GGACAGATGTCACCCAGAGCAGG + Intergenic
971957945 4:33446735-33446757 GGACCTAGGAAACCCTGGGCAGG - Intergenic
973306729 4:48660388-48660410 GGACCCACCACTCCCAGAACTGG + Intronic
976146881 4:82050865-82050887 CCATCCAGGACAGCCAGAGCAGG - Intergenic
976257008 4:83109829-83109851 AGACCCAGGGGTCCCAGAGCTGG - Intronic
976656512 4:87494220-87494242 GGATCAAGGAAACCAAGAGCAGG - Exonic
977042336 4:92030324-92030346 GGACCCAGGACACCCAATTAGGG - Intergenic
980160060 4:129150197-129150219 GTACCCAGGATGCCCTGAGCAGG + Intergenic
982675774 4:158374177-158374199 AGCTCTAGGACACCCAGAGCAGG - Intronic
984727762 4:183037723-183037745 GGACCCAGGGGAGCCAAAGCCGG - Intergenic
985314222 4:188637537-188637559 AGACACAGGAGACCCTGAGCTGG - Intergenic
986573622 5:9190506-9190528 GCAGCCTGGACACCCACAGCTGG + Intronic
988080644 5:26410647-26410669 GTCCCAAGGACACACAGAGCAGG - Intergenic
989103418 5:37840054-37840076 GGACCCCGGACCCCCAGCCCGGG - Intergenic
994413375 5:99437909-99437931 AGAGCCAGGACACCCAGAGGAGG + Intergenic
997251204 5:132389917-132389939 GTCCCCAGGAAATCCAGAGCAGG - Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
998129255 5:139643124-139643146 GGGCCCAGGGCACCCAGCGGCGG + Intergenic
998136451 5:139676755-139676777 GGACCCAGGACACCTTGTCCAGG - Intronic
1000836100 5:166156088-166156110 GGAACCAGGTCTGCCAGAGCAGG + Intergenic
1001663848 5:173416322-173416344 GGACTGAGGAAATCCAGAGCTGG + Intergenic
1002050010 5:176565358-176565380 GGAAGCAGGACAGCCATAGCTGG - Exonic
1002484126 5:179523195-179523217 GGACTGAGGATACCCAGGGCAGG + Intergenic
1002500439 5:179644286-179644308 GGACTGAGGATACCCAGGGCAGG - Intronic
1002690133 5:181044757-181044779 TGACCCAGGAGGCCCAGACCTGG - Intronic
1002817196 6:692572-692594 GCGCTCAGGACAGCCAGAGCGGG + Intronic
1004740658 6:18457228-18457250 TGACCCAGGACAGCCTGTGCTGG + Exonic
1004927971 6:20433933-20433955 GGAAGCAGTAAACCCAGAGCAGG - Intronic
1005709512 6:28489965-28489987 GGGCCCAGGGCACCCAGGGCAGG + Intergenic
1007513002 6:42389010-42389032 GGAACCTAGACACTCAGAGCAGG + Intronic
1007626466 6:43249229-43249251 CACCCCAGGTCACCCAGAGCTGG + Intronic
1007728917 6:43933848-43933870 AGACTCAGGACAGCCAGAGGGGG - Intergenic
1013155523 6:107489244-107489266 AAACCCAGGACACCCAGATAAGG + Intergenic
1017579876 6:155852616-155852638 TGACTCAGGACTGCCAGAGCAGG - Intergenic
1019270325 7:143551-143573 GGACGCAGGTCACCAGGAGCCGG - Intergenic
1019536459 7:1531874-1531896 GGACGCAGGACACCAGGAGAGGG - Intronic
1019602940 7:1894366-1894388 GGGACCAGGACACACAGGGCCGG + Intronic
1019747157 7:2707417-2707439 GGGCCCAGGAAACCCGGAGAGGG - Intronic
1024472621 7:49778764-49778786 AAACCCAGAATACCCAGAGCAGG - Intronic
1025279117 7:57614316-57614338 GGATCCAGGACACCTAGGCCTGG + Intergenic
1025305614 7:57851184-57851206 GGATCCAGGACACCTAGGCCTGG - Intergenic
1026232278 7:68495899-68495921 GGACCCAGGAAAGTCAGAGATGG - Intergenic
1026740459 7:72975713-72975735 TGGCCCTGGACACCCAGTGCTGG - Intergenic
1026797761 7:73377198-73377220 TGGCCCTGGACACCCAGTGCTGG - Intergenic
1027103272 7:75389357-75389379 TGGCCCTGGACACCCAGTGCTGG + Intergenic
1029113320 7:98224215-98224237 GGAGCCAGGACAGCCTGAGCTGG - Intronic
1031214240 7:118870225-118870247 GGAGCTAGGACACCCGGAGAGGG - Intergenic
1032592225 7:133202216-133202238 GGACACAGGACACTAACAGCGGG - Intergenic
1032710697 7:134458349-134458371 AGACCCAGGGCACCCCGAGGCGG + Intronic
1033566654 7:142585406-142585428 GGACTCAGGTGACCCAAAGCTGG - Intergenic
1034973063 7:155431260-155431282 GAGCCCAGGACAACCAGAGGAGG + Intergenic
1035381950 7:158446043-158446065 GAACCCAGGACACTCAGCGTGGG + Intronic
1035407232 7:158607129-158607151 GGGCCCAAGACACCCAGTGCTGG + Intergenic
1035581211 8:739888-739910 GGACCGAGGTGACACAGAGCCGG + Intergenic
1035623839 8:1056350-1056372 GGACAGAGGACACACAGAGCTGG - Intergenic
1036523257 8:9511968-9511990 AAACCCAGGACACCCAAAGAGGG - Intergenic
1036579003 8:10055055-10055077 GGACCCAGGGCACCTGCAGCGGG + Intronic
1036773863 8:11596783-11596805 GGAGCCATGGCACCCAGGGCAGG + Intergenic
1036783001 8:11662889-11662911 GGAGCCAGGCCACCCGGAGCTGG - Intergenic
1037831232 8:22190847-22190869 GAACCCAGCTCTCCCAGAGCAGG + Intronic
1038416746 8:27402267-27402289 GGACCCTGACCACCCAGACCAGG - Intronic
1038642320 8:29338249-29338271 AAACCCAGGAACCCCAGAGCAGG + Intronic
1041502745 8:58556381-58556403 GGAACCAGGCCACCCACAGCAGG - Intronic
1042877487 8:73452369-73452391 GGGCCCAGCCCACCCAGTGCTGG + Intronic
1043296191 8:78666220-78666242 GGACCCTGGACACCAGTAGCAGG + Intronic
1043428884 8:80175271-80175293 GGACCCAGGGCGCCCAGTGGAGG + Intronic
1043485263 8:80692952-80692974 GGCCCCTTGACACCAAGAGCAGG - Intronic
1044608918 8:94072972-94072994 GATCCCAGGACCCACAGAGCTGG - Intergenic
1045882240 8:107055027-107055049 TGAGCCAAGACACTCAGAGCAGG + Intergenic
1048941538 8:139404549-139404571 GGACCCAGGAGCAACAGAGCAGG + Intergenic
1049162489 8:141106189-141106211 TGATCCAGGACACCCAGCGCAGG + Intergenic
1049200775 8:141339586-141339608 GGACTCTGGGCACCCAGCGCCGG + Intergenic
1049213633 8:141397971-141397993 GGACCCTGGACAGTCAGCGCAGG + Intronic
1049345552 8:142136728-142136750 GGACCCAGGACTCAGAGGGCTGG + Intergenic
1049623573 8:143610023-143610045 AGACCCAGGTCACGGAGAGCAGG + Intergenic
1049781427 8:144430729-144430751 GGGCCAGGCACACCCAGAGCTGG - Intronic
1060219060 9:121754885-121754907 GGACCCAGGAAGTACAGAGCGGG - Intronic
1060970430 9:127734637-127734659 GGACACAGGAGTCCCAGACCAGG - Intronic
1061659175 9:132116955-132116977 TGCCCCAGGACACACAGAACTGG + Intergenic
1061720635 9:132548953-132548975 GGGCCCAGGAGACCCGAAGCAGG - Intronic
1061991233 9:134159775-134159797 GGCCCCAGGACCCCCACAGCAGG - Exonic
1062065144 9:134522639-134522661 GTACACAGCACTCCCAGAGCTGG + Intergenic
1062102253 9:134734379-134734401 GGCCCCAGGACACTTGGAGCAGG - Intronic
1062374604 9:136256228-136256250 AGTCCCAGGAAACCGAGAGCTGG - Intergenic
1062511849 9:136910625-136910647 GGACCTCTGACACACAGAGCAGG - Intronic
1203630179 Un_KI270750v1:66930-66952 GGATCCAGGACACCTAGGCCTGG + Intergenic
1190105042 X:47553896-47553918 GTACCCAGGTCAGCCAGTGCTGG - Intergenic
1195293328 X:103450072-103450094 AGCCCCAGGACACCTCGAGCAGG - Intergenic
1198302095 X:135343360-135343382 TGTCCCAGGACATCCACAGCAGG - Exonic