ID: 1145988903

View in Genome Browser
Species Human (GRCh38)
Location 17:29066289-29066311
Sequence TCTGCTGGGGAGCAAGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145988898_1145988903 4 Left 1145988898 17:29066262-29066284 CCAACAAGCTGAGATTTGTAGCT No data
Right 1145988903 17:29066289-29066311 TCTGCTGGGGAGCAAGGAGTAGG No data
1145988897_1145988903 5 Left 1145988897 17:29066261-29066283 CCCAACAAGCTGAGATTTGTAGC No data
Right 1145988903 17:29066289-29066311 TCTGCTGGGGAGCAAGGAGTAGG No data
1145988896_1145988903 14 Left 1145988896 17:29066252-29066274 CCATCTGTTCCCAACAAGCTGAG No data
Right 1145988903 17:29066289-29066311 TCTGCTGGGGAGCAAGGAGTAGG No data
1145988895_1145988903 20 Left 1145988895 17:29066246-29066268 CCAAGGCCATCTGTTCCCAACAA No data
Right 1145988903 17:29066289-29066311 TCTGCTGGGGAGCAAGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145988903 Original CRISPR TCTGCTGGGGAGCAAGGAGT AGG Intergenic
No off target data available for this crispr