ID: 1145990829

View in Genome Browser
Species Human (GRCh38)
Location 17:29078545-29078567
Sequence GTGTGTTAGTTCATGCATCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145990823_1145990829 17 Left 1145990823 17:29078505-29078527 CCTAGGTGTCCAGCCGCTCCACA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1145990829 17:29078545-29078567 GTGTGTTAGTTCATGCATCTGGG 0: 1
1: 0
2: 0
3: 14
4: 170
1145990825_1145990829 4 Left 1145990825 17:29078518-29078540 CCGCTCCACAGCACAAGCATGCG 0: 1
1: 0
2: 1
3: 4
4: 111
Right 1145990829 17:29078545-29078567 GTGTGTTAGTTCATGCATCTGGG 0: 1
1: 0
2: 0
3: 14
4: 170
1145990824_1145990829 8 Left 1145990824 17:29078514-29078536 CCAGCCGCTCCACAGCACAAGCA 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1145990829 17:29078545-29078567 GTGTGTTAGTTCATGCATCTGGG 0: 1
1: 0
2: 0
3: 14
4: 170
1145990826_1145990829 -1 Left 1145990826 17:29078523-29078545 CCACAGCACAAGCATGCGACAGG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1145990829 17:29078545-29078567 GTGTGTTAGTTCATGCATCTGGG 0: 1
1: 0
2: 0
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145990829 Original CRISPR GTGTGTTAGTTCATGCATCT GGG Exonic
900293776 1:1938304-1938326 GTGTGTGAGTGCATGTATGTGGG - Intronic
905068311 1:35203378-35203400 ATGTGTTAGTTCATTTATTTTGG - Intergenic
906533865 1:46540528-46540550 GTGTGTTCGTGCATGCACATGGG - Intergenic
907393151 1:54171791-54171813 GTGTGTGAGTTCAGACCTCTTGG - Intronic
907737583 1:57129712-57129734 GTGGGTTAGTTCATGCCTAAGGG + Intronic
911987673 1:104650588-104650610 GTGTGTGTGTGTATGCATCTGGG + Intergenic
913536308 1:119775713-119775735 GTGTGTGAGTTCATGTTCCTTGG - Intergenic
913652856 1:120934878-120934900 GTGTGATGGTTTATGCAGCTGGG - Intergenic
914168247 1:145194169-145194191 GTGTGATGGTTTATGCAGCTGGG + Intergenic
914518551 1:148394965-148394987 GTGTGATGGTTTATGCAGCTGGG - Intergenic
914643035 1:149629005-149629027 GTGTGATGGTTTATGCAGCTGGG - Intergenic
917417806 1:174829124-174829146 AGGTGTTGGTTCAGGCATCTAGG - Intronic
919664569 1:200279590-200279612 GTCTGTTAGTTCATCCTTCAAGG - Intergenic
921164200 1:212494379-212494401 GGGTGTTAGTGCATCCACCTGGG - Intergenic
924014583 1:239706755-239706777 GTGTGTGAGTACATGCACATGGG - Intronic
1063234168 10:4095343-4095365 ATGTGCTATTTCATGCCTCTGGG - Intergenic
1063684495 10:8223847-8223869 GTGTGTTAAATCATGGATCCTGG + Intergenic
1064778709 10:18809103-18809125 GTGTGATTGTTCATTCATTTTGG + Intergenic
1065242710 10:23723500-23723522 AAGTCTTAGTGCATGCATCTTGG + Intronic
1066292182 10:34024571-34024593 GTGGGTTAATTCAAGCATCCAGG - Intergenic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1074473927 10:113752669-113752691 GAGTGTTAGCTCTGGCATCTGGG - Intronic
1075035012 10:119057845-119057867 CTGGGTTATTTCATGCATTTTGG - Intronic
1075661942 10:124203472-124203494 GTGTGTGATTTTATGCACCTAGG + Intergenic
1076068678 10:127468889-127468911 GTGTGTGTGTTCATGCATGCAGG + Intergenic
1076901958 10:133343774-133343796 GTGAGCCAGTTCATGGATCTGGG + Intronic
1077314844 11:1914292-1914314 GTGTGTGGGGTCATGCACCTGGG + Intergenic
1078388372 11:10913007-10913029 GTGTGTTAGTTAAGGCCTTTTGG - Intergenic
1080292183 11:30683315-30683337 ATGTGTGAGTTCATGGAACTAGG + Intergenic
1081180461 11:39980056-39980078 GTGAGTTAGTTCATTCATTATGG - Intergenic
1081689427 11:45067243-45067265 ATGAGTAAGTTCATGCATGTGGG - Intergenic
1085891517 11:80585232-80585254 GTCTGTTATTTCATGAATATTGG + Intergenic
1085998001 11:81945105-81945127 ATATGTTAGTACAAGCATCTAGG - Intergenic
1086476777 11:87184817-87184839 GTGTGTTAATACTTCCATCTTGG - Intronic
1089183869 11:116601752-116601774 GTGGCTTAGGTCATGCAACTGGG - Intergenic
1089734614 11:120541116-120541138 CTGTGCTAGTTCACACATCTGGG + Intronic
1090394861 11:126412225-126412247 GTGTGTTATCTCATCCAGCTGGG - Intronic
1098172769 12:67763196-67763218 GTGGGTCAGTTCATGTACCTAGG + Intergenic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1099175780 12:79420216-79420238 GGGTGTTATTTAATACATCTAGG - Intronic
1100372476 12:93980926-93980948 GTGTGTAAGTTCTTGCCTATAGG - Intergenic
1101193507 12:102359166-102359188 ATGTGTTACTTGATCCATCTGGG + Intergenic
1103418189 12:120758756-120758778 CTGTATTAGTTGATACATCTAGG - Intergenic
1106205656 13:27591600-27591622 GTCTGTTCGTCCATCCATCTAGG + Intronic
1106401973 13:29440157-29440179 GTGAGATACTTCATTCATCTAGG - Intronic
1106951470 13:34889219-34889241 TTGTGTAAGTTCAGGAATCTAGG - Intergenic
1107995207 13:45852478-45852500 GTGTGTGCATTCATGCATCAGGG - Intergenic
1108140026 13:47410811-47410833 GTGTTTAAATTCATGCATCTAGG - Intergenic
1110345660 13:74444856-74444878 ATCAGTGAGTTCATGCATCTGGG + Intergenic
1111179363 13:84641780-84641802 GTGAGTTAGTTCAACCATCTTGG + Intergenic
1113286387 13:108853530-108853552 GTGTTTGAGTTTGTGCATCTTGG + Intronic
1114155236 14:20095226-20095248 GTGTGTGTGTTCATGCTTGTGGG - Intergenic
1114211436 14:20618825-20618847 GTGTGTTTGTTCATTCTTCTAGG + Intergenic
1114520526 14:23331664-23331686 GGGTCTTAGTCCATTCATCTGGG - Intergenic
1115153530 14:30313004-30313026 GTGTGTGTGTGCATGCATGTTGG - Intergenic
1115629194 14:35226871-35226893 GTGTGTTAGTGCATGTCTCTAGG - Intronic
1117212373 14:53513806-53513828 GTGTCTTAGGTCATACTTCTTGG - Intergenic
1118743459 14:68757783-68757805 GGGTGTCAGTTTCTGCATCTAGG - Intergenic
1127559113 15:60118291-60118313 GTGTGTTAGTGCAACCAGCTCGG + Intergenic
1127701856 15:61509063-61509085 GTGAGTTGGTTTATTCATCTTGG + Intergenic
1127986251 15:64073724-64073746 GTGTGGTGGTTCATGCCTGTGGG - Intronic
1129528287 15:76238027-76238049 ATGTCTTAGTACTTGCATCTGGG - Intronic
1130209970 15:81914018-81914040 GAGTGTTTGTTCGTGCCTCTAGG - Intergenic
1132285297 15:100658261-100658283 GTGTGTGTGTTCATGCTCCTCGG + Intergenic
1132792800 16:1702264-1702286 GTGTTTCAGTTAATGCATGTTGG - Intronic
1133338730 16:5023005-5023027 TTGTCTTAGTTTCTGCATCTGGG + Intergenic
1134585833 16:15409964-15409986 GTATTTTATTTCATGTATCTGGG - Intronic
1135266129 16:21027279-21027301 GTGTTTTATTTTATGCACCTAGG - Intronic
1138560195 16:57796735-57796757 GTGTGTGTGTGCATGCATATAGG - Intronic
1139014653 16:62675667-62675689 TTGTGTGAGGTCATGCAGCTGGG - Intergenic
1141427404 16:83953112-83953134 GTGTGCAAGTTCATTCATCACGG + Intronic
1144139925 17:12338211-12338233 GTGTGTTAATCTGTGCATCTGGG + Intergenic
1144452715 17:15394406-15394428 ATCTGTTATTTCATGAATCTGGG + Intergenic
1145990829 17:29078545-29078567 GTGTGTTAGTTCATGCATCTGGG + Exonic
1146674626 17:34764764-34764786 GAATGTTAGTTCATGAGTCTAGG - Intergenic
1146704185 17:34988351-34988373 GTGTTTTAGTTCTTGCAACCTGG + Intronic
1147550729 17:41439619-41439641 TTGCGTAAGATCATGCATCTTGG + Intronic
1148537188 17:48449874-48449896 GTGTGTTAAATTATACATCTAGG - Intergenic
1150175861 17:63055084-63055106 ATGTGTTATTTCCTGCAACTGGG - Intronic
1150396389 17:64825307-64825329 GTTTGTTAGTTTTTGCCTCTTGG - Intergenic
1151388711 17:73771215-73771237 GTTTGTGAGTTCATGGATATGGG + Intergenic
1151526795 17:74675452-74675474 TTGTATTAGGGCATGCATCTTGG + Intronic
1151962281 17:77412319-77412341 GTGTTTTATTTTGTGCATCTCGG + Intronic
1155991144 18:32280767-32280789 GTGTGCTAGTTCATTCTGCTGGG - Intronic
1158282896 18:55847288-55847310 GTGTGTAAGTAAATTCATCTTGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
931905583 2:66839280-66839302 GTCTGTTAGTTCATTCATTCAGG - Intergenic
932483291 2:72063159-72063181 CTGTGTTAGTTAATACAACTAGG + Intergenic
933657479 2:84901509-84901531 GTGTGTTACTTTAAGTATCTAGG + Intronic
934153235 2:89170463-89170485 CTGTGTTATTGCATCCATCTGGG - Intergenic
934213999 2:90011468-90011490 CTGTGTTATTGCATCCATCTGGG + Intergenic
934474335 2:94583461-94583483 TTGTGTTGGTTCATGAATCATGG + Intergenic
935274551 2:101464730-101464752 GTGTGTGACTACATGCAGCTAGG - Intronic
939004679 2:136772236-136772258 GTGTGTGTGTTCTTGCATTTTGG - Intronic
939695935 2:145324617-145324639 CTGTCTTAGTTTCTGCATCTAGG + Intergenic
939907436 2:147934342-147934364 CTCTGTTAATTCATGGATCTTGG + Exonic
943592089 2:189810958-189810980 GTCTGTTAATTCAAACATCTGGG - Intronic
943963100 2:194293036-194293058 GTGTCTTAGTATATCCATCTTGG - Intergenic
944278458 2:197867024-197867046 CTGTGTTTGCTAATGCATCTCGG - Intronic
945633487 2:212316267-212316289 GTGTGTGTGTACATGCATGTGGG - Intronic
945747162 2:213732272-213732294 ATGTGTCTGTTCATCCATCTTGG + Intronic
946479901 2:220044955-220044977 ATGTGTGAGTTCATGCCTATTGG - Intergenic
946631424 2:221673267-221673289 GTGTTCTTGTTCATGCTTCTGGG - Intergenic
946902026 2:224382063-224382085 GTGTGTTTGTTTTTGCAGCTTGG - Intronic
947591706 2:231389612-231389634 GTGTGTGTGTTCATGCGTCTGGG + Intergenic
1169995119 20:11547489-11547511 GTGTGTTAGTGCCTTGATCTTGG - Intergenic
1172172415 20:32946426-32946448 GTTTGTTTTTTCATTCATCTGGG + Intronic
1173775498 20:45702929-45702951 GTGTGGTAGCTCATGTGTCTGGG + Intronic
1175350274 20:58313127-58313149 GGGTGTAGCTTCATGCATCTTGG + Intronic
1182462246 22:30491236-30491258 GTGGGGTGGTTCATGCAACTGGG + Intronic
1182734744 22:32524662-32524684 GTCTTTTAGTTCATGGATCAAGG + Intronic
949589220 3:5475875-5475897 GTGTCTTAGTTAATATATCTTGG - Intergenic
949830019 3:8204361-8204383 GTGTGTGAGTTTATACATATCGG + Intergenic
950281363 3:11710750-11710772 GTGTGATAGTTCATACTTTTGGG - Intronic
951776216 3:26312928-26312950 GTGTGTGAGTTGATTCTTCTGGG + Intergenic
953704414 3:45220342-45220364 GTGTGTCAGAACAAGCATCTCGG - Intergenic
955569990 3:60294502-60294524 GTTTGTAAATTCATGCCTCTTGG - Intronic
959214653 3:103436508-103436530 TTGTGTTTGTTCAAGCATCATGG + Intergenic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
968055083 3:195685062-195685084 GCGTGTTGGTTCATGCCTGTTGG - Intergenic
968100817 3:195964155-195964177 GCGTGTTGGTTCATGCCTGTTGG + Intergenic
968791531 4:2667473-2667495 TTGTTTTGGTTCATGCATTTGGG + Intronic
969832876 4:9812109-9812131 GTGTGTTATTACATGCAACTCGG + Intronic
971154902 4:24071207-24071229 GTGTGTTTGTGCATGCATGTGGG - Intergenic
972038766 4:34561996-34562018 TTGTGTTAGTTCTTGCAGCATGG - Intergenic
974693622 4:65335628-65335650 GTGTGTATTTTCATGCATTTTGG - Intronic
976563512 4:86528679-86528701 GTGTGGTGGTACATGCCTCTAGG - Intronic
978092339 4:104733097-104733119 GTTTGTTATTTCATGTATGTAGG + Intergenic
979465431 4:121032260-121032282 GAGTGGTTGATCATGCATCTTGG - Intergenic
984166597 4:176309917-176309939 ATGTGTTAGGCTATGCATCTGGG + Intergenic
984399824 4:179248034-179248056 GAGAGTGAGTTCATGCATATCGG - Intergenic
984458757 4:180006768-180006790 GTATATTAGTTCATCCATCGTGG + Intergenic
985502256 5:255701-255723 GGGTGTTGGTTCATGCCTGTTGG - Intronic
986359361 5:6961093-6961115 GTGTGTTTGTGCATGCGTTTGGG - Intergenic
988615920 5:32774672-32774694 GTGTTTTGGTTCACCCATCTGGG + Intronic
989530849 5:42506390-42506412 TTTTGTTAGTTCATTAATCTTGG - Intronic
990553529 5:56908573-56908595 GTGTGCGTGTGCATGCATCTGGG + Intergenic
996202717 5:120696663-120696685 GTGTGTTAGTATCTGAATCTTGG + Intergenic
999115326 5:149157849-149157871 GTTTGTTGGTTCTTGCAACTGGG - Intronic
999402890 5:151280650-151280672 GTGTGTTACTTAATTTATCTGGG + Intronic
1001825467 5:174741673-174741695 TTGTGTTAGTTCATTTATTTGGG + Intergenic
1005058187 6:21750410-21750432 GTTGGTTATTTCAAGCATCTTGG + Intergenic
1005923429 6:30419779-30419801 GTGCTTTATTTCATGCATCTGGG + Intergenic
1006073111 6:31511137-31511159 GTGTTTTATTTCATGCGTCTGGG + Intergenic
1006845891 6:37061303-37061325 GTGTTTAAGGTCATGCAGCTGGG + Intergenic
1011581100 6:88866289-88866311 GTGTGTAAGTGCATGCTACTTGG - Intronic
1017375798 6:153766608-153766630 GCGTGTTAGCTCCTGAATCTGGG - Intergenic
1018765586 6:166930454-166930476 GTGTGTGTGTACATGCATGTGGG - Intronic
1019305799 7:334260-334282 GTGTGTTTCTGCATGCATGTGGG - Intergenic
1021548816 7:21847579-21847601 GTGTGTTACTTGGTCCATCTTGG + Intronic
1022829603 7:34052279-34052301 GTGTGTTAGAGAATTCATCTTGG - Intronic
1023966678 7:44966490-44966512 GTGTGTGAGCACATGCATGTGGG - Intronic
1024045341 7:45581884-45581906 GAGTGTGAGTGTATGCATCTGGG - Intronic
1027054441 7:75040319-75040341 GCGTGGTAGTGCATGCCTCTAGG + Intronic
1028046934 7:86131798-86131820 CTATGTTAGTTAATGCATCTGGG + Intergenic
1030886279 7:114941935-114941957 GTGAGTGAGTCCATGCATGTAGG - Intronic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031304012 7:120101357-120101379 GTATGTTTGTTTATGCATATAGG - Intergenic
1032929049 7:136644201-136644223 GGGTGAAAGTTCATGAATCTAGG + Intergenic
1035994990 8:4535755-4535777 ATAGGTTAGTTCATGCTTCTAGG + Intronic
1039795556 8:40909823-40909845 GTGTGTCTGTTCATGCAACAAGG - Intergenic
1040492766 8:47940325-47940347 CTGTATTAGTTCTTGCATTTAGG - Intronic
1041788110 8:61658479-61658501 GTGTGTAAGTTCAGGCACCTGGG + Intronic
1044617222 8:94154954-94154976 GTGTGTTGGTGCATGCATGCGGG - Intronic
1046044197 8:108944438-108944460 GACTGTTAGTTTAGGCATCTAGG + Intergenic
1046241954 8:111508158-111508180 GTGTGTTTCTGCATGCATTTAGG - Intergenic
1046301077 8:112290918-112290940 GTGTGTTACTTTAAGCATCTTGG + Intronic
1048534933 8:135284320-135284342 GTGTGTTAGTCCAGGCAGCATGG - Intergenic
1049649408 8:143757992-143758014 GTGTATCAGTTCATGCTTTTGGG + Intergenic
1051378892 9:16435269-16435291 GTATGTGTTTTCATGCATCTAGG - Intronic
1053567070 9:39264569-39264591 GTGTCTTTCTTCATGCCTCTTGG - Intronic
1053832841 9:42102415-42102437 GTGTCTTTCTTCATGCCTCTTGG - Intronic
1054130073 9:61354430-61354452 GTGTCTTTCTTCATGCCTCTTGG + Intergenic
1054597710 9:67084995-67085017 GTGTCTTTCTTCATGCCTCTTGG + Intergenic
1059905336 9:118977843-118977865 GTGCTGTAGTTCATTCATCTAGG - Intergenic
1185697798 X:2208381-2208403 ATGTGTTAGTTCAGGCTGCTGGG + Intergenic
1186996614 X:15130757-15130779 GTATGTTATTTCATGCTGCTAGG - Intergenic
1188180604 X:27050732-27050754 CTGTGTGAGCTCATTCATCTTGG + Intergenic
1188683480 X:33040882-33040904 GTCTGTTAGTTCAAGCATATAGG - Intronic
1194013322 X:88588276-88588298 GTATGTTAGTTTCTGTATCTTGG - Intergenic
1195563671 X:106316190-106316212 GTGTGTGTGTGCATGCATTTAGG - Intergenic
1199868276 X:151873896-151873918 GTGTGCGTGTGCATGCATCTGGG + Intergenic
1200362506 X:155623908-155623930 GTGTCTTAGTTTTTGCATCTGGG + Intronic
1201613143 Y:15865516-15865538 CTGTGGTAGCTCATGCATGTTGG + Intergenic
1202191209 Y:22247852-22247874 GTGTGTTAATTCCAGTATCTGGG + Intergenic