ID: 1145993535

View in Genome Browser
Species Human (GRCh38)
Location 17:29093092-29093114
Sequence CAGTGTCCCCATAAGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 150}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145993527_1145993535 9 Left 1145993527 17:29093060-29093082 CCCAAGCTCCCTCCTCACCACGT 0: 1
1: 0
2: 3
3: 18
4: 234
Right 1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG 0: 1
1: 1
2: 0
3: 15
4: 150
1145993530_1145993535 0 Left 1145993530 17:29093069-29093091 CCTCCTCACCACGTCCTCATTAT 0: 1
1: 0
2: 0
3: 11
4: 183
Right 1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG 0: 1
1: 1
2: 0
3: 15
4: 150
1145993526_1145993535 10 Left 1145993526 17:29093059-29093081 CCCCAAGCTCCCTCCTCACCACG 0: 1
1: 1
2: 5
3: 35
4: 332
Right 1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG 0: 1
1: 1
2: 0
3: 15
4: 150
1145993529_1145993535 1 Left 1145993529 17:29093068-29093090 CCCTCCTCACCACGTCCTCATTA 0: 1
1: 0
2: 0
3: 23
4: 245
Right 1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG 0: 1
1: 1
2: 0
3: 15
4: 150
1145993528_1145993535 8 Left 1145993528 17:29093061-29093083 CCAAGCTCCCTCCTCACCACGTC 0: 1
1: 1
2: 3
3: 49
4: 462
Right 1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG 0: 1
1: 1
2: 0
3: 15
4: 150
1145993531_1145993535 -3 Left 1145993531 17:29093072-29093094 CCTCACCACGTCCTCATTATCAG 0: 1
1: 0
2: 0
3: 15
4: 122
Right 1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG 0: 1
1: 1
2: 0
3: 15
4: 150
1145993524_1145993535 21 Left 1145993524 17:29093048-29093070 CCTCCTATCTTCCCCAAGCTCCC 0: 1
1: 0
2: 2
3: 28
4: 399
Right 1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG 0: 1
1: 1
2: 0
3: 15
4: 150
1145993525_1145993535 18 Left 1145993525 17:29093051-29093073 CCTATCTTCCCCAAGCTCCCTCC 0: 1
1: 0
2: 5
3: 35
4: 527
Right 1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG 0: 1
1: 1
2: 0
3: 15
4: 150
1145993532_1145993535 -8 Left 1145993532 17:29093077-29093099 CCACGTCCTCATTATCAGTGTCC 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG 0: 1
1: 1
2: 0
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145993535 Original CRISPR CAGTGTCCCCATAAGGATGC TGG Intronic
900565517 1:3329985-3330007 CACTGTCCCTTTAAGAATGCAGG + Intronic
900792822 1:4691167-4691189 CAGAGTCCCCATCAGGCTCCCGG + Intronic
901425460 1:9179974-9179996 CAGTGTTCCAGTAAGGATACGGG - Intergenic
901429392 1:9203710-9203732 CTGTGTCCCAAGCAGGATGCGGG - Intergenic
902242069 1:15095953-15095975 CATTGGCACCATCAGGATGCTGG + Intronic
905344485 1:37302173-37302195 GGGTGTCACCATAAGGAGGCTGG - Intergenic
905391020 1:37635212-37635234 CAGTTTCCCCATCAGGAACCTGG + Intergenic
908428630 1:64034037-64034059 CAGTGTCCAAGTAGGGATGCTGG + Intronic
913335940 1:117709073-117709095 CAGGGTCCTGATGAGGATGCAGG + Intergenic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
1065382422 10:25103286-25103308 CAGTGTCCCTGCAAGGATGGGGG - Intergenic
1067455344 10:46415144-46415166 CTGTGTTCCCATAAGGCTCCGGG - Intergenic
1067631860 10:47969491-47969513 CTGTGTTCCCATAAGGCTCCGGG + Intergenic
1068791043 10:61031594-61031616 CATTGGCCCCATGAGGAAGCTGG - Intergenic
1069737799 10:70669011-70669033 CAGTGTCCACAGAGGGCTGCTGG + Intergenic
1072675890 10:97465842-97465864 CAGTGTCTCCTTGACGATGCTGG + Exonic
1076382683 10:130036182-130036204 CAGTTTCCCCATCAGAATACAGG - Intergenic
1077269034 11:1666451-1666473 CAGTGGACTCATCAGGATGCCGG - Intergenic
1077271514 11:1684264-1684286 CAGTGGACTCATCAGGATGCCGG + Intergenic
1077296866 11:1830451-1830473 CAGGGTCTCCATGAGGCTGCTGG + Intronic
1078026490 11:7700546-7700568 CTGTTTCCTCACAAGGATGCTGG + Intronic
1078073575 11:8136325-8136347 CAGTGTGCTCACAAAGATGCAGG + Intronic
1079373559 11:19872291-19872313 TACTGACCCCATAAGGTTGCTGG - Intronic
1080381975 11:31781393-31781415 CAGTGTCCACGTGAGGAAGCAGG - Intronic
1081526614 11:43932022-43932044 AAGTGGGCCCATAAGGATGACGG + Intronic
1083678712 11:64341684-64341706 CAGTGTCCCCATCAGGCTCCGGG - Exonic
1083755307 11:64788967-64788989 CAGTGCCCCTAGAAGGCTGCTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086316774 11:85603261-85603283 CAGTTTCCCCAAAATGATGGTGG + Intronic
1090968258 11:131617024-131617046 CAGTGTCCCCCTCCAGATGCAGG - Intronic
1091728948 12:2865549-2865571 CAGAGTGCCCATAAGGCTGCTGG - Intronic
1092725483 12:11481467-11481489 AAGTGTCCCCATTAGAATGGTGG + Intronic
1096549479 12:52362762-52362784 CAGTGTGCCCATGAGGAAGCAGG - Intronic
1100739029 12:97570830-97570852 CACTGTCTGCATAAGGATGTGGG - Intergenic
1101404935 12:104419964-104419986 CAGTGTCCCAATAAGGTAGATGG - Intergenic
1104967053 12:132513022-132513044 CAGTGTCCCCACCAGGGCGCGGG - Intronic
1105351758 13:19622286-19622308 CAGTTTCCCTATTAGGAGGCTGG + Intergenic
1106933478 13:34692535-34692557 CTGTGTCCTCACAAGGAGGCAGG + Intergenic
1107381866 13:39865197-39865219 CACTGTCCCCAGAAGCTTGCTGG - Intergenic
1109219407 13:59626072-59626094 CAGTGTCCCCATGAGGATGCTGG - Intergenic
1109833433 13:67824372-67824394 CAGTGTCTCCATATAGATGCTGG + Intergenic
1111387531 13:87546181-87546203 CAGTGTCATCATAAACATGCTGG + Intergenic
1111972082 13:94926904-94926926 AAGGGTCCGCATACGGATGCTGG + Intergenic
1113825321 13:113247996-113248018 CCGTGTCCCCATCAGGATCCTGG + Intronic
1115081322 14:29454451-29454473 CATTGTCCCCAAAAGGATAAAGG + Intergenic
1116863001 14:50009254-50009276 CAGTGTGACCCTAAGGATGCCGG + Intergenic
1119760219 14:77145406-77145428 CAGTTTCCCCATAAGGAAAATGG - Intronic
1120887392 14:89462571-89462593 CAGAGTCCCCATCAGGAAGAAGG - Intronic
1121419392 14:93802010-93802032 CAGTGTCCTCATCAGAAGGCTGG - Intergenic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1123787934 15:23690923-23690945 CAGTGGCCCCCTAGGGAGGCTGG - Intergenic
1124488841 15:30141593-30141615 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124543924 15:30610557-30610579 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1126227922 15:46293082-46293104 CAGTGTCCCCATATCAATCCTGG + Intergenic
1127353513 15:58175635-58175657 CTGTGTCCCAAGAAGGCTGCTGG + Intronic
1128144089 15:65322695-65322717 CAGTGTCCCCATAGGAGTTCGGG + Intergenic
1129272426 15:74426330-74426352 CATGGACCCCATAAAGATGCTGG + Intronic
1134402308 16:13920896-13920918 AGGGGTCCCCAGAAGGATGCAGG + Intronic
1134915759 16:18069594-18069616 AAGTGTCCCCCTAAGGAGGGGGG + Intergenic
1136009841 16:27356411-27356433 CAGTCTCCCCAGTAGGATGCCGG - Intronic
1136104162 16:28017186-28017208 CAGTCACCCCAGAATGATGCTGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1138010454 16:53373982-53374004 GAGTGTTCCCAACAGGATGCTGG - Intergenic
1141096540 16:81167107-81167129 CTATGTCCCCACCAGGATGCTGG + Intergenic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1144441390 17:15285931-15285953 TAGTGTCCCCATGTGCATGCTGG - Intergenic
1145037419 17:19551137-19551159 CAGTGTCCCCAGAAGAGTCCTGG + Intronic
1145881145 17:28353625-28353647 CTTTGTCCCCATTGGGATGCAGG + Intronic
1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG + Intronic
1150572315 17:66397813-66397835 CAGTGGTGCCATCAGGATGCAGG - Intronic
1151480877 17:74369471-74369493 CAGTGTCTGCGTAAGGATCCTGG + Exonic
1152422021 17:80198620-80198642 CACTGTCCCCATGAGGAGCCCGG - Intronic
1152693718 17:81733654-81733676 CTGTGTCCCCACTAGGAAGCCGG + Intergenic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1154391130 18:13937047-13937069 CTTTGTCCCCATGAGGCTGCTGG - Intergenic
1156342031 18:36218411-36218433 CTGTTTCCCCAAAAAGATGCTGG - Intronic
1158254202 18:55527181-55527203 CAGTGTTGCCTTAAGGATGCGGG - Intronic
1162341647 19:10094860-10094882 CAGTGACACCAGTAGGATGCTGG - Exonic
1166733217 19:45070107-45070129 GAGTGTCCCCACCAGGCTGCAGG + Intronic
1167719496 19:51168657-51168679 CAGAGTCCCCATCTGGAGGCTGG + Intergenic
926582441 2:14645919-14645941 CAGTGTCCCTATTTGTATGCAGG - Intronic
927050649 2:19324889-19324911 TAGAGTCCCCATCAGGATCCAGG - Intergenic
927707472 2:25305717-25305739 CAGTGACACCATAAAGATACAGG + Intronic
927738781 2:25547593-25547615 CTGTCTTCCCATAAGGATACAGG - Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930271608 2:49263848-49263870 CAGTGTGCCTAGCAGGATGCTGG - Intergenic
932127353 2:69156081-69156103 CAGTGGCCCCATCAGCAAGCTGG - Intronic
936671402 2:114661519-114661541 CCGTGTCCCTGTAAGGATTCAGG + Intronic
946290223 2:218738835-218738857 CAGTTTCCTCAGGAGGATGCTGG + Exonic
947891689 2:233627833-233627855 CAGAGTGCCCCTAATGATGCTGG - Intronic
948903486 2:240967352-240967374 CAGGGTCGCCATCTGGATGCGGG - Intronic
1172149314 20:32779448-32779470 CTGTGTGCCCATAATGTTGCAGG + Intronic
1173224752 20:41155852-41155874 CAGTTTCCCCATCAGGAAACTGG - Intronic
1173904272 20:46614398-46614420 CAGTCTGCACATAAGGATGCCGG - Intronic
1175468732 20:59210580-59210602 CAGGGTCACCATGAGCATGCAGG - Intronic
1177666104 21:24161719-24161741 CAGAGTCCCCATCAGGAAGAAGG + Intergenic
1178438815 21:32582129-32582151 TAGCGTCCCCATAAAGATGTGGG - Intronic
1178902237 21:36606814-36606836 CGGTGTCCCCCTGTGGATGCAGG + Intergenic
1179381239 21:40901213-40901235 CAATGTCCCTGAAAGGATGCAGG - Intergenic
1181403729 22:22667358-22667380 GAGTGTCTCCTTAAGGATGCTGG - Intergenic
1182121252 22:27788306-27788328 CAGTGTCCACATCAGGATCGGGG + Intronic
1182460625 22:30481242-30481264 CAGAGTGGCCATTAGGATGCGGG - Intergenic
1183251052 22:36730614-36730636 AAGTCTCCCCATAAGAATGCTGG - Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
954332147 3:49896817-49896839 CAGTGTCCCCCTTAGCCTGCAGG - Exonic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
954635612 3:52069234-52069256 AAGTGACCCCATAAGACTGCTGG - Intergenic
958058628 3:88448075-88448097 CAGTGTCTCAATAAGGAACCTGG + Intergenic
958873433 3:99588897-99588919 CAGTGACCCCAAAAGGCTGATGG - Intergenic
968467855 4:761870-761892 CAGTGACACCATGGGGATGCAGG + Intronic
969087534 4:4667584-4667606 CAATCTCCCGATAAGAATGCGGG - Intergenic
969499972 4:7546662-7546684 CAGCGTCCCCATGAGGAGGCAGG - Intronic
970811589 4:20100458-20100480 CAGAGTCTCCACAAGGAAGCTGG + Intergenic
972342646 4:38165850-38165872 CAGTGTGCCCAAAGAGATGCTGG - Intergenic
975343195 4:73264051-73264073 CAGTGTCCCCTTAAGTGTCCGGG + Intergenic
977536265 4:98260222-98260244 CAGTGTCCCCTGAAGGACTCCGG + Intergenic
978523154 4:109637263-109637285 CAGTGTAACCATAAGGGAGCAGG + Intronic
984382069 4:179007422-179007444 CAGAGTCCCGAAAAGAATGCAGG + Intergenic
985378811 4:189370997-189371019 CACTGTCGTCACAAGGATGCAGG - Intergenic
986285853 5:6358536-6358558 CTGTGTCCCCATAGGAAAGCAGG + Intergenic
996492086 5:124110031-124110053 AAGTCTCCCCAAAAGGATGTGGG + Intergenic
997476841 5:134147493-134147515 CAGTTTCCCCATGGGGCTGCGGG + Exonic
998482236 5:142472403-142472425 CAGTGTCCTCATTAGGATCATGG + Intergenic
998538307 5:142954778-142954800 CAGTGTCTCCATAAGGACAAAGG - Intronic
999510675 5:152248113-152248135 CTGTGTCCCAACAAGGCTGCAGG + Intergenic
1002823031 6:746417-746439 CACTGTCTCCATGAAGATGCTGG - Intergenic
1003783920 6:9461548-9461570 CAGCTTCCCCATAAGGTTTCAGG - Intergenic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1006459248 6:34148784-34148806 CAAGGTCTCCCTAAGGATGCTGG + Intronic
1007988694 6:46232947-46232969 CTGTGGCCCCATGAGGATACTGG + Intronic
1008962871 6:57284058-57284080 CACTCTCCCCATAAGTATCCTGG + Intergenic
1009882932 6:69591768-69591790 CAGAATCCCCATAAGGATAAGGG - Intergenic
1013768136 6:113597010-113597032 AAGTGTCCCCATGATGCTGCTGG + Intergenic
1017767672 6:157620206-157620228 CAGTGTCCCCATCAGCAAGAAGG - Intronic
1022121341 7:27311223-27311245 CAGTGTCCTCATCTGGACGCTGG + Intergenic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1030104253 7:105973570-105973592 CAGTGTCCTCATAAGAAGACAGG - Intronic
1032988458 7:137364179-137364201 CATTGTCACCATGATGATGCAGG + Intergenic
1033848818 7:145469403-145469425 CCGTGGCCCCATATGGAGGCTGG + Intergenic
1035330822 7:158096326-158096348 CAGTTTCCCCACAAGGATGGAGG - Intronic
1035569560 8:663071-663093 CAGTGTCCCCGTCTTGATGCAGG - Intronic
1037998388 8:23369629-23369651 CAGTGCCCCGAAGAGGATGCTGG + Intronic
1040745991 8:50643230-50643252 CAGTGTCAGCATAAGAAAGCAGG - Intronic
1044215283 8:89602136-89602158 CAGTGTTGCCTTAAGAATGCTGG + Intergenic
1045290395 8:100827841-100827863 CAGTGTCCCAAAGAGGAAGCTGG + Intergenic
1045973998 8:108110792-108110814 CAGTGTCACAATAAGCATACAGG - Intergenic
1047625011 8:126647548-126647570 CAGTCTCCTCATGAAGATGCAGG - Intergenic
1049013628 8:139904827-139904849 CAGTCTCCCCTTCTGGATGCTGG + Intronic
1050165726 9:2763077-2763099 CAGTCTCCCCATAAGTTTGGAGG + Intronic
1053288377 9:36864491-36864513 CAGTGGCCCCATGAGGACTCTGG - Intronic
1057445011 9:95107666-95107688 CAGTGTTCCCATACGAATGTAGG + Intronic
1057796908 9:98164404-98164426 CAGAGACCCCATAAGGATTCTGG - Intronic
1058816797 9:108691822-108691844 CAGTGTAGCCACAAGGAAGCAGG + Intergenic
1059630434 9:116116221-116116243 CACTGTCCCAAGAAGAATGCAGG + Intergenic
1060878566 9:127101381-127101403 CTGTGTCCCCATAAGACTGTGGG + Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1185621205 X:1452483-1452505 CTGGGTCCCCATAGGGATGGGGG - Intronic
1186280418 X:7986976-7986998 CAGTGCCGCCATAAGAATGTGGG - Intergenic
1186353024 X:8759396-8759418 CAGTGCCGCCATAAGAATGTGGG + Intergenic
1188519519 X:31022086-31022108 GGGTGTCCTCACAAGGATGCAGG + Intergenic
1188870912 X:35370645-35370667 CAGTGTCCCCACAGGGATTAAGG - Intergenic
1190735869 X:53255874-53255896 CAGTGTCGCCCTGAGGAAGCAGG - Exonic
1191988303 X:67005625-67005647 CAGTATCACCATCAAGATGCAGG - Intergenic
1192278979 X:69663608-69663630 CAGTGCCCCAGTAAGGATTCTGG - Intronic
1196711949 X:118771592-118771614 CAGTGACACCATAATGTTGCAGG + Intronic