ID: 1145998055

View in Genome Browser
Species Human (GRCh38)
Location 17:29115673-29115695
Sequence CTCCCAGGCCACTCTCCTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145998048_1145998055 4 Left 1145998048 17:29115646-29115668 CCAAGGGACAAAGGGTACCTGTC 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1145998055 17:29115673-29115695 CTCCCAGGCCACTCTCCTCGGGG 0: 1
1: 0
2: 2
3: 29
4: 223
1145998042_1145998055 25 Left 1145998042 17:29115625-29115647 CCTCACACTCACAACTACCAGCC 0: 1
1: 0
2: 1
3: 25
4: 238
Right 1145998055 17:29115673-29115695 CTCCCAGGCCACTCTCCTCGGGG 0: 1
1: 0
2: 2
3: 29
4: 223
1145998047_1145998055 8 Left 1145998047 17:29115642-29115664 CCAGCCAAGGGACAAAGGGTACC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1145998055 17:29115673-29115695 CTCCCAGGCCACTCTCCTCGGGG 0: 1
1: 0
2: 2
3: 29
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145998055 Original CRISPR CTCCCAGGCCACTCTCCTCG GGG Exonic