ID: 1145998055 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:29115673-29115695 |
Sequence | CTCCCAGGCCACTCTCCTCG GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 255 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 29, 4: 223} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1145998048_1145998055 | 4 | Left | 1145998048 | 17:29115646-29115668 | CCAAGGGACAAAGGGTACCTGTC | 0: 1 1: 0 2: 1 3: 9 4: 117 |
||
Right | 1145998055 | 17:29115673-29115695 | CTCCCAGGCCACTCTCCTCGGGG | 0: 1 1: 0 2: 2 3: 29 4: 223 |
||||
1145998042_1145998055 | 25 | Left | 1145998042 | 17:29115625-29115647 | CCTCACACTCACAACTACCAGCC | 0: 1 1: 0 2: 1 3: 25 4: 238 |
||
Right | 1145998055 | 17:29115673-29115695 | CTCCCAGGCCACTCTCCTCGGGG | 0: 1 1: 0 2: 2 3: 29 4: 223 |
||||
1145998047_1145998055 | 8 | Left | 1145998047 | 17:29115642-29115664 | CCAGCCAAGGGACAAAGGGTACC | 0: 1 1: 0 2: 0 3: 9 4: 137 |
||
Right | 1145998055 | 17:29115673-29115695 | CTCCCAGGCCACTCTCCTCGGGG | 0: 1 1: 0 2: 2 3: 29 4: 223 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1145998055 | Original CRISPR | CTCCCAGGCCACTCTCCTCG GGG | Exonic | ||