ID: 1145998763

View in Genome Browser
Species Human (GRCh38)
Location 17:29119093-29119115
Sequence CTGGGGCCTGGCTGTATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145998763_1145998777 10 Left 1145998763 17:29119093-29119115 CCTCCAATACAGCCAGGCCCCAG 0: 1
1: 0
2: 3
3: 32
4: 281
Right 1145998777 17:29119126-29119148 CAGGGAGTTCTTGATAGGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1145998763_1145998767 -9 Left 1145998763 17:29119093-29119115 CCTCCAATACAGCCAGGCCCCAG 0: 1
1: 0
2: 3
3: 32
4: 281
Right 1145998767 17:29119107-29119129 AGGCCCCAGTACCCAGGACCAGG 0: 1
1: 0
2: 2
3: 33
4: 291
1145998763_1145998768 -8 Left 1145998763 17:29119093-29119115 CCTCCAATACAGCCAGGCCCCAG 0: 1
1: 0
2: 3
3: 32
4: 281
Right 1145998768 17:29119108-29119130 GGCCCCAGTACCCAGGACCAGGG 0: 1
1: 0
2: 0
3: 52
4: 329
1145998763_1145998774 5 Left 1145998763 17:29119093-29119115 CCTCCAATACAGCCAGGCCCCAG 0: 1
1: 0
2: 3
3: 32
4: 281
Right 1145998774 17:29119121-29119143 AGGACCAGGGAGTTCTTGATAGG 0: 1
1: 0
2: 1
3: 7
4: 112
1145998763_1145998776 9 Left 1145998763 17:29119093-29119115 CCTCCAATACAGCCAGGCCCCAG 0: 1
1: 0
2: 3
3: 32
4: 281
Right 1145998776 17:29119125-29119147 CCAGGGAGTTCTTGATAGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145998763 Original CRISPR CTGGGGCCTGGCTGTATTGG AGG (reversed) Intronic
900164843 1:1240558-1240580 CTGGGGCCAGGGTGAATGGGGGG - Intergenic
900397989 1:2461093-2461115 CTGGGACGTGGCTGCATTGGTGG + Intronic
901160086 1:7170468-7170490 CTGGGGCCTGTCGGGGTTGGAGG - Intronic
901312233 1:8278251-8278273 CTGGAGACTGGATGCATTGGAGG + Intergenic
903755012 1:25654465-25654487 CTGGGACCTGGCAGGCTTGGGGG - Intronic
903869018 1:26419012-26419034 CTGGGGCTGGGCTCTACTGGGGG + Intronic
904113329 1:28143752-28143774 CTGGGACAGGGCTGTCTTGGGGG - Intergenic
904365878 1:30010631-30010653 CTGGGGCCTGGCCAGAGTGGTGG + Intergenic
904888582 1:33760901-33760923 CTGGGGTCTTGCTGGATTGAGGG - Intronic
905156187 1:35984520-35984542 TTGGGGGATGGCTGGATTGGGGG - Intronic
905665355 1:39760329-39760351 CTGGGGTCTGGCTGGGTTTGAGG + Exonic
906680534 1:47723048-47723070 CCCGGGCCTGGCTGTACTAGGGG + Intergenic
907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG + Intronic
908711446 1:67019996-67020018 CTGAGGTCTGGCTGTTTTGTAGG - Intronic
908853625 1:68398055-68398077 CTGGAGCCTGGATATAATGGTGG + Intergenic
910255693 1:85245008-85245030 TTTGGGGCTGGCTGTACTGGAGG + Intergenic
910567223 1:88657985-88658007 CTGGAGCCAGGCTGTTTGGGTGG - Intergenic
917498079 1:175560473-175560495 CAGGGGCCTTGCCATATTGGCGG + Intronic
920297306 1:204966936-204966958 CTGGGGCCTGGCTGCACCGGCGG - Intronic
922966646 1:229696394-229696416 TTAGGGCCTTGCTGTCTTGGCGG + Intergenic
923276458 1:232401005-232401027 CTGGGGAATGGCTGGGTTGGAGG - Intronic
924374239 1:243388832-243388854 CTGGGTCCTGGCTATTTGGGAGG + Intronic
924451605 1:244183872-244183894 CTTGGGCCTGTCTGTAGTGGTGG - Intergenic
1063631145 10:7734875-7734897 ATGGAGCATGGCTGCATTGGAGG - Intronic
1064010337 10:11730356-11730378 CTGGGGCCTGGCTGAATTTGGGG - Intergenic
1064104538 10:12490015-12490037 CTGGGCTCTGGATGTGTTGGTGG + Intronic
1066065658 10:31759578-31759600 CTGGGGGATGGGTGTGTTGGGGG + Intergenic
1066417178 10:35232169-35232191 GTGGTGCCTGCCTGTAATGGGGG + Intergenic
1066705760 10:38175842-38175864 CTGGGGCCAGGCTGTGGTGTCGG + Intergenic
1067317491 10:45181666-45181688 CTAGAGCCTGGCTGCATGGGAGG + Intergenic
1067797856 10:49333779-49333801 TTGGGGCCTAACTGAATTGGGGG - Intergenic
1069058244 10:63866849-63866871 CTGGGGCCTGGCAGTAATGATGG + Intergenic
1069890739 10:71650870-71650892 CTGGGGCCTGGCAGGGTTTGTGG + Intronic
1071836338 10:89421821-89421843 CTTGGGCCTGCCTGTGTTGTAGG - Intergenic
1075008027 10:118844247-118844269 CTGGGCCCTGTCAGTAGTGGTGG + Intergenic
1075733747 10:124651688-124651710 CTGGGGCCTGCCTGCTCTGGAGG + Intronic
1076220553 10:128730023-128730045 CTGGGGCCTGGGTGCATGAGAGG - Intergenic
1076634315 10:131872665-131872687 CTGGGGTCTGGCTGAGTAGGAGG - Intergenic
1076835830 10:133020608-133020630 CTGGTGCCTGGCTGGATGGGGGG - Intergenic
1076875401 10:133213323-133213345 CTGAGGGCTGGCTGTGGTGGCGG - Intronic
1077179471 11:1205809-1205831 CTGGGGCCTCGCCGTGTTGCAGG + Intergenic
1077378452 11:2216374-2216396 CTGGGGCCTGGCTGTGAGCGGGG - Intergenic
1077443008 11:2577466-2577488 CTGGGGCCTGGGTGCCATGGGGG + Intronic
1078004545 11:7522761-7522783 CTGTGGCCTAGCTGTATGTGGGG + Intronic
1080187950 11:29513273-29513295 CTGGGGCCTGTCTGTTCTTGGGG - Intergenic
1081145916 11:39562531-39562553 CTGGGGCCAGGCTGTAATGCAGG - Intergenic
1081227187 11:40538286-40538308 CTGGGGCCTGTGTGGGTTGGGGG - Intronic
1081630777 11:44688240-44688262 CTGGGGCCAGGCTGCCTTGCTGG - Intergenic
1082166134 11:48953836-48953858 CTGGGGCCTGTCTGGGGTGGGGG - Intergenic
1082237063 11:49831131-49831153 CTGGGGCCTGTCTGGGGTGGGGG + Intergenic
1082241631 11:49878573-49878595 CTGGGGCCTGTCTGGGGTGGGGG - Intergenic
1083718594 11:64592890-64592912 CTGGGACCTGCCTGGACTGGGGG - Intronic
1084858956 11:72005843-72005865 CTAGGGGCTGGCTGTGTTGGGGG - Intronic
1085742522 11:79089240-79089262 GTGGGGCCTGGCCCTCTTGGGGG - Intronic
1085884970 11:80511069-80511091 CTGGGGCCTGCCTGGGGTGGGGG + Intergenic
1086305830 11:85481577-85481599 CTGGTGCTAGGCTTTATTGGGGG - Intronic
1088492459 11:110401217-110401239 TTGGGGCCAGGCTGTAGTGCAGG - Intergenic
1089323067 11:117639557-117639579 CTTGGGGCTGGGTGGATTGGGGG + Intronic
1089327740 11:117668937-117668959 CTGGGGGGTGGCAGTAGTGGGGG + Intronic
1089436450 11:118472867-118472889 CTGGAGGCTGGCTGCAGTGGTGG - Exonic
1089977016 11:122741707-122741729 CTGGGGCCTGGCTGTCGTGAGGG - Intronic
1092768340 12:11873008-11873030 CTGGGGCCTAGATCTTTTGGGGG + Intronic
1095556265 12:43508907-43508929 CTGGGGCCTGTCAGGGTTGGGGG - Intronic
1095957572 12:47815505-47815527 CTGGGGCAAGGCTGTGTTTGAGG - Intronic
1095968282 12:47883864-47883886 CTGGGAGCTGGCAGTACTGGAGG - Intronic
1096588760 12:52643522-52643544 CTGGGTCCTGGCTGGTCTGGAGG + Intergenic
1097173490 12:57129652-57129674 CTGGGGTAGGGCTGTGTTGGGGG + Intronic
1099172960 12:79387262-79387284 CTGGGCCATTGCTGTCTTGGAGG - Intronic
1099734055 12:86543869-86543891 CTGGGGCCTGACAGTCTGGGAGG + Intronic
1100429076 12:94514298-94514320 CTGGGCCCTGGATCTAGTGGTGG - Intergenic
1100758181 12:97775202-97775224 CTGGGAGCTGGCTGGAGTGGAGG - Intergenic
1100934636 12:99648811-99648833 ATGGGGCCTGGATGCTTTGGGGG + Intronic
1102278466 12:111599765-111599787 CTGGGGCCTGCCTGGTGTGGAGG + Intergenic
1103581339 12:121917916-121917938 CTGGGGCATGGCAGTGTGGGCGG + Exonic
1106543705 13:30713101-30713123 CTGGGGGCTGGGTGAACTGGTGG + Intergenic
1107241217 13:38236678-38236700 CTGGGGCCTGTTGGTAGTGGAGG + Intergenic
1108121967 13:47197842-47197864 TTGGGGACTGTCTATATTGGAGG - Intergenic
1108722787 13:53149032-53149054 CTGGGGGCTGGCAGAATTGTAGG - Intergenic
1111982308 13:95029927-95029949 CTGGGGCCTGTTTGAATAGGTGG - Intronic
1112029472 13:95443865-95443887 TTGGGGCCTTGCTGACTTGGGGG - Intronic
1112877782 13:104066633-104066655 CTGTGTCTTGACTGTATTGGTGG + Intergenic
1113647959 13:112012221-112012243 CTGGGGCCTGGCTGCTTCGCAGG - Intergenic
1117591960 14:57279514-57279536 CTGGGGCCTGTCAGTTGTGGGGG + Intronic
1117611665 14:57489361-57489383 CTGGGGCCTGTCAGGGTTGGTGG + Intronic
1119273165 14:73327907-73327929 CTGGGGACTGGGTGTGGTGGGGG - Intronic
1121225570 14:92319384-92319406 CTGGGGCGGGGCTGAAGTGGTGG + Intergenic
1121664218 14:95659474-95659496 CTGCAGCCTGGCTGGACTGGAGG - Intergenic
1121959252 14:98243540-98243562 ATGTGGCCTGGCTGGAGTGGAGG - Intergenic
1122792261 14:104189005-104189027 ATGGGGCCTGGCTGGCCTGGCGG + Intergenic
1123925936 15:25110633-25110655 CTGGGTCATTGCTGTGTTGGGGG + Intergenic
1123942099 15:25221630-25221652 GTGTGGCCTGGCTGTATGTGTGG + Intergenic
1124230072 15:27936962-27936984 CACTGGCCTGTCTGTATTGGTGG - Intronic
1124719796 15:32101654-32101676 CTGGGGACTGGCTGTGGTGCAGG - Intronic
1126092195 15:45062451-45062473 CTGGGGCCAGGCTGCGGTGGGGG - Intronic
1127042893 15:54996793-54996815 CTGGGGCCTGTCAGGAGTGGGGG + Intergenic
1128055928 15:64700117-64700139 GAGGGGCCTGGCTGTATGAGAGG - Intronic
1128374937 15:67067453-67067475 TTGGGGGCTGGCTCTTTTGGGGG + Intronic
1128529824 15:68436968-68436990 ATGGAGACTGGCTGCATTGGAGG - Intergenic
1130141917 15:81234741-81234763 CTAGGGCCTACCTGTATTAGAGG - Intronic
1132974065 16:2702829-2702851 CTGAGGCCTGGCTGTCATAGGGG + Intronic
1135971554 16:27075529-27075551 TTGGGGCTTGGCTCAATTGGTGG - Intergenic
1137457400 16:48628503-48628525 GTGGGGCCTGGCTGTTTTCAAGG - Intergenic
1137899196 16:52246427-52246449 TTGGGTTCTGGCTGTACTGGGGG - Intergenic
1138424372 16:56920962-56920984 CTGGGGCCTGTCAGTGTGGGAGG + Intergenic
1139261480 16:65598713-65598735 GTGGGGGCTGGCTACATTGGAGG + Intergenic
1141557492 16:84845706-84845728 CTGGGGCGTTGCTGTATTTATGG + Intronic
1141702621 16:85649536-85649558 CTGGGGCCTGCCTGTGTGGAAGG + Intronic
1142699605 17:1651017-1651039 TTGGGGCCTGGCTGGCTTGGAGG - Intronic
1142866491 17:2794575-2794597 CTGGGGACTAGCTGCCTTGGAGG + Intronic
1143322236 17:6075745-6075767 CTGGGGCTTGGCCTTATTGGGGG - Intronic
1143729559 17:8873284-8873306 CTGGGGCCAGACTGGGTTGGCGG - Intergenic
1145817314 17:27804857-27804879 CCAGGGCCTGGCTGTATTTATGG - Intronic
1145888326 17:28397772-28397794 CTGGAGCCTGGGTTTATTGGAGG - Exonic
1145907737 17:28525442-28525464 GTGGGGCCTGGGTGTATTCCTGG + Intronic
1145998763 17:29119093-29119115 CTGGGGCCTGGCTGTATTGGAGG - Intronic
1146556354 17:33827878-33827900 CTGGGGCCTGTCGGGAGTGGAGG - Intronic
1147213669 17:38886732-38886754 CTGCTGCCTGGGTGTCTTGGAGG + Intronic
1148379885 17:47188843-47188865 CAGGGGCCTGGCTTGACTGGGGG - Intronic
1149646714 17:58246490-58246512 CTGGGGCTGGGCTCTGTTGGGGG - Intronic
1151539899 17:74759524-74759546 CAGGGGCATGGCTGGACTGGGGG - Intronic
1151747481 17:76019087-76019109 CTCAGGCCAGGCTGCATTGGAGG + Intronic
1151844145 17:76639730-76639752 CTCTGGCCTGGCTGGCTTGGTGG - Intronic
1152888205 17:82864912-82864934 CGGGGGCCTGCTTGTGTTGGGGG + Intronic
1157152869 18:45236948-45236970 CTGGGGCCTGGAAGTCTTGGGGG + Intronic
1159169571 18:64747918-64747940 CTGGTTCTTGGCTATATTGGGGG + Intergenic
1159856777 18:73598352-73598374 GTGGGGCTTGGCTGTAGTGAAGG + Intergenic
1159906149 18:74094222-74094244 GTGGGAGCTGACTGTATTGGAGG + Intronic
1162420076 19:10561139-10561161 CTGGGGCCTGACTGGACTGCTGG - Intronic
1162494248 19:11014256-11014278 ATGGGGCCTGGCTGTCTTATAGG - Intronic
1164948797 19:32318686-32318708 CTGGGGCCTGGGGGCAGTGGAGG + Intergenic
1165118608 19:33544842-33544864 CTGGGGTCTGGCTGCGCTGGAGG - Intergenic
1165186977 19:34030939-34030961 GTGGGGCCTGGCTGCCTTGAGGG + Intergenic
1166071416 19:40390206-40390228 CTGAGCCCTGGCTGGAGTGGGGG + Intergenic
1166208886 19:41292516-41292538 GTGGGGCCAGAATGTATTGGTGG + Intronic
1166532526 19:43551647-43551669 CTAGGACCTGGCTGTACTTGGGG + Exonic
1166849942 19:45754894-45754916 CTGTGTCGTGGCTGTAATGGGGG + Intronic
1166941944 19:46372554-46372576 CTGGGGGCTGCGTGTATTTGGGG - Intronic
925050004 2:806044-806066 CTGGGAACTGGCTGTGCTGGTGG + Intergenic
925691481 2:6528599-6528621 CTGGGGCCTGGCTTGAAGGGTGG + Intergenic
925910305 2:8569506-8569528 CTGTGGCCTGGCTGTGGTGCTGG - Intergenic
926941239 2:18139248-18139270 CTGGGGCCTGTCGGGGTTGGGGG - Intronic
927032555 2:19137585-19137607 CTGTGGCCTGGGTGTAGTGATGG - Intergenic
928943692 2:36753194-36753216 CTGGGGCCTGTCAGAGTTGGGGG + Intronic
932421345 2:71603247-71603269 TTGGGTCCTGGCTGGTTTGGGGG + Intronic
932588026 2:73044439-73044461 CTGAGGCCTGGCTGTTCTAGTGG + Intronic
933746815 2:85577710-85577732 CTGGGGGTTGGCTGTGTCGGGGG + Intronic
937981662 2:127619410-127619432 GTGGGGGCTGGTTGGATTGGAGG + Intronic
939061002 2:137421329-137421351 CTGGTGCCTGGAGGTATGGGAGG - Intronic
939457995 2:142462936-142462958 CTGGGTCCTGTCTGTAATGTGGG + Intergenic
940592145 2:155742798-155742820 CTGTGGCCTGGCTGTTTCAGGGG + Intergenic
941501861 2:166289339-166289361 CTGGGGCCTGTCGGTGGTGGGGG - Intronic
941927218 2:170908280-170908302 CTGGGGCCTGTCTGGAGTGGGGG + Intergenic
942619575 2:177833146-177833168 GTGGGGGCTGGCTGTGTTAGTGG - Intronic
944969262 2:204973099-204973121 CTGGGGACTGGCTGCAAGGGAGG - Intronic
947943133 2:234076110-234076132 CTGGGGTCTTGCTGTGCTGGAGG + Intronic
948334185 2:237194666-237194688 CAGGGGCCTGGATTTATTGCAGG - Intergenic
948843670 2:240672713-240672735 CTGGGGCCTGGATGACCTGGTGG + Intergenic
948918705 2:241051602-241051624 CTGGGGCCTGGCTGCAGCAGGGG - Intronic
1168831679 20:848490-848512 CTGGGGCCAGGCTGGCCTGGGGG - Intronic
1168980976 20:2003224-2003246 CTGGGGCCTGGCTGGAGATGGGG + Intergenic
1170953777 20:20959695-20959717 GTGAGGCCTGGCTTTGTTGGAGG + Intergenic
1171391725 20:24805767-24805789 CTGTGTCCTGTCTCTATTGGTGG + Intergenic
1172232683 20:33347746-33347768 CTGGGCCCTGGCTGTCATGTTGG + Intergenic
1172259246 20:33547964-33547986 ATGGGGTCTTGCTGTATTGCAGG + Intronic
1172968776 20:38858394-38858416 CCGTGGCCTGGCTGCATTGAAGG + Intronic
1173548393 20:43915861-43915883 CTGGGACCTGGCTGGGGTGGGGG - Intronic
1173667039 20:44770455-44770477 CTGAGGGCTGTGTGTATTGGGGG + Intronic
1173944554 20:46940596-46940618 CTTGGTCCTGGCTGCATGGGTGG - Intronic
1174486746 20:50866007-50866029 CTGGGGGCCGGCGGTAGTGGGGG + Intronic
1174494553 20:50930732-50930754 CCGGGGCCAGGCTGCACTGGCGG + Intronic
1175262543 20:57683907-57683929 CTGTGGGCTGTCTGTTTTGGGGG + Intronic
1175463949 20:59176973-59176995 TATGGGCCTGGCTGTGTTGGAGG - Intergenic
1176181677 20:63752423-63752445 CCGAGGCCTGGCTGCCTTGGCGG + Intronic
1176365707 21:6031614-6031636 GTGGAGCCAGGCTGTCTTGGTGG + Intergenic
1177405631 21:20663965-20663987 CCGAAGCCTGGCTGTAATGGTGG - Intergenic
1179757809 21:43506931-43506953 GTGGAGCCAGGCTGTCTTGGTGG - Intergenic
1180149976 21:45942478-45942500 CCGGGGCCTGGGTGCATTGGGGG - Intergenic
1181005032 22:20009261-20009283 CTGCCGCCTGGCTGTGTGGGAGG - Intronic
1181938422 22:26455944-26455966 TTGGGAACTGGCTGTGTTGGGGG - Intronic
1183383844 22:37503822-37503844 CTGGGGCCTGGCTTTCTTGCCGG + Intronic
1184180533 22:42821034-42821056 CGGGGGCCTGCCTGAAGTGGAGG - Intronic
1184195369 22:42924122-42924144 CTGGGGCCTGGGGGTCTTGTGGG - Intronic
1185012465 22:48322160-48322182 CTAGGGCCTGGGTGTCTGGGAGG + Intergenic
950439885 3:13004438-13004460 CTGGGGCCTGGGTGTAGCTGAGG - Intronic
950492757 3:13316142-13316164 CTGGGGCCTGGCAGAGCTGGAGG - Intergenic
951843397 3:27059427-27059449 GTTGGACCTGGCTGTATTTGAGG - Intergenic
954083209 3:48224468-48224490 CTGGGGGCTGGGGGTGTTGGTGG + Intronic
954146820 3:48638693-48638715 TTGGGGTCTGGCTGTTTGGGAGG - Intronic
954852932 3:53618564-53618586 GTGGGTTCTGGCTGTATTTGGGG - Intronic
954874636 3:53793645-53793667 CTTGGGCCTGGCTGTGTTGCTGG + Intronic
955387193 3:58489206-58489228 CTGGGGCCAGGCTGACCTGGAGG - Intergenic
955502618 3:59599957-59599979 CTGAGGCCTGGCTGCATTCTTGG + Intergenic
956133777 3:66079007-66079029 CGGGGGCCTGGGGGTATAGGAGG + Intergenic
957992700 3:87648038-87648060 CTGGGGCCTGTCGGGAGTGGGGG - Intergenic
958003990 3:87789409-87789431 CTGGGGCCTGTCGTTTTTGGGGG + Intergenic
958975858 3:100667331-100667353 CTGGGGCCTGTCAGTGGTGGGGG - Intronic
959829701 3:110845683-110845705 CTGGGGCCTGTCTGGAGTTGAGG + Intergenic
961333060 3:126154291-126154313 CTGGGGCCCAGCTGTATTGGTGG - Intronic
962689851 3:137884143-137884165 CTGGGGCCTGTCAGTGGTGGGGG - Intergenic
963860735 3:150307813-150307835 CTGGTTTCTGGCTGTTTTGGTGG + Intergenic
966280371 3:178219641-178219663 CTGGGGCCTGTCAGGGTTGGGGG - Intergenic
967997801 3:195179973-195179995 CTGGAGCCTGCCTGTGTTGGGGG - Intronic
968762824 4:2451233-2451255 TTGGGGACTGGCTGTGGTGGGGG - Intronic
969883690 4:10196675-10196697 CTGGAGCCCAGCTTTATTGGGGG - Intergenic
970190484 4:13511562-13511584 CTGGGGCATGGCTGTCTTCCAGG - Intergenic
972423210 4:38909614-38909636 CTGGGGCATGCCTGGATTGTGGG - Intronic
975075189 4:70198131-70198153 CTGGGGCCTGGTTGTGTCTGAGG - Exonic
976826967 4:89271671-89271693 GAGAGGGCTGGCTGTATTGGGGG + Intronic
979487186 4:121283258-121283280 CTGGGGCCTGCCTGGCTTTGGGG - Intergenic
980101652 4:128547400-128547422 CTGGGGCATAGCTGTATGGAAGG + Intergenic
981371178 4:143960663-143960685 CTGGGGCTTGTCTGTAGTGGCGG + Intergenic
981656540 4:147118320-147118342 CTGGGGTATGGCTGTTTAGGAGG + Intergenic
982000886 4:151020047-151020069 CTTGAGCCTGGCTTTATAGGAGG - Intergenic
982747218 4:159116867-159116889 CTGGGGCCTGTCAGTGTTGGGGG + Intronic
983085732 4:163442094-163442116 GTGGGTCCTGGCTGTATTTTAGG + Intergenic
987835302 5:23153012-23153034 CTCTGGCTTGGCTGTTTTGGAGG - Intergenic
990064705 5:51698160-51698182 CCAGGGCCTGGTTGTGTTGGGGG - Intergenic
991098940 5:62770589-62770611 CTGGGGCCTGTGCGTGTTGGGGG + Intergenic
992445811 5:76832476-76832498 CTGTGGCCTGGCTGTTTAGGAGG + Intronic
992777807 5:80103609-80103631 CGTGGGTCTGGCTGTATTGGGGG + Intergenic
994409880 5:99393655-99393677 CTGTGGTCTGAGTGTATTGGTGG - Intergenic
994483940 5:100371620-100371642 CTGTGGTCTGAGTGTATTGGTGG + Intergenic
994731683 5:103499137-103499159 CTGGAGCCCGGCTTTCTTGGCGG + Intergenic
996289068 5:121829679-121829701 CTGGGGCCTCACAGTATTTGGGG + Intergenic
997692133 5:135834121-135834143 CTGGGGCCTGGCTGAATGTAGGG + Intergenic
998763045 5:145453618-145453640 CTGGGGCCTGTCAGGGTTGGGGG - Intergenic
999234050 5:150079955-150079977 CTGGGGACTGGGTGTGATGGGGG - Intronic
999302080 5:150497519-150497541 CTGGGACCTGGCTGGCATGGGGG + Intronic
999322812 5:150625427-150625449 CTGGGGTCTGGCTGTGCCGGTGG + Intronic
999726506 5:154442639-154442661 CTGGGGCCTGACTGGATGGAAGG + Intergenic
1000190532 5:158906062-158906084 CTGGGACCTAGGTATATTGGTGG - Intronic
1000320834 5:160133277-160133299 CTGGGTCTTGGCTGTCTTTGTGG + Intergenic
1001982605 5:176047095-176047117 CTGGGGCCTGGGTGTTTTCCTGG + Intergenic
1001990677 5:176113353-176113375 CTGGTGGCTGCCTGTAATGGTGG - Exonic
1002168007 5:177359942-177359964 CTGGGGCCAGGCAGTTCTGGGGG - Intronic
1002226196 5:177724787-177724809 CTGGTGGCTGCCTGTAATGGTGG + Exonic
1002234858 5:177796962-177796984 CTGGGGCCTGGGTGTTTTCCTGG - Intergenic
1002267654 5:178046426-178046448 CTGGTGGCTGCCTGTAATGGTGG - Exonic
1002767544 6:255443-255465 CTGTGGCCTGGCTGACGTGGAGG + Intergenic
1002853452 6:1017031-1017053 CTGGGGACTGGCTTGATTGGGGG + Intergenic
1003930657 6:10921038-10921060 CTGGGGCCTGGGTATGTTGGGGG - Intronic
1006465247 6:34190001-34190023 CAGGGGTCTGGCTGAAATGGGGG + Intergenic
1006923937 6:37643973-37643995 AAGAGGCCTGGCTGTCTTGGGGG - Intronic
1007834833 6:44666422-44666444 AGTGGGCCTGGCTGGATTGGGGG - Intergenic
1007859333 6:44890967-44890989 CTGGGGCCTGTCGGGGTTGGGGG + Intronic
1008972860 6:57390043-57390065 CTGGTGCCTGACAGTAATGGTGG - Intronic
1009161769 6:60291604-60291626 CTGGTGCCTGACAGTAATGGTGG - Intergenic
1009524960 6:64732148-64732170 CTGGGGCCTGTCGGGGTTGGGGG + Intronic
1010949532 6:82018776-82018798 GTGGGGGAGGGCTGTATTGGAGG - Intergenic
1011229366 6:85142843-85142865 CTGGGCCCTGCCTGGATTGGGGG - Intergenic
1014560089 6:122879461-122879483 CTGGGGCCTGTCAGTGGTGGGGG - Intergenic
1014974998 6:127869547-127869569 TTGGGGGCTGTCTGTATTTGCGG + Intronic
1015120295 6:129693529-129693551 GTGGGCCATGGCTGTAGTGGGGG - Intronic
1015514971 6:134074273-134074295 CCGGGGCCTGGCCCTCTTGGAGG + Intergenic
1015609357 6:134999289-134999311 CTGAGGGCTGCCTGGATTGGTGG - Intronic
1018288772 6:162268932-162268954 CTGGGACGGGGCTGTATAGGAGG + Intronic
1019051702 6:169188494-169188516 TTGGAGACTGGCTGGATTGGAGG + Intergenic
1019140122 6:169937659-169937681 CTGGGGCCTGGCCCTATGTGGGG - Intergenic
1019312629 7:370074-370096 CAGGGGCCTGGCTGTACCTGTGG + Intergenic
1019470515 7:1217955-1217977 GTGGGGCCTGGTAGTCTTGGTGG + Intergenic
1020049644 7:5072972-5072994 CCGGGCTCTGGCTGTATTGATGG + Exonic
1020605292 7:10329753-10329775 CTGGGGCCTGGGTGGAGTAGAGG - Intergenic
1020923570 7:14295858-14295880 CTGGGGCCTGTCTGGGTTGGGGG - Intronic
1021958929 7:25853008-25853030 CTGGGGCCCGCCTTTACTGGGGG + Intergenic
1022385333 7:29893526-29893548 CACGGGCCTGGCTGTCTGGGAGG - Intronic
1024009784 7:45257811-45257833 CTGGGGCCTGTCGGGGTTGGGGG + Intergenic
1024942438 7:54776593-54776615 CTGAGGCCTAGCTGACTTGGAGG - Intergenic
1029349622 7:100003937-100003959 GCGGGGCCTGGCTGTACTGATGG + Intergenic
1029459420 7:100686620-100686642 TTGGGGCCTGGTAGCATTGGCGG - Intronic
1031239553 7:119219910-119219932 CTGGGGCCTGAGTCTGTTGGGGG + Intergenic
1032098007 7:128949079-128949101 CTGGGGCCTAGCTGTATAGGAGG + Intronic
1033311431 7:140264747-140264769 CTGGGGCCTGGCTCAGCTGGAGG + Intergenic
1034461365 7:151199692-151199714 CTGGGGACTGGAGGGATTGGAGG - Intronic
1035168051 7:157003239-157003261 CCGGGGCCTGGCTCTGCTGGAGG + Intronic
1036618489 8:10406573-10406595 CAGAGTCCTGGGTGTATTGGAGG + Intronic
1037641540 8:20748613-20748635 CTGGGGCCTGTCAGGGTTGGGGG + Intergenic
1042040856 8:64587110-64587132 CTGGGACCTGGCAGGACTGGAGG + Intergenic
1042479372 8:69286194-69286216 CTGGGGCCTGTCAGGGTTGGGGG + Intergenic
1043636848 8:82395290-82395312 CTGGGACCTGGATGTCTTGTTGG + Intergenic
1043983255 8:86664852-86664874 CTGTGGTTTGGCTGTATTGATGG + Intronic
1045346130 8:101295112-101295134 CTGGGGCTTGGCCGTTTTGAGGG + Intergenic
1046068834 8:109225900-109225922 ATGTGGCATGGCTGTATTGTAGG - Intergenic
1048033452 8:130654424-130654446 CTGGGGCCTGTTTGTAGTGAGGG + Intergenic
1049183335 8:141234822-141234844 CTGGAGCCTGGCTGTGCTGGGGG - Intronic
1049241866 8:141541873-141541895 CTGGGTCCAGGCTGTCCTGGTGG - Intergenic
1049284341 8:141766496-141766518 CTGGGGCATGGCTCTGTGGGGGG + Intergenic
1049747514 8:144269276-144269298 CTGTGGCCTGGCAGGGTTGGGGG - Intronic
1051221231 9:14850551-14850573 CTGGGGCCTGTCGGGGTTGGGGG + Intronic
1051887094 9:21904554-21904576 CTGAGGCCTGTCTGGATTGGTGG - Intronic
1052192671 9:25677677-25677699 CTGGGCCCTGGCTGTAGCCGAGG - Exonic
1052833727 9:33235234-33235256 CTGGGGCCTGTGTGTATCTGGGG + Intronic
1055039926 9:71858538-71858560 CTGGAAACAGGCTGTATTGGTGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056303708 9:85268750-85268772 CAGGGACCTGGCTGTTCTGGGGG + Intergenic
1059350181 9:113658782-113658804 AGGGGGCCTGCCTGGATTGGTGG + Intergenic
1059663651 9:116425761-116425783 CTGGGGCCTGGGTGGGCTGGGGG - Exonic
1060220612 9:121762303-121762325 CTGGGGCCTGGCTCTCATTGCGG + Intronic
1061057750 9:128233321-128233343 CTGGGCCCTGGCCCTCTTGGTGG - Intronic
1061615027 9:131773897-131773919 CTGGGGCGTTGATGTAGTGGAGG + Intergenic
1062217708 9:135398320-135398342 CTGGGGCCAGGCTGTGCCGGGGG + Intergenic
1062388647 9:136325309-136325331 GTGGGTCCTGGCTGGATTGGGGG - Intergenic
1186504735 X:10082181-10082203 CTGGAGGCTGGCTGGAGTGGGGG - Intronic
1188413580 X:29904526-29904548 CTGGGGCCTGTCGGGGTTGGGGG - Intronic
1189456060 X:41191356-41191378 CTGGGGCCAGTATGTATTTGGGG - Intronic
1189707963 X:43778490-43778512 GTGGGCCCTGGCTGTGCTGGTGG - Intronic
1190561510 X:51690745-51690767 CTGGAGCCTGGTTGTAGTGGTGG + Intergenic
1190562781 X:51702570-51702592 CTGGAGCCTGGTTGTAGTGGTGG - Intergenic
1191046763 X:56146549-56146571 CTGGGGCCTGTCTGGATGTGGGG + Intergenic
1193893495 X:87081406-87081428 CTGGGGCCTGTCTGGAGTTGGGG - Intergenic
1194027436 X:88770428-88770450 CTCGGGCTTGGCTTAATTGGAGG - Intergenic
1194827088 X:98577223-98577245 CTGGGAGCTGGCTGTAGTGGAGG + Intergenic
1196508925 X:116482008-116482030 CTGGGGCCTGTCAGGAATGGGGG + Intergenic
1196534200 X:116822404-116822426 CTGGAGCCTGGATGTATGGAAGG + Intergenic
1196663681 X:118294600-118294622 GTGGTGCCTGGCTTGATTGGAGG - Intergenic
1199161348 X:144615572-144615594 CTGTGGCCTGTTTGTATTTGGGG - Intergenic
1200109698 X:153734024-153734046 CTGGGGTGTGGCTGAAGTGGTGG - Intronic
1201465732 Y:14278522-14278544 ATGGGGCCTGGAGTTATTGGAGG + Intergenic