ID: 1146001067

View in Genome Browser
Species Human (GRCh38)
Location 17:29130833-29130855
Sequence GGCTGGAGGCAGTGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 1, 2: 2, 3: 44, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146001065_1146001067 -10 Left 1146001065 17:29130820-29130842 CCCAATGCGCTGGGGCTGGAGGC 0: 1
1: 0
2: 2
3: 33
4: 1071
Right 1146001067 17:29130833-29130855 GGCTGGAGGCAGTGAGTAGCTGG 0: 1
1: 1
2: 2
3: 44
4: 408
1146001059_1146001067 13 Left 1146001059 17:29130797-29130819 CCAGGTTTATTCAGGGTCTCTAT 0: 1
1: 0
2: 0
3: 16
4: 180
Right 1146001067 17:29130833-29130855 GGCTGGAGGCAGTGAGTAGCTGG 0: 1
1: 1
2: 2
3: 44
4: 408
1146001056_1146001067 25 Left 1146001056 17:29130785-29130807 CCTTAGGAGAGTCCAGGTTTATT 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1146001067 17:29130833-29130855 GGCTGGAGGCAGTGAGTAGCTGG 0: 1
1: 1
2: 2
3: 44
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146001067 Original CRISPR GGCTGGAGGCAGTGAGTAGC TGG Intronic
900115824 1:1027508-1027530 TGCTGGACGCAGTGAGCAGGGGG - Intronic
900307430 1:2017962-2017984 GGCAGGGGCCAGTGAGCAGCCGG + Intergenic
900308651 1:2023078-2023100 GGCTGGATGCAGGGAGAGGCAGG + Intronic
900474261 1:2868926-2868948 GGGTGGAGGCAGTGTGAAGGCGG + Intergenic
901493755 1:9609819-9609841 GTCTGGAGACAGAGAGAAGCGGG - Exonic
901739824 1:11334751-11334773 GGCAGGGGGCATTGAGGAGCTGG + Intergenic
901815184 1:11789730-11789752 GCCTGGGGGCAGTGACTGGCAGG - Exonic
902401396 1:16159472-16159494 GGCCGGAGGCAGGGATTGGCAGG - Intergenic
902717339 1:18281785-18281807 GGGAGGAGGCAGCGAGGAGCTGG + Intronic
903321884 1:22548236-22548258 GGCGGGAGGCCGAGAGGAGCGGG - Intergenic
904402339 1:30265205-30265227 GGCTGGAGGCAATGAGGGGAGGG - Intergenic
904771760 1:32884911-32884933 GGCTGGAGGAACTGAGGAGCCGG - Intergenic
905540768 1:38758630-38758652 GGCTGGAGGTAGTGATGAGGAGG - Intergenic
905665671 1:39761618-39761640 GGCTGGGTGCAGTGAGTGGGAGG - Intronic
905733588 1:40312022-40312044 GGCAGGAGGCAGTGAACAGAGGG + Intronic
905943093 1:41879611-41879633 GGCTGGAGGCAGGGAGATGAAGG - Intronic
905961944 1:42050298-42050320 TGCTAGAGGCAGTGAGGAGCAGG - Intergenic
906561874 1:46764271-46764293 TGCTGGAGGCTGTGAGATGCTGG + Intronic
906671812 1:47661298-47661320 GGCAGGAGACAGAGAGCAGCTGG - Intergenic
907603587 1:55794078-55794100 GGCAGGAGCCAGGGAGAAGCAGG + Intergenic
907808970 1:57849613-57849635 GGCTTGAGGCATTAAGGAGCAGG + Intronic
909283177 1:73783620-73783642 GGCTGGAAGAAGTCAGGAGCAGG - Intergenic
914870986 1:151473525-151473547 GGCAGGAGGCACTGGGAAGCGGG + Intergenic
915916688 1:159944854-159944876 GCCTGGAGGCAGTGGGAAACAGG - Intronic
915938880 1:160105852-160105874 GGCTAGAGAAAGTGAGTAACGGG - Intergenic
916211134 1:162360862-162360884 GGCTGAAGTTAGGGAGTAGCAGG - Intronic
917255564 1:173112282-173112304 GGTTTGAGGAAGTGAGTAACAGG + Intergenic
918160991 1:181899512-181899534 GGCTGGAGGCAGTAAGTTGTAGG - Intergenic
918185296 1:182121375-182121397 GTATGGAGGCAGTGATTAGTAGG - Intergenic
918405448 1:184207744-184207766 GGGTGGAGGCTGTCAGTAGATGG + Intergenic
919045237 1:192442773-192442795 GGCTGGATGTAGTGAACAGCTGG + Intergenic
919132899 1:193473438-193473460 GGTTGGAGGCAGTGAGAGACTGG + Intergenic
919555078 1:199041882-199041904 GGCTGCAGGCAGAGAGTAGAAGG + Intergenic
919803961 1:201369710-201369732 GGCTGGGGGGTGTGAGTAGGCGG - Intronic
919927188 1:202198217-202198239 TGCTGGAGGCAGAGAGTAAGAGG + Intronic
919982523 1:202651110-202651132 GGCAGGAGGCAATGAGAAGAGGG + Intronic
920324169 1:205148725-205148747 GTCTGGATTCAGTGAGAAGCAGG + Intronic
920958987 1:210647555-210647577 GGCTGGGGGCGGTGGGAAGCAGG - Intronic
921092939 1:211860281-211860303 GGATGGGGGGAGTGAGAAGCAGG + Intergenic
921496907 1:215853298-215853320 GGCTGGAGCCACTGAGAAACAGG + Intronic
921840841 1:219826642-219826664 GGCTTGAGGCAGGGAGTTGGGGG + Intronic
922230840 1:223684244-223684266 TGCTGGCTGCAGTGAGGAGCTGG - Intergenic
922307207 1:224354582-224354604 GGCAGGATGAAGTGAGCAGCAGG - Intergenic
922897785 1:229113890-229113912 GGCTGTAGAGAGTGAGTAGGAGG - Intergenic
924429898 1:243988030-243988052 GGCTGGAGGGAGTGACCACCTGG + Intergenic
1063362296 10:5468520-5468542 GGCTGCAGCCAGAGAGCAGCAGG - Intergenic
1064599727 10:16981297-16981319 GGTTGGAGGAAGTGGGTTGCAGG - Intronic
1065845958 10:29743587-29743609 GGCTGGAAGGAGGGAGTGGCAGG - Intergenic
1066373714 10:34838676-34838698 GGGTGGAGGCAGGGAGATGCTGG + Intergenic
1067286462 10:44911163-44911185 GGCTGGAGGCAGTCTGGAGCTGG - Intergenic
1067464467 10:46487032-46487054 GGCTATAGGCAGTGGGAAGCAGG + Intergenic
1067622729 10:47897625-47897647 GGCTATAGGCAGTGGGAAGCAGG - Intergenic
1067681552 10:48445053-48445075 GCCTGGAGACAATGGGTAGCTGG + Intergenic
1068199179 10:53761007-53761029 GGCTGAAGGCAAAGAGAAGCTGG + Intergenic
1070442724 10:76462752-76462774 TGTGGGAGGCACTGAGTAGCTGG - Intronic
1070942177 10:80357269-80357291 GGCGGGAGGCAGAGAGGAGCGGG + Intronic
1070955535 10:80461065-80461087 GGCTGGAGGCAGGGACTTGTAGG - Intronic
1070971033 10:80567448-80567470 AGCTGGATGCAGTGACTGGCTGG - Intronic
1072257284 10:93632042-93632064 GGCGGGAGGCCCTGAGAAGCTGG - Intronic
1072524317 10:96258105-96258127 GGCTGGAGGAAGTGAGCATTAGG - Intronic
1073075839 10:100825595-100825617 GGCCAGAGGGAGTGAGTTGCTGG - Intronic
1075448331 10:122529379-122529401 GCCTGGGGGCAGGGAGTAGAAGG - Intergenic
1075826354 10:125359859-125359881 GGCTAGAGAAAGTGAGGAGCGGG - Intergenic
1076218694 10:128716035-128716057 GGCTGCAGGCAGTGAGGTTCAGG + Intergenic
1076719314 10:132386333-132386355 GGGTGGAGGCAGGGATGAGCTGG + Intergenic
1076998111 11:308928-308950 GGGAGGAGACAGTGAGGAGCTGG + Intronic
1077075342 11:698628-698650 GGCTGGAGACAGCGAGTACCGGG - Intronic
1077316113 11:1920078-1920100 GGCAGGAGGCAGAGAGGTGCGGG + Intronic
1077372498 11:2190023-2190045 GGCTGGAGGCAGAGACCGGCCGG + Intergenic
1077439742 11:2562298-2562320 GGCTGGCGGCTGGGAGCAGCTGG + Intronic
1078086207 11:8234332-8234354 GGCTGGAGGGAGAGAGTGGGAGG - Intronic
1078581706 11:12544012-12544034 GGCTGGCAGCAGTGGGTAGTTGG + Intergenic
1078941492 11:16011568-16011590 GCCTGGAGGCAGTGAGGAAAAGG - Intronic
1079096991 11:17517409-17517431 GGATGGAGGCACGGAGGAGCAGG - Intronic
1079138281 11:17788842-17788864 GGGTGGATGGAGTGAGCAGCTGG - Intronic
1079315821 11:19407045-19407067 GGATGGAGGCAGGGAGGAGATGG + Intronic
1081788256 11:45763847-45763869 GGCTAGAGGCAGTGGGTAATGGG + Intergenic
1082800354 11:57409825-57409847 GCCTGGAGGCAGTCAGGTGCGGG - Intronic
1082811186 11:57479960-57479982 GGCATGAGGTAATGAGTAGCTGG - Intergenic
1083662492 11:64258244-64258266 GGGTGGAGGGAGTGAGGAGAGGG + Intronic
1083881092 11:65548632-65548654 GGCTGGAGGCAGGGAGTCCTGGG - Intronic
1083961181 11:66015863-66015885 GGCCGGAGGGAGTCAGGAGCGGG - Intergenic
1084705212 11:70812311-70812333 GGTTGCAGGCAGTGATTACCGGG + Intronic
1084758789 11:71255282-71255304 TGCTGAAGGCAGTGAGCATCTGG - Intergenic
1084934258 11:72578666-72578688 GGCCTGAGGCAGGGAGTGGCTGG + Intronic
1085402043 11:76241256-76241278 GGCTGGAGGCAGTGAGTAGAGGG - Intergenic
1085738521 11:79060177-79060199 GTCGGGAGGCAGTGAGAAGCTGG - Intronic
1086570226 11:88275062-88275084 GGGTGCAGGCAGAGAGCAGCCGG + Intergenic
1087151095 11:94860605-94860627 GGTGGGAGGCAGTGAGGGGCTGG - Intronic
1088774017 11:113064292-113064314 GCCTGGAGGCACTGAGAAACTGG - Intronic
1089100113 11:115955945-115955967 GGCTTGCAGCAGTGAGTAGTGGG - Intergenic
1089824217 11:121258986-121259008 GGCTGGAGGCAGGGAGGTGGGGG - Intergenic
1090211065 11:124921354-124921376 GGCGGGAGACACGGAGTAGCCGG + Exonic
1090671263 11:128947303-128947325 GGCTGCAGGAAGTGAGTGGTGGG - Intergenic
1091569052 12:1668772-1668794 TGCTGGAGGCAGTGAATCTCAGG + Intergenic
1091621151 12:2090081-2090103 GGCTGGAGGCAGGGAGAAATGGG - Intronic
1091680799 12:2525241-2525263 GGCTGGAAGGAGAGAGAAGCTGG + Intronic
1092964141 12:13625423-13625445 GGCTGGTGGCAGTGGGAGGCAGG + Intronic
1093214153 12:16343468-16343490 GGGTGGGGGCAGTGATTAGCTGG - Intergenic
1095306515 12:40645093-40645115 GGGTGGAGGCAGTGGGAAGCGGG - Intergenic
1095968111 12:47882985-47883007 CCCTCGAGGCAGGGAGTAGCAGG + Intronic
1096629406 12:52916154-52916176 GGCTGCAGGAAGGGAGGAGCAGG + Intronic
1097043098 12:56168048-56168070 AGCGAGAAGCAGTGAGTAGCAGG - Exonic
1097218489 12:57432306-57432328 GGCAGGAGGCAGTGATGACCAGG - Intergenic
1097283475 12:57860266-57860288 GGATGGAGACAGTGAGCAGTGGG + Intergenic
1100903463 12:99270374-99270396 GGTAGGAGGCAGTGAGTAGTAGG - Intronic
1102259258 12:111434308-111434330 GGCTGGAGGCAGGGAGTTTGGGG - Intronic
1104727218 12:131085418-131085440 GGCGGGAGGCAGGGAGGAGCAGG + Intronic
1105008631 12:132739106-132739128 GGGTGGAGGGAGTGAGGAGGAGG + Intronic
1106252663 13:27994544-27994566 GGCTGGAGGAAGGGAGAAGTGGG + Intergenic
1106532066 13:30602308-30602330 GGCTGTAGTCAGTTAGCAGCTGG - Intronic
1106594433 13:31124437-31124459 GGCAGGAGGGAGTGAGAAGGGGG - Intergenic
1110723683 13:78794961-78794983 GGCTGGAGGCAGAGAGAAAGCGG + Intergenic
1112802195 13:103124745-103124767 GGTGGGAGGCAGTGGGTAGAAGG + Intergenic
1113077977 13:106487083-106487105 TGCTGGAGGCAGTGGGTGGATGG + Intergenic
1113581981 13:111436487-111436509 GGAGCGAGGCAGTGAGGAGCAGG - Intergenic
1115346622 14:32349527-32349549 GGCTTGATGCAGTGAGTAATAGG + Intronic
1117543629 14:56772409-56772431 TGGTGCAGGCAGTGAGGAGCGGG - Intergenic
1117594719 14:57314632-57314654 GGCAGGAGGAAGAGAGAAGCGGG + Intergenic
1121011332 14:90521896-90521918 GGCGCGAGGCAGGGAGAAGCAGG - Intergenic
1121580535 14:95026343-95026365 GGCTGGAGCCTGTGACTGGCAGG - Intergenic
1121825835 14:97008700-97008722 GGCTGGAGGCAGTGGCTGGTGGG - Intergenic
1122279827 14:100615166-100615188 GGCTGGAGGGAGAGGGTAGAGGG + Intergenic
1122309040 14:100783182-100783204 GGCTGGAGCCCGTGAGAGGCAGG + Intergenic
1122359748 14:101152212-101152234 TGCTGGAGGGAGAGAGGAGCGGG + Intergenic
1122422845 14:101588356-101588378 GGCTCCAGGCAGTGAGCAGGGGG - Intergenic
1122943251 14:104992773-104992795 GGCATGAGGCAGCGAGTGGCAGG + Intronic
1123983522 15:25624227-25624249 GCCTGGAGTCTGTGAGCAGCAGG - Intergenic
1124600822 15:31131739-31131761 GGGTGGAAGCAGTGAGTGGGTGG + Intronic
1127819195 15:62640361-62640383 GGCTAGAGGCAGAGAGAAGAGGG + Exonic
1128113993 15:65094224-65094246 GACAGGAGGCAGAGAGCAGCAGG - Intronic
1128452481 15:67813750-67813772 GGCTGGAGGCAGGCAGGGGCAGG - Intergenic
1128582608 15:68819786-68819808 CGCTGGAGGCAGGGAGACGCGGG + Intronic
1128682380 15:69661454-69661476 GGGTGCAGGCATTGAGTAGGTGG + Intergenic
1128980065 15:72179499-72179521 GGCAGGAGGCAGAGAGAAGCAGG + Intronic
1130103476 15:80911890-80911912 GGCTGGAGGCTGGGAGAGGCTGG + Intronic
1132034387 15:98469125-98469147 GGCTGGAGGGAGTGAGTGGAAGG + Intronic
1132802806 16:1762600-1762622 GGCGGGAGCCAGAGAGTCGCAGG + Intronic
1132808630 16:1787301-1787323 GGCTGGTGGGAGTGAGGCGCAGG + Intronic
1133021276 16:2967963-2967985 GGCTGGAGGCACTCAGAGGCCGG - Exonic
1133041791 16:3064873-3064895 GGCTGGGGGCCGTGAGGAGGAGG + Intergenic
1134208093 16:12253842-12253864 GGGTGGAGGCAGAGAAGAGCTGG + Intronic
1134795996 16:17037619-17037641 AGCTTGAGGCACTGAGTAGGTGG + Intergenic
1135130959 16:19853585-19853607 TGCTGGAGGCAATTAATAGCTGG - Intronic
1136046905 16:27622306-27622328 GACTGGGGGCAGGGAGTAGGGGG + Intronic
1136559810 16:31032707-31032729 GGCTGGGGGGTGTGAGTGGCAGG + Intergenic
1136576090 16:31126261-31126283 GGCTGGAGGCAGGGAGTCTGAGG + Intronic
1137686493 16:50390459-50390481 AGCTGGGGGCTGTGAGAAGCAGG + Intergenic
1138024354 16:53511228-53511250 GGCTAGGGGCTGTGAGAAGCGGG + Intergenic
1139430660 16:66909430-66909452 GGCTGGGGGCTCTGAGCAGCTGG - Intronic
1141045464 16:80712590-80712612 GGCTGGAGGCAGAAAGAAGGTGG + Intronic
1141099110 16:81184197-81184219 GGCTGGACCCAGTTAGAAGCTGG - Intergenic
1141165229 16:81655810-81655832 GACGGGATGCAGTGACTAGCAGG - Intronic
1141281947 16:82636892-82636914 TGCTGGAGCCAGTTAGTATCAGG - Intronic
1142704295 17:1684676-1684698 GGCTGGATGCACTGTGTGGCGGG - Exonic
1142714145 17:1738824-1738846 TGATGGAGGGAGTGAGGAGCAGG + Intergenic
1143048241 17:4100320-4100342 GGCTGGAGGGAGTGAGCAGGAGG + Intronic
1143101868 17:4508991-4509013 GGCTGGAGGCAGGGAGTCCAGGG + Intronic
1143977893 17:10843956-10843978 GGCGGGAGGGAGAGTGTAGCTGG - Intergenic
1145889392 17:28404535-28404557 ATCTGGGGGCAGTGAGTGGCCGG + Intronic
1146001067 17:29130833-29130855 GGCTGGAGGCAGTGAGTAGCTGG + Intronic
1146258386 17:31404982-31405004 GGCTGGAGGCAGGAGGTGGCAGG + Intronic
1146574901 17:33982332-33982354 GGCTGGAGACAGTTACTGGCTGG + Intronic
1146792614 17:35760963-35760985 GGCTGGAGGCAGGGTGGGGCTGG + Intronic
1147134435 17:38427098-38427120 AGCTGGAGGAAGTAAGAAGCAGG + Intergenic
1147325945 17:39669681-39669703 GGCTGCAGGCACTGAGCAGCTGG - Exonic
1147426635 17:40348845-40348867 GGCAGGAGGCAGTTAGGAGCAGG + Intronic
1147620724 17:41865043-41865065 GGCTGGAGGCCGCGAGTTCCGGG - Exonic
1147661946 17:42121424-42121446 AGCTGGAGGCAGTGAGGGGAAGG - Exonic
1148018071 17:44536547-44536569 GGGAGGTGGCAGTGAGTGGCAGG + Intergenic
1148074383 17:44927132-44927154 GGCTGGAGGGAGGAAGTGGCTGG - Intronic
1149044799 17:52232303-52232325 GGCTGGAGGAAGTGAAGAGAGGG - Intergenic
1149080451 17:52650289-52650311 GTGAGGAGGCAGAGAGTAGCTGG + Intergenic
1149160525 17:53687292-53687314 GACAGGAGGCAGGGACTAGCGGG - Intergenic
1149638665 17:58189674-58189696 GGGTGGAGGCAGTGAGTGCAAGG - Intergenic
1150810175 17:68350063-68350085 GGCGGGATGCAGTGAAGAGCAGG + Intronic
1152104829 17:78322912-78322934 GGCTGGAGGCTGAGTGGAGCAGG - Intergenic
1152294137 17:79456844-79456866 GGCTGGGGACAGAGAGTAGAGGG - Intronic
1152299100 17:79485074-79485096 GGCTGGTGGGAGAGAGCAGCGGG - Intronic
1152681391 17:81670175-81670197 GGCAGGAGGCAGACAGTGGCAGG - Intronic
1152759721 17:82101558-82101580 GGGTGGAGGCAGGGAGCTGCAGG - Exonic
1156351473 18:36305721-36305743 GGCTGGAGACTCTGAGTAGTGGG + Intronic
1156486832 18:37471742-37471764 GGCAGGTGGAAGTGAGTAGAGGG - Intronic
1157036244 18:43978489-43978511 GTCTGGAGTCAGTGTGTGGCGGG + Intergenic
1158818932 18:61135979-61136001 AGCTGGATGCAGTGACTAGCTGG - Intergenic
1159023092 18:63158944-63158966 GGCTGGAGGCAGTGGGATGGGGG - Intronic
1160119921 18:76121200-76121222 TGGTGGAGGCAGTGAGTGGCTGG - Intergenic
1160392267 18:78543140-78543162 GGCTGGAGGCAGGTAAGAGCCGG + Intergenic
1161091033 19:2360191-2360213 GGCTGGAGGAAGGGAGGGGCGGG - Intergenic
1161158435 19:2747630-2747652 CTGGGGAGGCAGTGAGTAGCGGG + Intergenic
1161158445 19:2747664-2747686 ACTGGGAGGCAGTGAGTAGCGGG + Intergenic
1162449516 19:10746288-10746310 GGCTGGAGGCAGGGAGTGAGGGG + Intronic
1162671861 19:12264385-12264407 GGCCTGAGGCAGTGACTAGAAGG - Intronic
1162763075 19:12900040-12900062 GTCTGGGGGCTGTGAGTTGCCGG + Exonic
1162971107 19:14182078-14182100 GGCTGCAGCCAGGGAGTGGCCGG - Intronic
1164696228 19:30246559-30246581 GGACGGGGGCAGTGTGTAGCTGG - Intronic
1164714775 19:30383548-30383570 GGGAGGAGTAAGTGAGTAGCAGG - Intronic
1165390228 19:35534481-35534503 GGGAGGACGCAGTGAGGAGCTGG + Intronic
1165528891 19:36379753-36379775 GGGTGTATGCAGTGAGTAACTGG - Intergenic
1165783394 19:38446747-38446769 GGCTGGAGCCACTGAGAATCAGG + Exonic
1165855636 19:38878127-38878149 GGCTGTGGGCAGTGCGTGGCAGG + Intronic
1166299211 19:41904693-41904715 GGCTGGAGGGTGGGAGTGGCTGG + Intronic
1166309022 19:41952055-41952077 GGCTGGAGGGAGTGAGACGAGGG - Intergenic
1167421165 19:49404197-49404219 GGCTGGAGGGAGGGAGAGGCTGG + Intronic
1167506052 19:49871658-49871680 GGCTGGGGGCACTGAGCAGGTGG + Exonic
1167793821 19:51696215-51696237 GTCTGGAGGCCGGGAGAAGCTGG + Intergenic
1168225549 19:54992354-54992376 GGCTGGAGACGATGAGTAGAAGG + Intronic
1168498680 19:56875418-56875440 GGATGGAGGCAGTGAGAGACAGG - Intergenic
924985123 2:263972-263994 GGCGGGCAGCAGTGAGTACCCGG - Exonic
925011919 2:492409-492431 GGGTGGAGGCAGCAAGGAGCGGG - Intergenic
925559091 2:5168426-5168448 GGCTGGGGGCAGTGAAGAGCTGG + Intergenic
926466902 2:13202122-13202144 AGCTGGTGGCAGTGTGTAGATGG + Intergenic
926931746 2:18048091-18048113 GTCTGGGGGCAGGGAGTGGCTGG - Intronic
927199883 2:20571631-20571653 GGCTGGAGGGAGTGAGCAGTGGG - Intronic
928282287 2:29958854-29958876 GGCAGAAGGCAGGGAGCAGCAGG + Intergenic
929246434 2:39708253-39708275 GGCTGGAGGGAGTGAGGGACAGG + Intronic
929485074 2:42345843-42345865 GCCTGGAGGAGGTGAGTAGAGGG + Intronic
929576961 2:43057985-43058007 GGCTGCAGGGAGAGAGCAGCAGG - Intergenic
930774929 2:55162044-55162066 GGCTGGAGGTAATGAGAAGCGGG + Intergenic
932732047 2:74228212-74228234 GGCTGGAGGTAGGAAGAAGCTGG - Intronic
933895618 2:86807855-86807877 GGCTGAAGGCAGGCAGGAGCAGG + Intronic
933966588 2:87434834-87434856 ATCTGGAGGCAGTCAGTTGCTGG + Intergenic
934555012 2:95282472-95282494 GGCTGGTGACAGTGAGCAGGAGG + Intronic
934612903 2:95753944-95753966 GGCTGGGGGCAGGGAGGAGCTGG - Intergenic
935709262 2:105882694-105882716 GGCTGGGGGCGGTGAGTTTCAGG + Intronic
936327205 2:111515650-111515672 ATCTGGAGGCAGTCAGTTGCTGG - Intergenic
937339631 2:121082783-121082805 GGCTGGAGGCAGGGGCCAGCAGG + Intergenic
938093208 2:128446668-128446690 GGGTGGTGGCAGGGAGCAGCTGG + Intergenic
938263619 2:129911573-129911595 GGCAGGAGGCTATGAGAAGCTGG - Intergenic
938744034 2:134260144-134260166 GTGTTGAGGCAGTGAGAAGCCGG + Intronic
939553316 2:143642815-143642837 GGCTGGAGTCAGTGCTTGGCTGG - Intronic
939780804 2:146445377-146445399 GTTTAGAGGAAGTGAGTAGCTGG + Intergenic
939902544 2:147867821-147867843 AGTGGGAGGCAGTGAGTGGCAGG - Intronic
939969637 2:148644876-148644898 GGCCGGGGGCAGTGAGGAGGAGG + Intronic
942037855 2:172028329-172028351 GGCTGGCGGCAGTGAGTGACAGG + Intronic
942510015 2:176688150-176688172 CTCTGGAGGGAGTGAGTTGCTGG + Intergenic
945100266 2:206256809-206256831 GGCTTGAGGCAGGGAGGACCTGG + Intergenic
945238355 2:207653600-207653622 GGATGGAGGCAGAGAGGAGCTGG + Intergenic
946168106 2:217877680-217877702 GGCTGCAGGCAGTGAGGAAAGGG + Intronic
946676952 2:222170426-222170448 GGCTGAAGGCAATGAGGAGCAGG + Intergenic
948012742 2:234662964-234662986 GGTGGGAGGCAGTGGGTAGGAGG - Intergenic
948272649 2:236686384-236686406 GGCTGGAGCCACTGAGTGGATGG - Intergenic
948342423 2:237265102-237265124 GGCTGGAGGCCTTGGGGAGCTGG - Intergenic
948424400 2:237878098-237878120 GGCTGCAGTGGGTGAGTAGCGGG + Intronic
948737396 2:240017875-240017897 GGCTGGAGCCAGTGGAAAGCTGG - Intronic
948889621 2:240900714-240900736 GGCAGGAGTCAGTGTGGAGCAGG - Intergenic
1170837247 20:19895012-19895034 GGCTGGAGGCAGGGATTGGTGGG - Intronic
1171126413 20:22605755-22605777 GGCTTGAGAGAGTGAGAAGCTGG + Intergenic
1171354587 20:24534288-24534310 GGGTGGAGGCTGTGAGGAGGGGG - Intronic
1171976378 20:31597278-31597300 GACTGGAGGCAGTGAAGGGCTGG + Intergenic
1172515105 20:35527996-35528018 TGCTGAAGGCATTGAGGAGCAGG + Intronic
1172777998 20:37418470-37418492 GGGAGCGGGCAGTGAGTAGCAGG - Intergenic
1172810501 20:37644254-37644276 GGCAGGAGGGAGGGAGAAGCAGG - Intergenic
1173326624 20:42039481-42039503 GGCTGGGGGCAGGGAGTGGGAGG - Intergenic
1173849167 20:46207146-46207168 ATGTGGAGGCAGTGAGGAGCTGG - Intronic
1175074508 20:56361266-56361288 GGCGGGAGACAGGGAGTAGGAGG - Intronic
1175221341 20:57418474-57418496 GGTTGGAGGCAGTGAGCAAGGGG - Intergenic
1175564557 20:59962764-59962786 GGGTGGAGGCAGAGAAGAGCTGG + Intronic
1175907153 20:62386598-62386620 GGCCCGGGGGAGTGAGTAGCAGG + Intergenic
1177155503 21:17497389-17497411 GGGTTGAAGGAGTGAGTAGCAGG - Intergenic
1177667158 21:24175526-24175548 GGCTAGAGGCAATGAGCAGAAGG - Intergenic
1179032365 21:37731804-37731826 GGGTGCAGGCAGTGAGAAGGCGG + Intronic
1179818959 21:43925402-43925424 GGCTGGAGTGTGTGAGCAGCAGG - Exonic
1179853580 21:44150919-44150941 GGCTGGACCCAGGGAGCAGCGGG - Intergenic
1179910453 21:44444629-44444651 CGCTGGGGGCAGTGTGGAGCAGG + Intergenic
1180078537 21:45475525-45475547 GGGAGGAGACGGTGAGTAGCCGG + Exonic
1180179347 21:46111146-46111168 GGCTGGGTGGAGTGGGTAGCTGG - Intronic
1180721343 22:17910989-17911011 GGGTAGAGGAAGTGAGGAGCCGG + Intronic
1180910766 22:19448326-19448348 GTATGGAGGCGGTGTGTAGCAGG + Intergenic
1181694085 22:24584428-24584450 GGATGGAGGCAGTGAGGAAAAGG - Intronic
1182548322 22:31088103-31088125 AACTGGCTGCAGTGAGTAGCGGG + Exonic
1182825009 22:33257483-33257505 GGTGGGAGGGAATGAGTAGCTGG + Intronic
1183310787 22:37108506-37108528 GGCAGGAGGGAGTGAGGAGCAGG - Intronic
1183661760 22:39225444-39225466 GGCTGGGGGCATTGAGGGGCTGG + Intronic
1184099304 22:42333719-42333741 GGCTGTGGGCAGTGAGTTACAGG - Intronic
1184386916 22:44181771-44181793 GCCTGGAGGAAGTGAGCAGCGGG + Exonic
1184913291 22:47550234-47550256 GGCTGGATGCATCGAGTACCTGG + Intergenic
1184972558 22:48036818-48036840 GGGTGGAGGCAGAGAGGAGCAGG - Intergenic
1185012577 22:48322549-48322571 GGCGGGAGGCTGTGAGTCCCAGG + Intergenic
949539900 3:5024284-5024306 GGCTGGAGGGAGAGAGGAGTGGG - Intergenic
950012406 3:9732440-9732462 GGCTGGAGGAAGTAAGGGGCGGG - Intronic
950124132 3:10501247-10501269 GGCGGGAGGCAGGGGGAAGCGGG - Intronic
950495671 3:13332991-13333013 AGATGGTGGCAGTGAGGAGCAGG - Intronic
950547220 3:13645745-13645767 AGCTGGATGCAGTGAAAAGCAGG + Intergenic
950841992 3:15976633-15976655 GGCAGGAGGCAGAGAGCAGCAGG - Intergenic
953122979 3:40064095-40064117 GGCTGCAAGCAGAGAGTAGATGG + Intronic
953144118 3:40258185-40258207 GGCCGGAGGCAGTGGGTCACTGG - Exonic
953384733 3:42500190-42500212 GGTTGGAGGCAGTGAGTGGCTGG - Intronic
953782341 3:45882323-45882345 GTCTGGAGGCAGTTAGTAGTTGG - Intronic
954001915 3:47564395-47564417 GGCTGTGGGCAGTGGGCAGCTGG - Intronic
954386852 3:50248621-50248643 GGCGGGAAGTAGTGAGTGGCAGG - Intronic
954877797 3:53814433-53814455 GGCAGGAGACAATGAGGAGCAGG + Exonic
955857534 3:63289439-63289461 GGCAGAAGGCAGAGAGGAGCTGG + Intronic
957008262 3:74975453-74975475 GGCTGAAGGCAAAGAGGAGCTGG + Intergenic
959904724 3:111698697-111698719 TGCTGGAGGCATTGAGAGGCAGG + Intronic
961404633 3:126669275-126669297 AGATGGTGGCAGTGAGGAGCAGG + Intergenic
962591733 3:136896607-136896629 GGCTCACTGCAGTGAGTAGCCGG + Intronic
962710444 3:138081484-138081506 GGATGGAGGCAGTGGGGAGGAGG - Intronic
962791820 3:138818216-138818238 GGCTGGAGGCAGTGAATAATAGG - Intronic
963669449 3:148233282-148233304 GGTTGGAGAAAGTGAGTAGTAGG + Intergenic
964764171 3:160162498-160162520 AGCTGGAGGCCGTTAGGAGCAGG + Intergenic
966149898 3:176856223-176856245 GCCTGTAGGCAGTGAGTTACAGG - Intergenic
966941814 3:184752680-184752702 GAGGAGAGGCAGTGAGTAGCTGG + Intergenic
966948571 3:184795660-184795682 GGCTGGAGACAGTGAGGGGGAGG - Intergenic
967279240 3:187806243-187806265 GGCAGGAGGCAGGAAGAAGCTGG - Intergenic
967536732 3:190613349-190613371 GGCGGGTGGCAGTGACTAGCAGG + Intronic
967641656 3:191872414-191872436 GGCTGAAGGAAGGGAGCAGCTGG + Intergenic
968383730 4:117747-117769 GGCAGGAGGCAGGCAGCAGCTGG - Intergenic
968489626 4:883086-883108 GGTGGGAAGCAGTGAGGAGCTGG + Intronic
968615726 4:1576998-1577020 GGCTGGAGGGAGGGAGGGGCCGG - Intergenic
968673501 4:1864619-1864641 GGCTGTAGGCCCTGAGTAGGCGG + Intergenic
969101208 4:4769493-4769515 GGGTGTAGGGAGTGAGTGGCAGG + Intergenic
969622230 4:8284371-8284393 GGCTGGAGTCAGTAATTAGTTGG - Intronic
970505385 4:16724013-16724035 TGCTGTAGGCAGTGAGGAGATGG - Intronic
970752979 4:19387756-19387778 TGCTGGAGGCAGTGACCACCTGG - Intergenic
971370103 4:26012030-26012052 GGCTGGAGACAATGAGCATCAGG + Intergenic
971749683 4:30631515-30631537 GGCAGGAGGCAGACAGGAGCAGG + Intergenic
972262434 4:37423453-37423475 GGCTGGAGGCCTAGAGAAGCTGG + Intronic
972520701 4:39853051-39853073 GACTGCAGGGACTGAGTAGCTGG + Intronic
972631829 4:40848721-40848743 GGCTGGAGGCAGGGAGTTTGCGG - Intronic
977919048 4:102624010-102624032 GGCTGGAAGGAGTGGGTAGGAGG - Intergenic
979469225 4:121074271-121074293 GCCTGGAGGTGGTGAGTAGTTGG + Intergenic
981154463 4:141417470-141417492 GGCAGAAGGCAGAGGGTAGCTGG - Intergenic
984402069 4:179279023-179279045 GGCTGGGGGCAGTGAGAAAGAGG - Intergenic
985146795 4:186902037-186902059 GCCTGGTGGCAGTGATTTGCAGG - Intergenic
985937413 5:3107495-3107517 GCCTAGAGGCAGTGAGTTGGGGG - Intergenic
986830987 5:11578122-11578144 CTCTGGAGGCAATGAGGAGCAGG - Intronic
986835118 5:11628551-11628573 GGTTGGAAGCAGTGATTAACTGG - Intronic
989524144 5:42433850-42433872 GGGAGGAGGCAGAGAGTACCAGG + Intronic
989608655 5:43270708-43270730 GGGTGCAGGCAGAGAGTAGTGGG + Intronic
990289945 5:54339913-54339935 GGCTGGATGTGGTGAGTATCTGG - Intergenic
991461585 5:66864450-66864472 GGCTGGACCCAGAGAGTAGAGGG + Intronic
993355320 5:86899734-86899756 GGGTGGAGGCAGTGAGGAAGGGG - Intergenic
993906904 5:93633453-93633475 GGCTGGAGCCAGAGAATAGAAGG - Intronic
994098830 5:95872780-95872802 GGCTGGAGGCTGTGGACAGCAGG - Intergenic
995614370 5:113944413-113944435 GTCTGGAGGCAGCTAGGAGCAGG + Intergenic
997725688 5:136118223-136118245 AGCTGGAGGCTGTGAGTATGTGG + Intergenic
998251891 5:140558847-140558869 GTCTAGAGGCAGAAAGTAGCTGG - Intronic
998399230 5:141839498-141839520 GGCTGGAGGTGGGGAGGAGCTGG + Intergenic
998926701 5:147134671-147134693 TGCAGGAGGAAGTGAGTGGCAGG - Intergenic
999379429 5:151109931-151109953 GGCTGAGGGCAGTCAGAAGCTGG + Intronic
1000151972 5:158511696-158511718 GGCAGGAAGCAGTCAGAAGCAGG + Intergenic
1001268130 5:170289994-170290016 GGCTGGAGACACAGAGGAGCAGG + Intronic
1001413885 5:171529502-171529524 GGCTGGAGGCAGGGAGTCCAGGG - Intergenic
1001687480 5:173604983-173605005 GGTTGGATGCAGTGACTAGACGG + Intergenic
1001882187 5:175254018-175254040 GTGTGGAGTCAGTGAGTGGCAGG + Intergenic
1001917126 5:175571078-175571100 AGCTGGAGGCAGAGAGAACCAGG - Intergenic
1001966698 5:175914625-175914647 GGCTACAGGCAGTGAGGCGCTGG - Intergenic
1002064479 5:176645233-176645255 GGCTGGAGACGGTGAGTTGGAGG + Exonic
1002250250 5:177924579-177924601 GGCTACAGGCAGTGAGGCGCTGG + Intergenic
1002363264 5:178690442-178690464 GGCTGGAGGGAGGGAGAAGTGGG - Intergenic
1002441554 5:179267048-179267070 GGCTGGAGGCAGAGAGCTGTGGG - Intronic
1002442715 5:179272733-179272755 GGCTGACGGCAGGGCGTAGCAGG - Intronic
1002644444 5:180646273-180646295 GGGTGGAGGCAGGTAGCAGCTGG - Intronic
1002927293 6:1611731-1611753 GACCGGAGGCAGAGAGTAGTCGG - Exonic
1003151845 6:3559144-3559166 GGCTGGAGGGAGTGGGTTGCAGG + Intergenic
1003294911 6:4817411-4817433 TGCCGGTGGGAGTGAGTAGCTGG - Intronic
1003303911 6:4909331-4909353 GGCTGGAGCTACTGAATAGCTGG - Intronic
1006315388 6:33288564-33288586 TGCTGGAGGCAGGGAGTGTCTGG - Intronic
1006470773 6:34227434-34227456 GGGTAGAGGAAGTGGGTAGCTGG - Intergenic
1006680461 6:35793491-35793513 GGCAGGAAGCATGGAGTAGCTGG - Intronic
1006876721 6:37303906-37303928 GTCTGGTGGCAGAGAGTAGGAGG - Intronic
1006919792 6:37619871-37619893 GCTGGGAGGCAGTGGGTAGCGGG - Intergenic
1007116027 6:39343938-39343960 GGTAGGAGGGAGTGAGAAGCAGG - Intronic
1007368835 6:41413110-41413132 GGTTGGAGGCAGGGAGTTGGGGG + Intergenic
1007519528 6:42440833-42440855 AGCTGGAGGGGGTGAGAAGCGGG + Intronic
1007955416 6:45913788-45913810 TGCTGGAGGAAGTGAGAAGGTGG + Intronic
1010408280 6:75531094-75531116 GGCTGGAGAGACTGAGTATCAGG - Intergenic
1010955480 6:82086315-82086337 GGCTGGGGGAAGGGAGGAGCAGG + Intergenic
1012335032 6:98044954-98044976 TGGAGGAGGCAGTGGGTAGCTGG + Intergenic
1013603225 6:111724769-111724791 TGCTGGAGGCTGTCAGAAGCAGG - Intronic
1014287318 6:119514917-119514939 GGCTGGGGGTAGTGAGAGGCTGG - Intergenic
1016441980 6:144094123-144094145 GGCTGGAGGGAGTGAGTAAGGGG - Intergenic
1017018107 6:150117422-150117444 GGCTGGAGGAGGTGAGAAGGCGG - Intergenic
1017081330 6:150671811-150671833 GGCTGGAGGCAGTGAGCAGTGGG + Intronic
1018672783 6:166193452-166193474 TGCTGGAGGCTGTGGGCAGCCGG + Intergenic
1019219998 6:170465498-170465520 GGCTGGAGGCTGTTATTAGGAGG + Intergenic
1019398491 7:836567-836589 GTCTGAAGGCAGTTTGTAGCTGG + Intronic
1022289439 7:28986793-28986815 GGCTGGAGTCAGTTTGTGGCAGG + Intergenic
1022304001 7:29129185-29129207 GGCTGGGGTCAAGGAGTAGCAGG + Intronic
1023407678 7:39852446-39852468 GTCTGGGGGCAGAGAGTACCTGG - Intergenic
1023422194 7:39992669-39992691 GGCTGGGGGCAGGGGGTAGGGGG - Intronic
1023842930 7:44106935-44106957 GGGTGGAGGCAGGGAGTGGGAGG + Intronic
1026391826 7:69910534-69910556 GGCAGAAGGCAATGAGTAGCAGG + Intronic
1028048368 7:86152166-86152188 GGCTGGAGCCACTGAGATGCAGG - Intergenic
1028310402 7:89325953-89325975 GGTCCGAGGAAGTGAGTAGCAGG + Intronic
1029107406 7:98189635-98189657 GGATGGAGGCAGTGCGTGGTGGG + Intronic
1029551793 7:101240542-101240564 GGCTGGAGGGAGGGAGTGGGTGG - Intronic
1032174368 7:129611751-129611773 GGCAGGAGGCTGCGAGGAGCCGG + Exonic
1032198734 7:129804644-129804666 GCCTGGAGGCAGTGGGCAGCCGG - Intergenic
1032360516 7:131250543-131250565 CGCAGGAGGGAGTGAGTAGGAGG + Intronic
1033361834 7:140643508-140643530 GGCTGGGGGCTGTGAGAGGCAGG - Intronic
1034063765 7:148117428-148117450 GCCTGGAGGAGGTGAGGAGCCGG - Intronic
1034105359 7:148485052-148485074 GGCTGGTGGCTTTGAGCAGCTGG - Intergenic
1034432937 7:151049976-151049998 GGCTGGGGGCATTGAGATGCGGG + Intronic
1037632421 8:20670377-20670399 GGATGGAGGCATGGAGGAGCTGG + Intergenic
1038038432 8:23705275-23705297 TTCTGGAGTTAGTGAGTAGCCGG + Intronic
1038065875 8:23963278-23963300 TGCTGGGGGCAGTTAGGAGCAGG + Intergenic
1038282823 8:26181321-26181343 GCCTGGAGGCAGTGATGAGTTGG - Intergenic
1038296291 8:26293133-26293155 GTCTGGAGCCAGTGATTTGCTGG + Intronic
1040487130 8:47884180-47884202 GGCAGGAGGCAGTGACTCCCTGG - Intronic
1041452169 8:58016917-58016939 GGCTGGAAGCAGGGAGTAGGGGG + Intronic
1043473944 8:80588406-80588428 GGCAGGAGGAAGTCAGGAGCAGG - Intergenic
1043920951 8:85982779-85982801 GGGTTGAGGCAGTGGGTGGCCGG - Intergenic
1044616762 8:94150356-94150378 GGCTGGAAGCAGGGAGAAGCAGG + Intronic
1045240117 8:100393008-100393030 GGATGGAGGCAGGGAGGGGCAGG - Intronic
1045458003 8:102400905-102400927 GGTTGGAGGCAGTGAAGAACTGG + Intronic
1045473182 8:102531182-102531204 GGCTGGACGCAGTGGCTGGCCGG + Intronic
1045508351 8:102794511-102794533 GGCTCGAGGCAGGCAGTATCTGG - Intergenic
1046614761 8:116463828-116463850 GACAGGAGGCAGAGAGCAGCTGG - Intergenic
1047752429 8:127891866-127891888 AGCTGGAGGGAGGGAGCAGCTGG + Intergenic
1048640254 8:136349899-136349921 GGATGTATGCAGTGAGTAGATGG - Intergenic
1048803411 8:138216169-138216191 GAATGGTGGCAGTGAGTTGCTGG + Intronic
1049168436 8:141141514-141141536 GGCTGGGGGCAGTGGGCAGGGGG + Intronic
1049358097 8:142198631-142198653 GGCTGAGGGCAGTGGGCAGCTGG - Intergenic
1049377741 8:142296987-142297009 GGCCGTAGGCAGAGTGTAGCGGG - Intronic
1049473411 8:142786163-142786185 GGCTGGTGGCAGGGACTAGATGG + Intronic
1052325971 9:27217057-27217079 GCCTGGAGGCAGTCAGGACCAGG + Intronic
1052833507 9:33233950-33233972 GGCTGGAGGAAGGGTGGAGCAGG + Intronic
1052857560 9:33416625-33416647 GGCTGGGAGCAGTGAGTGGCAGG - Intergenic
1055626061 9:78178653-78178675 GGGGGGGGCCAGTGAGTAGCAGG - Intergenic
1055935841 9:81603634-81603656 GGCTGGAGGCAGTAAATTGTGGG - Intronic
1056442496 9:86634736-86634758 CACTGGAGGCAGTGAGAGGCTGG + Intergenic
1056695665 9:88848701-88848723 GGCTGGAGAGAGTGAGTAATGGG - Intergenic
1056702057 9:88918951-88918973 GGCTGGAGTGAGTGAGATGCAGG + Intergenic
1056952109 9:91048868-91048890 GGCAGGAGGCAGGGAGGTGCTGG + Intergenic
1057077401 9:92145699-92145721 TGCTGGAGGCAGAGAGTAAGGGG + Intergenic
1057963445 9:99479098-99479120 TGCAGGAGGCAGTGTGTGGCAGG + Intergenic
1061030685 9:128080532-128080554 GCATGGAGGCATGGAGTAGCTGG + Intronic
1061224761 9:129274716-129274738 GGCTGGAGGGAGCGGGTAACGGG + Intergenic
1061407298 9:130399529-130399551 GGCCGGGGGCCGTGAGGAGCAGG - Intronic
1061625546 9:131838880-131838902 GCCTCGAGGGAGTGAGTGGCTGG + Intergenic
1061824956 9:133252305-133252327 GCCTGGAGGGAGAGAGCAGCCGG + Intronic
1061997377 9:134193399-134193421 GGCAGGAGGCAGTGGCTGGCAGG - Intergenic
1062057679 9:134477023-134477045 GGCAGGACGCAGTGAGGTGCAGG - Intergenic
1062635963 9:137491981-137492003 GGCTCCAGGCAGAGAGCAGCAGG + Intronic
1062702249 9:137913405-137913427 GGCAGGAGGAAGGGAGGAGCAGG + Intronic
1062711217 9:137976143-137976165 GCCTGAAGACAGTGAGGAGCAGG + Intronic
1185687270 X:1939564-1939586 GGTTGGAGTCAGTGCTTAGCTGG + Intergenic
1187106973 X:16253274-16253296 GGCTGGAAGCAGTGACTGGCTGG + Intergenic
1188032244 X:25277064-25277086 TGCTGGAGGCAGCCAGTAGTAGG - Intergenic
1189491798 X:41475859-41475881 GGAAGGAGGCAGCCAGTAGCTGG + Intergenic
1190297171 X:49034495-49034517 GACTGGAGGAAGTGATAAGCAGG - Intronic
1190626419 X:52342554-52342576 ACCTGGAGGCAGTGAGGAGCAGG + Intergenic
1190701587 X:52993284-52993306 ACCTGGAGGCAGTGAGGAGCAGG - Intronic
1192409128 X:70916927-70916949 GGCTGGAGGGAGTGGGGAGGTGG - Intergenic
1192452529 X:71253015-71253037 GGATGGAGCCACTGAGTTGCTGG - Exonic
1192850386 X:74949775-74949797 GGCAGCAGGAAGTGAGCAGCGGG + Intergenic
1194713146 X:97259509-97259531 GGCTGGAAGCAGGGAGAAGACGG - Intronic
1196320985 X:114340092-114340114 GGCTGGAGCCAGAGGGTAGCGGG - Intergenic
1197295776 X:124717322-124717344 GGCTGCAGGCAGTGGGGAGTGGG - Intronic
1197728770 X:129793515-129793537 AGCTGGAAGCAGTGAGGAGAGGG + Intronic
1197993936 X:132352031-132352053 GGCTTGAGGAATTGAGTAGATGG + Intergenic
1198443647 X:136689594-136689616 AGCCGGAGGCAGTGGGGAGCTGG - Intronic
1198450985 X:136767171-136767193 GGCTGGAGTGAGGGAGCAGCTGG - Intronic
1199975975 X:152895179-152895201 AGGTAGAGGCAGGGAGTAGCAGG - Intergenic