ID: 1146004981

View in Genome Browser
Species Human (GRCh38)
Location 17:29155419-29155441
Sequence CAGGGTCCACACAGGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 270}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146004981_1146005001 20 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146005001 17:29155462-29155484 TGAGAGGTGCTGGGGAGGGAGGG 0: 1
1: 0
2: 15
3: 133
4: 1224
1146004981_1146004999 16 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146004999 17:29155458-29155480 GCAGTGAGAGGTGCTGGGGAGGG 0: 1
1: 0
2: 6
3: 91
4: 787
1146004981_1146004998 15 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146004998 17:29155457-29155479 GGCAGTGAGAGGTGCTGGGGAGG 0: 1
1: 0
2: 9
3: 66
4: 765
1146004981_1146004994 10 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146004994 17:29155452-29155474 GGCCTGGCAGTGAGAGGTGCTGG 0: 1
1: 0
2: 2
3: 44
4: 421
1146004981_1146004997 12 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146004997 17:29155454-29155476 CCTGGCAGTGAGAGGTGCTGGGG 0: 1
1: 0
2: 3
3: 46
4: 436
1146004981_1146005000 19 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146005000 17:29155461-29155483 GTGAGAGGTGCTGGGGAGGGAGG 0: 1
1: 0
2: 15
3: 128
4: 1185
1146004981_1146004991 4 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146004991 17:29155446-29155468 CCCCAGGGCCTGGCAGTGAGAGG 0: 1
1: 0
2: 7
3: 170
4: 1135
1146004981_1146004995 11 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146004995 17:29155453-29155475 GCCTGGCAGTGAGAGGTGCTGGG 0: 1
1: 0
2: 3
3: 48
4: 325
1146004981_1146004987 -6 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146004987 17:29155436-29155458 ACCCTGCTTGCCCCAGGGCCTGG 0: 1
1: 0
2: 4
3: 48
4: 469
1146004981_1146005002 23 Left 1146004981 17:29155419-29155441 CCTGCCGCCCTGTGTGGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 270
Right 1146005002 17:29155465-29155487 GAGGTGCTGGGGAGGGAGGGAGG 0: 1
1: 1
2: 43
3: 342
4: 3049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146004981 Original CRISPR CAGGGTCCACACAGGGCGGC AGG (reversed) Intronic
900166508 1:1246203-1246225 CAGGTTCCTCAGAGCGCGGCAGG + Intronic
900185540 1:1331515-1331537 CCTGGTGCACACAGGGCTGCTGG - Exonic
900385047 1:2406690-2406712 CGGGGGCCACACATGGGGGCTGG - Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900685678 1:3946214-3946236 GAGGATCCACACAGGGGTGCAGG - Intergenic
901219970 1:7578227-7578249 CAGGATCCACAGAGGGCACCTGG - Intronic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902584980 1:17433404-17433426 CGGGCTCCACCCGGGGCGGCGGG + Intronic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG + Intronic
905137019 1:35808037-35808059 CGGGGTCCACAGAGCCCGGCAGG - Intergenic
905878868 1:41450675-41450697 CAGGATCCACACAAGACGGGTGG + Intergenic
905937864 1:41839172-41839194 CAGGGTCCACAGAGGAGGGAAGG + Intronic
907243449 1:53093048-53093070 CAGAGTCTACACAGTGCGCCTGG + Intronic
907407711 1:54263767-54263789 CAGGGCCCAAACAGAGCAGCAGG + Intronic
908809608 1:67966553-67966575 CAGTGTCCTCACAGGGTGGAAGG - Intergenic
915018836 1:152760977-152760999 CTGGGTGCTCACAGGGCTGCAGG - Exonic
920433444 1:205933467-205933489 CAGGATGCACACACAGCGGCAGG - Intronic
920862468 1:209721756-209721778 CAGGATCCACACTGGGCCTCTGG + Intronic
921016707 1:211198411-211198433 TAGGGTCCAAAAAGGGCGGAAGG - Intergenic
924343395 1:243054557-243054579 CGGGGTCTACAAAGGCCGGCGGG - Intergenic
924640250 1:245826773-245826795 CAGCTTCCTCACAGGGCGGCAGG + Intronic
1062939885 10:1413203-1413225 CAGGGCCCAGCCAGGGCAGCAGG + Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1066733077 10:38450957-38450979 CGGGGTCTACAAAGGCCGGCGGG + Intergenic
1069737799 10:70669011-70669033 CAGTGTCCACAGAGGGCTGCTGG + Intergenic
1069897861 10:71689925-71689947 CAGGGTCTGGACAGGGTGGCTGG + Intronic
1070736959 10:78869707-78869729 CATGGCCAGCACAGGGCGGCCGG + Intergenic
1070917693 10:80165354-80165376 CAGGGTGCACACAGAGCTGTGGG + Intronic
1071055287 10:81502935-81502957 CAGGCTGCACTCAGAGCGGCTGG + Intergenic
1071160302 10:82737806-82737828 CAGGGGCCTGGCAGGGCGGCGGG + Intronic
1071335881 10:84600230-84600252 CAGGTTCCACGCAGGGTGGGAGG - Intergenic
1071533834 10:86411097-86411119 CAAGGCCCACACAGGGAGGGAGG - Intergenic
1072690804 10:97571233-97571255 CAGGGGCCCCACAGAGCTGCAGG - Intergenic
1073320195 10:102611445-102611467 CAGGGTCCACTCAAGGAGTCAGG + Intronic
1075070534 10:119317213-119317235 CAGGGTCCAGAAAGCACGGCAGG + Intronic
1075093157 10:119454581-119454603 CAGCTTCCGCACAGGGTGGCTGG - Intronic
1075161832 10:120031121-120031143 CTGGGTCCTCACAGGGTGGAAGG - Intergenic
1076680801 10:132170273-132170295 CAGGGTCCCCCGAGGGCGGCTGG + Intronic
1076683602 10:132187137-132187159 CAGGCCCCACTCCGGGCGGCGGG - Intronic
1076791783 10:132780684-132780706 CAGGGGCCAGGCAGGGCGGGTGG + Intronic
1076804277 10:132847380-132847402 GAGGGCCCACCCAGGGAGGCCGG + Intronic
1078093790 11:8284016-8284038 CAGGGCCCGCACAGGTCTGCAGG + Intergenic
1078128706 11:8594069-8594091 CAGGGACCACTCACCGCGGCCGG + Intronic
1082565946 11:54677626-54677648 CACCATCCTCACAGGGCGGCAGG - Intergenic
1082569224 11:54717261-54717283 CAGGGTCCTGTCAGGGGGGCTGG + Intergenic
1083222788 11:61264523-61264545 CAGGGTCGGCACAGGCCCGCTGG + Exonic
1083781258 11:64919004-64919026 CAGGCTCCATTCAGGGAGGCAGG + Intronic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1085320668 11:75572089-75572111 CAGGGTGCACACAGGATGGCAGG + Exonic
1090784958 11:130040769-130040791 CAGGCTCCAGACAGGCCTGCAGG + Intergenic
1091106012 11:132920567-132920589 CAGGGTGCACACATGGCCCCAGG + Intronic
1093632991 12:21432118-21432140 CAGGGTCCACAATGGGCTTCTGG - Intergenic
1094872097 12:34604323-34604345 CAGGGTCTGCCCAAGGCGGCAGG + Intergenic
1096967666 12:55641321-55641343 CAGGGGCCAGAGAGGACGGCAGG + Intergenic
1098973604 12:76879366-76879388 CAGGTCCGACGCAGGGCGGCGGG - Intergenic
1101068719 12:101050348-101050370 CAAGGTCCACCAAGGGAGGCAGG - Intronic
1101782212 12:107846150-107846172 CAGTGTCCAATCAGGGGGGCTGG - Intergenic
1104820933 12:131677264-131677286 CCGGGTGCACCCAGGGCTGCCGG + Intergenic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1105014860 12:132780320-132780342 CAGGGCCCAGACAGGGCACCTGG + Intronic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105865054 13:24451691-24451713 CAGGGGCCACAGAGGCAGGCAGG + Intronic
1111235624 13:85404362-85404384 CACCTTCTACACAGGGCGGCAGG - Intergenic
1113956467 13:114102199-114102221 CAGGATCCACAGCGGGCGGGTGG + Intronic
1114269167 14:21090857-21090879 CAGGGTCCTCCCAGGGCTGGCGG + Exonic
1117735183 14:58761792-58761814 CAAGGACCTCACAGGGCGGCAGG + Intergenic
1121496962 14:94399145-94399167 AAGGATCCACACAGGGATGCTGG - Intergenic
1121812887 14:96907205-96907227 CAGGGGCCACACCTGGCAGCCGG + Intronic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1122790706 14:104183065-104183087 CGGGGTCCAGACAGGGAGGACGG - Intergenic
1122847511 14:104507973-104507995 CAGAGTCCCCACAGGCCTGCAGG + Intronic
1125542278 15:40476442-40476464 CAGTGTCCACCCAGGGGGGTGGG - Intergenic
1125696792 15:41644627-41644649 CAGAGTCCACCCAGGCTGGCTGG - Intronic
1127268015 15:57376629-57376651 TAGGGGCCGCCCAGGGCGGCGGG + Intronic
1129887328 15:79047805-79047827 CACGGTCCACACTGGGAGGAAGG + Intronic
1130557114 15:84930388-84930410 CAGTGTCCACACAGGGCCCTGGG + Intronic
1131441175 15:92460874-92460896 CAGGCTCCACACAGGGCACGAGG - Intronic
1131511869 15:93053653-93053675 CTGGGTTCACACAAGGCTGCTGG - Intronic
1132534529 16:471510-471532 CACGGTGCACACAGGGCGGGAGG - Intronic
1132574555 16:658521-658543 CAGGGTGGACACCGGGCAGCTGG - Exonic
1133241286 16:4416051-4416073 CAGGGGCGACCCGGGGCGGCAGG + Intronic
1133610700 16:7430753-7430775 CAGGGTCCACACAGGAAGCCTGG + Intronic
1134243717 16:12524302-12524324 CAGTGACCACACAGGTCAGCGGG - Intronic
1137812111 16:51362688-51362710 CAAGGTCCCCACAGAGCGACGGG + Intergenic
1141613621 16:85197861-85197883 CAGGGTCCCCACGGGGCTGTTGG + Intergenic
1141853019 16:86660403-86660425 GAAGGTCCACACAGGACGCCAGG + Intergenic
1142257941 16:89024290-89024312 CAGGGTCCAGGCAGAACGGCTGG + Intergenic
1142277981 16:89132917-89132939 CAGGGCCCACAGAGGACGGCGGG + Intronic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1142300794 16:89256833-89256855 CCGGGACCACACAGGTCGCCTGG + Intergenic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1144950581 17:18991555-18991577 CAGGGGCCACACTGGGCAGGAGG + Intronic
1145209073 17:20999956-20999978 CAAGGTCCACAGAGGGCCCCGGG + Exonic
1145961677 17:28890031-28890053 CAGGGACAACACTGGGGGGCTGG + Intronic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1146516711 17:33495299-33495321 CAGGGGCCAAACAAGGCAGCAGG - Intronic
1147887542 17:43694591-43694613 AAGCGGCCCCACAGGGCGGCAGG + Intergenic
1148236722 17:45974124-45974146 CAGCGTTTACACAGGGCTGCCGG + Intronic
1149313990 17:55421862-55421884 CTGGGGCCAGACCGGGCGGCTGG + Exonic
1150004945 17:61463654-61463676 CAGTGTCCACATAGGGGGCCAGG - Intronic
1151726284 17:75886650-75886672 CAGGGACCTCACAGGCCAGCTGG - Intronic
1152108118 17:78342350-78342372 CAGGGCGCAGACCGGGCGGCGGG - Intergenic
1152374709 17:79913167-79913189 CAGGTTCCACACAGGAGGCCTGG - Intergenic
1152539939 17:80969772-80969794 CAGCCTCCAGACAGGGCGGGTGG + Intergenic
1152683917 17:81684320-81684342 GAGGGTCCGCGCAGGGCGCCAGG + Intronic
1152700235 17:81814993-81815015 CAGGGACCACACAGCGGGGGTGG + Intergenic
1156792189 18:40988938-40988960 CAGACACCACACAGGGCTGCTGG + Intergenic
1157614279 18:48977581-48977603 CAGGGTCCAGAGAGGCCGGTAGG - Intergenic
1160805155 19:989425-989447 CGGGGCCCACACAGGACGCCTGG + Intronic
1161301299 19:3544317-3544339 CAGGGCCCCCTCAGGACGGCTGG - Exonic
1161388165 19:4007872-4007894 CCGGGGCCCCACAGCGCGGCCGG + Intronic
1161511700 19:4675714-4675736 TGGGGTCCACACCGGGCAGCGGG - Exonic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161772952 19:6241303-6241325 CAGGGTCCATTCAGGGCTCCAGG + Intronic
1162184072 19:8891157-8891179 ATGGGTCCAGACAGGGAGGCTGG + Exonic
1162324187 19:9989158-9989180 CAGGGTCCACCAGGGTCGGCAGG - Exonic
1162772439 19:12957223-12957245 CGGGGTCCTCACAGGCCCGCCGG + Exonic
1166429349 19:42711019-42711041 CAGGGTCCAGGCAGGCCAGCTGG + Intronic
1166450773 19:42898760-42898782 CAGGGTCCAGGCAGGCCAGCTGG + Intronic
1166462676 19:43003105-43003127 CAGGGTCCAGGCAGGCCAGCTGG + Intronic
1166479958 19:43163083-43163105 CAGGGTCCAGGCAGGCCAGCTGG + Intronic
1166489784 19:43248614-43248636 CAGGGTCCAGGCAGGCCAGCTGG + Intronic
1167072475 19:47228703-47228725 CAGGGCTCACACAGGACGGATGG + Intronic
1167300270 19:48673858-48673880 CTGGGGCCACCCAGGGCAGCAGG - Intergenic
925201361 2:1969733-1969755 CAGTGTCCAGAGAGGGCTGCAGG - Intronic
925306289 2:2849901-2849923 CAGGGGCCTCTCACGGCGGCTGG - Intergenic
925820979 2:7799624-7799646 CAGGGGCCATGCAGGGCAGCTGG - Intergenic
926147010 2:10402565-10402587 CTGGGGCCACCGAGGGCGGCTGG + Intronic
927150332 2:20191942-20191964 GAGGGTCCACACTGGGCCCCTGG - Intergenic
927965029 2:27262995-27263017 CGGGATCCCCGCAGGGCGGCGGG + Exonic
932885287 2:75543626-75543648 CAGGTCCCACCCAGGGAGGCTGG - Intronic
933977237 2:87521358-87521380 CAGAGTCCACAGTGGGCGGTTGG - Intergenic
934609804 2:95726704-95726726 CAGGGTCCTCACATGGCAGGGGG + Intergenic
935424711 2:102907843-102907865 CAGGGTCTACAGAGGCCAGCAGG + Intergenic
936543126 2:113368274-113368296 CAGGGTCCTCACATGGCAGAAGG + Intergenic
937934360 2:127230739-127230761 CTGTGTCCTCACAGGGCGGAAGG - Intergenic
937968548 2:127533000-127533022 CAGGGTCCATCCAGGGAGGATGG + Intergenic
938240891 2:129741654-129741676 CAGGGTGCACTCAGGTGGGCAGG - Intergenic
946104698 2:217358861-217358883 CAGAGTCCACACAGTTCTGCTGG - Intronic
946552125 2:220813593-220813615 CAGGGTCCATACAGGGATACGGG + Intergenic
947542925 2:230991024-230991046 CAGGGTGCCCTCGGGGCGGCCGG - Intergenic
947933368 2:233982967-233982989 CATGGTCCACTGAGGACGGCCGG + Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948174747 2:235934352-235934374 CAGGCTCCACCCAGGCCTGCTGG + Intronic
948708296 2:239809471-239809493 CAGCGCCCACACAGGGAGGAGGG - Intergenic
1170757263 20:19214972-19214994 CGGGGGCAACACAGGGAGGCTGG - Intronic
1171404114 20:24898230-24898252 CAGGGACCTCACAATGCGGCTGG + Intergenic
1171545599 20:25998205-25998227 CAGGGTCTAGAGAGGGCGTCTGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1175247177 20:57589203-57589225 CTGAGGCCACACAGGGAGGCAGG + Intergenic
1175652084 20:60734178-60734200 CAGGCTCCACCCAGGCCGGTTGG + Intergenic
1175852963 20:62103783-62103805 CAGGGTGGACCCAGGGTGGCAGG + Intergenic
1176097957 20:63352901-63352923 AAGGCTCCCCAGAGGGCGGCTGG - Intronic
1176101731 20:63367589-63367611 CAGGGTCCAGACAGGCCCGGAGG + Intronic
1176134874 20:63518122-63518144 CAGGCTTCCCACAGGGCGGGAGG - Intergenic
1177842984 21:26255401-26255423 CTGTGTCCACACATGGTGGCAGG + Intergenic
1178821528 21:35979504-35979526 CTGGGTCCTCACAGGGCAGAAGG - Intronic
1179594970 21:42437380-42437402 CAGGGTCCTCAAAGGGCCCCGGG - Intronic
1179802877 21:43819743-43819765 CTGGGCCCACACAGGAAGGCCGG - Intergenic
1184039217 22:41933388-41933410 CTGTGTCCTCACAGGGAGGCTGG + Intergenic
1184130146 22:42512753-42512775 CAGAGTCCACACAGGCCAGGAGG - Exonic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
1185072934 22:48667151-48667173 CAGGGGCAGCACAGGGCAGCAGG + Intronic
1185221098 22:49629644-49629666 CTGGGTTCAAACAGGGAGGCTGG + Intronic
1185221119 22:49629708-49629730 CTGGGTTCAAACAGGGAGGCTGG + Intronic
1185249952 22:49795980-49796002 CAGGCTCCAAACAGTGCTGCTGG - Intronic
1185363095 22:50420836-50420858 CAGGTTCCCCACATGCCGGCAGG + Intronic
950084669 3:10248776-10248798 CAAGATCCACACATGGCTGCCGG - Exonic
952751908 3:36831548-36831570 CAGGGTCCAAACAGAGCAGGCGG + Exonic
952931744 3:38365890-38365912 CTGGGAACACACAGGGCAGCAGG - Intronic
953038282 3:39232466-39232488 AATGGTCCACACAGGAAGGCTGG - Intergenic
953436324 3:42880769-42880791 CGGGGGCCACGCAGGGCTGCCGG + Intronic
954405044 3:50340899-50340921 CAGGATCCAGACTGGGCGGCGGG + Intronic
955963018 3:64360361-64360383 CAGAGTCCACAGAGGCCAGCAGG + Intronic
956788302 3:72660969-72660991 CAGGGTACACACAGTGGGGTGGG + Intergenic
960611341 3:119557707-119557729 CATGGGCCACACACGGAGGCAGG - Exonic
960994557 3:123332373-123332395 CAGGGCCCACGCAGGGCGTGAGG + Intronic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
961864655 3:129944868-129944890 CAGGGCACAAGCAGGGCGGCTGG + Intergenic
963799105 3:149658880-149658902 CAGGCTCCCCGGAGGGCGGCAGG - Intronic
967823372 3:193859001-193859023 CAGGCCCCACAAAGGGAGGCAGG - Intergenic
968488564 4:877102-877124 CCCGGTCCACTCTGGGCGGCCGG - Exonic
968742779 4:2339863-2339885 CGGGGTCCTCACAGGGCCCCAGG + Intronic
968890690 4:3367005-3367027 CTGGGTCCAGCCAGGGCAGCAGG - Intronic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969128456 4:4972208-4972230 CTGTGTCCACACAGGGTGGAAGG - Intergenic
969317419 4:6390530-6390552 CAGGGAGCACGCCGGGCGGCGGG + Intronic
969542648 4:7803392-7803414 CAGAGACCACACAGTGCAGCAGG + Intronic
969584669 4:8084857-8084879 CAGGGTCCACCCAGGGTATCTGG + Intronic
969842090 4:9890159-9890181 CAGGGTCCACACAGGCTGTCTGG + Intronic
975523928 4:75328811-75328833 CTGGGTCCTCACAGGGTAGCAGG - Intergenic
981342139 4:143634022-143634044 CAGAGCCCAAACAGGGCAGCTGG + Intronic
981415846 4:144492575-144492597 CAGGGTCCACACAGAATAGCTGG - Intergenic
981686538 4:147460729-147460751 CTGGGTCCTCACATGGCGGAAGG - Intergenic
982257510 4:153465664-153465686 CAGTGTCCACAGAGGGTGCCGGG + Intergenic
982746120 4:159104611-159104633 CAGAGGCCACGGAGGGCGGCTGG - Intronic
985520952 5:373739-373761 CCGGGTGCACACGGGGCGGGCGG - Intronic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985926195 5:3020933-3020955 CTGGGTCCTTACAGGGCGGAAGG - Intergenic
987843220 5:23247302-23247324 CAGCTTCTTCACAGGGCGGCAGG - Intergenic
991085200 5:62642626-62642648 CTGGGTCCACACTGGAGGGCAGG - Intergenic
991697783 5:69289077-69289099 CAAGCTCCACACAGGGTTGCAGG + Intronic
992831522 5:80597744-80597766 CACCTTCCTCACAGGGCGGCAGG - Intergenic
995474776 5:112536838-112536860 CAGAGTCTACAAAGGGCTGCAGG + Intergenic
995738462 5:115328798-115328820 CTGGGTCCACCCAGCACGGCTGG + Intergenic
997412244 5:133699213-133699235 CAGTGTCCACACAGGGCCTGAGG + Intergenic
997422701 5:133781657-133781679 CAGGGTACACACAGTGTGGCAGG - Intergenic
997468215 5:134102187-134102209 CAGAGTCCCCCCAGAGCGGCGGG - Intergenic
998095652 5:139394411-139394433 CAGAGTCCCCCAAGGGCGGCCGG - Exonic
998207210 5:140166434-140166456 TAGGGTGCAGACAGGGAGGCAGG + Intergenic
1001250110 5:170140625-170140647 CAGGGTCCACTCTGGGGAGCAGG - Intergenic
1002118577 5:176984105-176984127 CACTTTCCAGACAGGGCGGCCGG - Intronic
1002212952 5:177609221-177609243 CAGGGTCCATGCAGGCTGGCAGG + Intronic
1002422362 5:179155277-179155299 CAGGGGCCACTCAGTGAGGCAGG - Intronic
1003094794 6:3133613-3133635 AAGGGCCCACACAAGGAGGCAGG - Intronic
1003195038 6:3906715-3906737 CAAGGTCCACGCTGGGAGGCGGG + Intergenic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1006512680 6:34530148-34530170 CAGAGTCCACTCAGGGAAGCAGG - Intronic
1017764775 6:157597660-157597682 CAGTGCCCACACAGGACAGCAGG - Intronic
1017888700 6:158621909-158621931 TAAGGTCCACACATGGCTGCTGG + Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019539783 7:1546447-1546469 CGGGGTCCACACAGGCTGGCCGG - Exonic
1019621805 7:1996161-1996183 CCGGGTCTACACACGGCTGCTGG + Intronic
1019621849 7:1996275-1996297 CCGGGTCTACACACGGCTGCTGG + Intronic
1019621863 7:1996313-1996335 CCGGGTCTACACACGGCTGCTGG + Intronic
1019731004 7:2629673-2629695 CAGGGTACACACATGCAGGCAGG - Intergenic
1020094708 7:5361861-5361883 CAGGGGCCCCACGGGGCGGGCGG + Intronic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1024475318 7:49802779-49802801 CAGGGTCCACACACTCCGTCTGG - Exonic
1024752456 7:52483501-52483523 CAGGGACAACAAAGGCCGGCAGG + Intergenic
1025178167 7:56812278-56812300 CAGGGTCTACAAAAGCCGGCGGG + Intergenic
1025178599 7:56814020-56814042 CAGGGTCTACAAAAGCCGGCGGG + Intergenic
1025179037 7:56815810-56815832 CAGGGTCTACAAAAGCCGGCGGG + Intergenic
1025179493 7:56817696-56817718 CAGGGTCTACAAAAGCCGGCGGG + Intergenic
1025179942 7:56819534-56819556 CAGGGTCTACAAAAGCCGGCGGG + Intergenic
1025180417 7:56821516-56821538 CAGGGTCTACAAAAGCCGGCGGG + Intergenic
1025180860 7:56823354-56823376 CAGGGTCTACAAAAGCCGGCGGG + Exonic
1025181287 7:56825105-56825127 CAGGGTCTACAAAAGCCGGCGGG + Intronic
1025181733 7:56826943-56826965 CAGGGTCTACAAAAGCCGGCGGG + Intronic
1025690184 7:63750052-63750074 CAGGGTCTACAAAAGCCGGCGGG - Intergenic
1025691082 7:63753698-63753720 CAGGGTCTACAAAAGCCGGCGGG - Intergenic
1025691956 7:63757297-63757319 CAGGGTCTACAAAAGCCGGCGGG - Exonic
1025692405 7:63759120-63759142 CAGGGTCTACAAAAGCCGGCGGG - Intergenic
1025692849 7:63760943-63760965 CAGGGTCTACAAAAGCCGGCGGG - Intergenic
1025693265 7:63762622-63762644 CAGGGTCTACAAAAGCCGGCGGG - Intergenic
1025693708 7:63764445-63764467 CAGGGTCTACAAAAGCCGGCGGG - Intergenic
1026392376 7:69914514-69914536 CACGGTCCACGCAGGGCGCAGGG - Intronic
1026848248 7:73709441-73709463 GAGGGCCCAGACAGAGCGGCCGG - Intronic
1028441014 7:90860974-90860996 CAGTTTCCACACAGGGCCTCTGG - Intronic
1028535713 7:91887906-91887928 CACTTTCCAGACAGGGCGGCCGG - Intergenic
1028548236 7:92027389-92027411 CACTTTCCAGACAGGGCGGCCGG - Intronic
1029531350 7:101127364-101127386 CAGGGTCGACCCAAGGCTGCAGG - Intronic
1032051644 7:128653910-128653932 CGGGGTCTACAAAGGCCGGCGGG + Intergenic
1034787046 7:153935459-153935481 CAGGTTCCACTCTGTGCGGCAGG - Intronic
1035108254 7:156459807-156459829 CAGGGGCAGAACAGGGCGGCGGG - Intergenic
1035619444 8:1026410-1026432 CAGGGTGCAGCCAAGGCGGCGGG - Intergenic
1036935798 8:13001306-13001328 CTGGGTCCACTCAGTGAGGCGGG + Intronic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1039913565 8:41843529-41843551 CATGGTGCAGACAGGGCAGCTGG + Intronic
1041200992 8:55451916-55451938 CCTGGTCCTCAGAGGGCGGCTGG + Intronic
1047033799 8:120913070-120913092 CACCTTCCCCACAGGGCGGCTGG - Intergenic
1048206130 8:132416811-132416833 CAGGGTACAGACAGGAAGGCTGG + Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1048910980 8:139134823-139134845 CAGGGTTCACACAGGTTTGCAGG + Intergenic
1049281942 8:141753875-141753897 CATGGTCCATGCAGGGCTGCAGG - Intergenic
1049497923 8:142945388-142945410 CAGTGTCCACACGGGTGGGCGGG - Intergenic
1051973752 9:22923608-22923630 CCAGGCCCACACAGGGCTGCTGG + Intergenic
1052861394 9:33439939-33439961 CATGGTCCAGAGAGGGCGGGTGG - Intergenic
1052963400 9:34319661-34319683 CAGGGTGCACACAGGATGGCAGG + Intronic
1059427159 9:114228306-114228328 CGGGGGCCAGGCAGGGCGGCAGG - Intronic
1059731796 9:117064228-117064250 CACGGTCCAGCCAGGGCCGCTGG + Intronic
1060016913 9:120094666-120094688 CAGGGGACACACAGGGCGGGGGG + Intergenic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1062120429 9:134831151-134831173 CTGTGTCCACCCAGGGAGGCTGG - Intronic
1062279371 9:135745063-135745085 CAGAGTCCACACCCGGCAGCGGG - Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1062446262 9:136596597-136596619 CAGGGCCCGCACACGGCAGCCGG - Intergenic
1062523700 9:136969913-136969935 AGGGCTCCACACAGGGCTGCAGG - Exonic
1062600584 9:137317117-137317139 CAGCCTCCTCACAGGCCGGCTGG - Intronic
1062630268 9:137460175-137460197 CAGGGGCCTCACAGGACTGCAGG + Exonic
1189506001 X:41612777-41612799 CAGCTTCCAGACGGGGCGGCTGG - Intronic
1199677734 X:150201714-150201736 CAGGGACCATTCAGTGCGGCCGG + Intergenic
1202380930 Y:24276271-24276293 CGGGGTCTACAAAGGCCGGCAGG + Intergenic