ID: 1146006282

View in Genome Browser
Species Human (GRCh38)
Location 17:29162740-29162762
Sequence ATGGGCAGGTGGAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1118
Summary {0: 1, 1: 0, 2: 14, 3: 135, 4: 968}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146006271_1146006282 25 Left 1146006271 17:29162692-29162714 CCCAGGACCTAGTATGCAGTAAG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG 0: 1
1: 0
2: 14
3: 135
4: 968
1146006272_1146006282 24 Left 1146006272 17:29162693-29162715 CCAGGACCTAGTATGCAGTAAGT 0: 1
1: 0
2: 1
3: 12
4: 115
Right 1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG 0: 1
1: 0
2: 14
3: 135
4: 968
1146006273_1146006282 18 Left 1146006273 17:29162699-29162721 CCTAGTATGCAGTAAGTGCTCAA 0: 2
1: 6
2: 45
3: 288
4: 1254
Right 1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG 0: 1
1: 0
2: 14
3: 135
4: 968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146006282 Original CRISPR ATGGGCAGGTGGAAGGATGA TGG Intronic
900304129 1:1994907-1994929 AGCGGGAGGTGGAGGGATGAGGG + Intronic
900498693 1:2989126-2989148 ATGGGTAGATGGATGGATGGAGG - Intergenic
900498705 1:2989184-2989206 ATGGGTGGGTGGATGGATGGAGG - Intergenic
900546723 1:3233553-3233575 AGGGGCAGGGAGAAGGATGCTGG - Intronic
900993130 1:6106976-6106998 ATGGAGGGGTGGAAGGATGGAGG + Intronic
900993149 1:6107055-6107077 ATGGAGCGATGGAAGGATGATGG + Intronic
900993209 1:6107260-6107282 ATGGAGAGATGGAGGGATGATGG + Intronic
900993232 1:6107366-6107388 ATGGAGAGATGGAGGGATGATGG + Intronic
900993311 1:6107702-6107724 ATGGAGAGATGGAGGGATGATGG + Intronic
900993321 1:6107746-6107768 ATGGAGAGATGGAGGGATGATGG + Intronic
900993413 1:6108074-6108096 ATGGAGAGATGGAGGGATGATGG + Intronic
900993453 1:6108220-6108242 ATGGACGGGTGGAAGGATGGAGG + Intronic
900993517 1:6108529-6108551 ACGGAGAGATGGAAGGATGAAGG + Intronic
900993533 1:6108583-6108605 ATGGAGGGGTGGAAGGATGGAGG + Intronic
900993558 1:6108680-6108702 ATGGAGGGGTGGAAGGATGGAGG + Intronic
900993615 1:6108890-6108912 ATGGAGGGGTGGAAGGATGGAGG + Intronic
901001247 1:6149838-6149860 ATGGACAAATGGACGGATGATGG + Intronic
901001267 1:6149966-6149988 ATGGGCAAATGAATGGATGATGG + Intronic
901003611 1:6161094-6161116 GTGGCCAGGAGGGAGGATGAAGG + Intronic
901006767 1:6175509-6175531 ATGGGCAGATGGATGGATGGTGG + Intronic
901006773 1:6175532-6175554 ATGGGCAGATGGATGGATGGTGG + Intronic
901454767 1:9356797-9356819 ATGGACAGATGGATGGATGATGG + Intronic
901666429 1:10828763-10828785 ATTGGCAGGTGTGAGGATGAAGG + Intergenic
901699819 1:11039311-11039333 ATGGGTGGATGGAAGGATGGTGG + Intronic
901699960 1:11039973-11039995 ATGGGTGGGTGGATGAATGAGGG + Intronic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902628674 1:17691821-17691843 ATGGACAGATGGATGGATGAAGG - Intronic
903169157 1:21541479-21541501 GTCGCTAGGTGGAAGGATGATGG - Intronic
903277392 1:22230905-22230927 ATGAGTGGGTGGATGGATGATGG - Intergenic
903277442 1:22231099-22231121 ATGAGTGGGTGGATGGATGATGG - Intergenic
903280890 1:22249224-22249246 AGGGGCAGCTGGAAGGGAGAGGG + Intergenic
903352470 1:22726046-22726068 ATGGACAGATGGATGGATGAAGG - Intronic
903578401 1:24353371-24353393 GTGGGCAGGTGGATGGAGGATGG + Intronic
903774262 1:25782727-25782749 ATGGACAGGTGGGAGGTTGAGGG + Intronic
904311612 1:29632844-29632866 ATGGGCAGCCGGAGGGCTGAGGG - Intergenic
904487969 1:30840116-30840138 ATGGGTGGGTGGATGGATGATGG + Intergenic
904609942 1:31720356-31720378 ATGGGCAGGAGCAAGCTTGATGG - Intergenic
904933290 1:34107632-34107654 GTGGGTGGGTGGATGGATGAAGG + Intronic
905178932 1:36155227-36155249 CTGGGAAGGTGGATGGATGATGG - Intronic
905256443 1:36688489-36688511 ATGGGAAGGGGAAAGGATGTGGG + Intergenic
905284934 1:36873135-36873157 ACGTGCTGGTGGCAGGATGAGGG - Intronic
905889330 1:41509752-41509774 AGGTGCAGGTAGAAGGAGGAGGG - Exonic
906069961 1:43008920-43008942 ATGGGAATGTGGGAGGAGGAGGG + Intergenic
906240923 1:44241859-44241881 ATGGACAGATGGATGGAAGAAGG - Intronic
906328040 1:44860774-44860796 ATGGGCAGCTGGAAGGGAGAAGG + Intronic
906522446 1:46475440-46475462 GTGGCCAGGAGGAGGGATGAGGG - Intergenic
906826672 1:48988780-48988802 ATGGGCAGGTGGAGGGGAGGAGG + Intronic
907935888 1:59041937-59041959 AGGGGGAGGTGGAAGGATTGGGG + Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908742618 1:67344067-67344089 AGGTTCAGGTGGAAGGATGATGG + Intronic
908798498 1:67854872-67854894 ATGGGCAGGAGGTAGGAAGGGGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909594537 1:77391183-77391205 ATGGGCAGGTAGGATGATTATGG + Intronic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
909715440 1:78701932-78701954 ATGGCCAGGTGGAAGGGTTGGGG + Intergenic
910232359 1:84998909-84998931 ACGGACAGGTGGGGGGATGAGGG + Intergenic
910409599 1:86926219-86926241 ATGGGCAGGTGGAACAATTTTGG - Intronic
910713801 1:90208663-90208685 GTGGGCAGGAGGGAGGATGCTGG + Intergenic
910852610 1:91663646-91663668 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
912704631 1:111902852-111902874 ATGGGCAGGGGGATATATGAAGG - Intronic
913666418 1:121052495-121052517 ATGGGCAGGTGGCACCAGGAAGG + Intergenic
913962600 1:143351954-143351976 ATGGCCAGGTGGAAGGGAGCAGG - Intergenic
913967761 1:143391364-143391386 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
914056955 1:144177539-144177561 ATGGCCAGGTGGAAGGGAGCAGG - Intergenic
914062139 1:144216954-144216976 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
914117011 1:144749400-144749422 ATGGGCAGGTAGGAAGATGCTGG + Intergenic
914122191 1:144788827-144788849 ATGGCCAGGTGGAAGGGAGCAGG + Intergenic
914351293 1:146842712-146842734 ATGGGTGGGTGGGTGGATGATGG + Intergenic
914351346 1:146842928-146842950 ATGCGAGGGTGGATGGATGATGG + Intergenic
914351353 1:146842947-146842969 ATGGGTGGGTGGGTGGATGATGG + Intergenic
914351361 1:146842974-146842996 ATGGGTGGGTGGATGGATGATGG + Intergenic
914916669 1:151823287-151823309 ATGGGGAGGTGGGAGGCCGAGGG - Intronic
915080582 1:153349188-153349210 AGTGGCAGGCGGGAGGATGATGG - Intergenic
916491482 1:165306151-165306173 ATGAACAGGTGGGAGGAAGAAGG - Intronic
916766795 1:167868658-167868680 ATGGGCAGTAGGAAGAAAGATGG - Intronic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
918646823 1:186915572-186915594 ATGGGCAGTAGGAAGAAAGATGG + Intronic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
919970580 1:202574815-202574837 GGTGGCAGGTGGAAGGATGATGG - Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
921261958 1:213392408-213392430 ATTGGCAGGTGGGAGGAGGAGGG + Intergenic
921556550 1:216604974-216604996 ATGGACAGGTGGATGGAAGGAGG + Intronic
922427151 1:225509312-225509334 GGCGGCGGGTGGAAGGATGAGGG + Intronic
922680414 1:227590646-227590668 ATGGGCAGTAGGAAGAAAGATGG + Intronic
922690452 1:227685027-227685049 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
922745579 1:228041599-228041621 ATGGGTGGGTGGATAGATGATGG - Intronic
922996404 1:229965782-229965804 TTTGGAAGCTGGAAGGATGATGG - Intergenic
923301440 1:232644323-232644345 ATGGATAGATGGATGGATGAAGG - Intergenic
923307227 1:232699267-232699289 ATGGGCAGGGAAAAGGAGGAAGG + Intergenic
923415106 1:233749095-233749117 ATCAGTAGCTGGAAGGATGATGG + Intergenic
924034274 1:239920310-239920332 ATGGATGGGTGGATGGATGATGG - Intergenic
924247228 1:242096885-242096907 AGGGGGAGGGGGAAGGAGGAGGG - Intronic
924446819 1:244140591-244140613 TGGGGTAGGTGGATGGATGATGG - Intergenic
1062842712 10:683488-683510 AAGGGAAGGTGGAAGCAGGAAGG + Intronic
1062940191 10:1415065-1415087 ATGGGTGGGTGGATGGATGGTGG + Intronic
1063371066 10:5523511-5523533 TTGGGCAGGAGGAAGCAGGAAGG - Intergenic
1063414538 10:5862844-5862866 ATGCGCAGTTGGAAGGGAGAAGG + Intronic
1063523401 10:6761120-6761142 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1063978699 10:11436874-11436896 CTGGGAAAGTGGCAGGATGAAGG + Intergenic
1064470486 10:15630292-15630314 GTGTGCAGCTGGAAGGATGCTGG + Intronic
1065626054 10:27629807-27629829 TTAGGCAAGTGCAAGGATGAGGG + Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067346457 10:45441979-45442001 ATGGGCTGGGGAAAGGAGGAAGG - Intronic
1067374604 10:45716024-45716046 GTAGGCAGGTGGAATTATGAGGG - Intergenic
1067739584 10:48884455-48884477 ATGCGCATGTGTAAGGATAAGGG - Intronic
1067882414 10:50057662-50057684 GTAGGCAGGTGGAATTATGAGGG - Intergenic
1067925284 10:50502430-50502452 ATGGGCAGGTAGAAGGAACTGGG - Intronic
1068633676 10:59324745-59324767 AGGGGGTGGTGGCAGGATGAGGG - Intronic
1068654451 10:59560400-59560422 ATGGGCAGGGGCAGGGAAGAGGG - Intergenic
1068671449 10:59727657-59727679 ATGGGCAGTAGGAAGAAAGATGG + Intronic
1069320018 10:67158152-67158174 ATGGGCAGTAGGAAGAAAGATGG - Intronic
1069335146 10:67340174-67340196 AAGGGCAGGAGGAAGGAGGAGGG + Intronic
1069640213 10:69950131-69950153 AGGGGGAGGGGAAAGGATGAAGG - Intronic
1069833595 10:71295339-71295361 ATGGACAGATGGATGGATGGAGG - Intronic
1069862969 10:71482620-71482642 CTGGGCAGGTGGAGGGGTTAGGG + Intronic
1071104672 10:82080459-82080481 ATGGGAAGGTGGCAGAAGGAGGG - Intronic
1072225925 10:93368564-93368586 ATGGACAGATGGAGGGATGGAGG + Intronic
1072306864 10:94116083-94116105 AGGAGCAGGAGGAAGGATCAGGG - Intronic
1072335164 10:94391392-94391414 ATGGGCAGTAGGAAGAAGGATGG - Intergenic
1072542508 10:96409174-96409196 ATGGATATGTGGATGGATGAGGG - Intronic
1072918176 10:99553261-99553283 CTGGGCTGGGGGAAAGATGAGGG - Intergenic
1073038052 10:100578154-100578176 GTGAGCAGGTGAATGGATGAAGG + Intergenic
1073348513 10:102802095-102802117 AGGAGAAGGTGGAAGGAGGAGGG - Intronic
1073467381 10:103702057-103702079 ATGGATAGATGGATGGATGATGG - Intronic
1073529549 10:104218738-104218760 ATGGGGAGGGAAAAGGATGAGGG - Intronic
1074103013 10:110368421-110368443 ATAGACAGGTGGCTGGATGAAGG + Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074758278 10:116644197-116644219 ATGTGCGGGTGGAGGGATGATGG - Intronic
1074885907 10:117693497-117693519 ATGGGGAGGAGATAGGATGATGG + Intergenic
1075048761 10:119166316-119166338 AAGGGCAGGTGGGAGGAGGAAGG - Intergenic
1075906437 10:126085762-126085784 ATGAGCGGGTGGCTGGATGATGG - Intronic
1076117809 10:127912819-127912841 ATGGAGAGATGGATGGATGAAGG + Intronic
1076136770 10:128050426-128050448 ATGGATGGGTGGATGGATGATGG + Intronic
1076290695 10:129343399-129343421 GTAGGGAGGTGGAAGGAAGATGG - Intergenic
1076676780 10:132151265-132151287 GTGGATAGGTGGAAGGATAAAGG - Intronic
1076798327 10:132809453-132809475 AGGGGCAGGAGGAAGGCAGACGG - Intronic
1076867378 10:133174733-133174755 ATGGATGGGTGGATGGATGATGG + Intronic
1077142687 11:1031353-1031375 ATGAGCAGGTGGGGGGATGGTGG - Intronic
1077150225 11:1069852-1069874 ATGGATAGGTGGATGGATGGAGG - Intergenic
1077159454 11:1106100-1106122 CTAGGTAGGTGGAAGGATGGAGG - Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077163254 11:1123119-1123141 AGGGGGAGGGGGAAGGAAGAAGG - Intergenic
1077248974 11:1552254-1552276 ATGGGCAGATGGATGAATGGTGG - Intergenic
1077418148 11:2435496-2435518 ATGGACAGATGGACGGATGGAGG - Intergenic
1077599844 11:3566683-3566705 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1079026311 11:16950670-16950692 ATGGGCAGGTGGAGGGAATGTGG - Intronic
1079336550 11:19575296-19575318 ATGGGCAGGTGGAAGCATGCTGG + Intronic
1079440422 11:20508491-20508513 GTGAGCAGATGGATGGATGATGG + Exonic
1079619155 11:22532355-22532377 ATTGGCAGATGAGAGGATGAGGG + Intergenic
1079657484 11:23000930-23000952 GTGGGTAGGTGGAGGAATGACGG - Intergenic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1080631397 11:34080356-34080378 ATGGGCAGGAGTATGGGTGAGGG + Intronic
1080692070 11:34566572-34566594 ATCTGCAGGTGGAAGAAGGAAGG - Intergenic
1080716789 11:34810343-34810365 CAGCGCAGGTGGAAAGATGATGG + Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1080770825 11:35339671-35339693 ATGGGCAGATGGATGGATGGAGG + Intronic
1080849334 11:36054767-36054789 ATGGATAGATGGATGGATGATGG + Intronic
1081206444 11:40281022-40281044 ATGGGGAGGACTAAGGATGAAGG + Intronic
1081626491 11:44659063-44659085 ATGGAGAGATGGAAGGATGAAGG + Intergenic
1081629960 11:44682340-44682362 ATGGGTGGATGGATGGATGATGG - Intergenic
1081765850 11:45609607-45609629 ATGCACAGATGCAAGGATGATGG + Intergenic
1081866802 11:46364753-46364775 TTGGGCAGGAGGAAGGATGAAGG - Intronic
1082089474 11:48077606-48077628 GTGGGCAGGTGGCAGGATATTGG - Intronic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083197532 11:61097632-61097654 ATGGGCAGTTGGAAGAAAGATGG - Intergenic
1083201252 11:61122356-61122378 GTGGGTGGGTGGATGGATGATGG + Intronic
1083296850 11:61719637-61719659 CAGGGCAGGAGGAAGGCTGAAGG - Intronic
1083588866 11:63880646-63880668 ATGGGCAGCAGGAAGTGTGAAGG + Intronic
1083634625 11:64113781-64113803 ATGGACAGGTGCATGCATGATGG + Intronic
1083634773 11:64114569-64114591 ATGGACAGGTAGATGCATGATGG + Intronic
1083720622 11:64601898-64601920 CTGGGCAGGTGGACGGGTGTGGG - Exonic
1084255753 11:67941304-67941326 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1084302450 11:68260387-68260409 TTGGGCAGGTGGGCAGATGAAGG + Intergenic
1084445051 11:69198766-69198788 ATGGAGAGATGGAAGGATGAAGG - Intergenic
1084461884 11:69300800-69300822 ATGAGTGGGTGGATGGATGAAGG + Intronic
1084494982 11:69498341-69498363 ATGTGTAGGTGGAAGGGTGCAGG + Intergenic
1084495080 11:69498721-69498743 GTGGGTAGGTGGAGGGATGGAGG + Intergenic
1084596263 11:70118745-70118767 ATGGACAGATGGATGGTTGATGG + Intronic
1084596322 11:70119011-70119033 ATGGGTGGGTGGATGGATGATGG + Intronic
1084596357 11:70119173-70119195 ATGGGTGGGTGGATGGGTGATGG + Intronic
1084596366 11:70119214-70119236 ATGGGTGGGTGGAGGAATGATGG + Intronic
1084596393 11:70119309-70119331 ATGGGTGGGTGGATGGATGATGG + Intronic
1084596401 11:70119350-70119372 ATGGGTGGGTGGATGAATGATGG + Intronic
1084596508 11:70119891-70119913 ATGGGTGGGTAGATGGATGATGG + Intronic
1084776320 11:71379143-71379165 ATGGGGTGATGGATGGATGATGG + Intergenic
1084781802 11:71414776-71414798 ATGGGTGGGTAGATGGATGATGG + Intergenic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1084817005 11:71654023-71654045 ATGTGCAGGTGGAATGAAGAGGG + Intergenic
1084882041 11:72178267-72178289 AAGCGCAGGTGGAAGGAAGATGG + Intergenic
1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG + Intronic
1085240092 11:75045931-75045953 ATGGGCAGTAGGAAGAAGGATGG - Intergenic
1085406878 11:76268703-76268725 ATGGGTGGATGGATGGATGATGG - Intergenic
1085464273 11:76713500-76713522 GTGGGAGGGTGGATGGATGATGG + Intergenic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1086215206 11:84370896-84370918 GTGGGCAGGTGGTGGGAGGAGGG + Intronic
1086457154 11:86970466-86970488 CTGGGGAGATGGAAGGATGCTGG - Intergenic
1087011346 11:93516948-93516970 AAGGGAAGGTGGAAGGCAGAGGG - Intronic
1087158930 11:94930342-94930364 ATGGGGAGGTGGGAGAATGAAGG + Intergenic
1087199160 11:95328384-95328406 AGGAGCATGTGGCAGGATGAGGG - Intergenic
1087396617 11:97609145-97609167 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1088371142 11:109089807-109089829 ATAGGCAGCTGGAGGGAGGAAGG - Intergenic
1088699151 11:112396645-112396667 AAGGGCAGGTGGGAGGAACAGGG - Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089386027 11:118068620-118068642 ATGAGCTGGGGCAAGGATGAAGG + Intergenic
1089464206 11:118673720-118673742 ATGGTCAGGCGGAAGGACAATGG - Intronic
1089862556 11:121602896-121602918 ATGGGCAGGGGGCAGGGTGCGGG + Intronic
1089868260 11:121650757-121650779 AAGGGCTGCAGGAAGGATGAAGG - Intergenic
1090241893 11:125189735-125189757 AGGGACAGGTGGGAGGATGGTGG - Intronic
1090254424 11:125273366-125273388 ATGGGCAGATGGGAGAAGGAGGG + Intronic
1090334193 11:125951768-125951790 ATGGCCCTGTGGAAGGAGGAAGG - Intergenic
1090805510 11:130199705-130199727 AGGGGGAGGTGGGAAGATGAGGG + Intronic
1090973910 11:131666199-131666221 ATAGGCAGGGTGAAGGGTGAAGG - Intronic
1091187354 11:133658452-133658474 ATGGGTAGATGGATGAATGATGG + Intergenic
1091300995 11:134508147-134508169 AAGGACAAGTGGAAGAATGAAGG + Intergenic
1091814148 12:3423571-3423593 ATGGGCAGTAGGAAGAAAGATGG + Intronic
1092125137 12:6069902-6069924 ATGGACAGTTGGAAGGATGATGG + Intronic
1092425993 12:8376042-8376064 ATGTGCAGGTGGAATGAAGAGGG - Intergenic
1092971922 12:13704330-13704352 ATGGGCTGATGAAAGGAAGAAGG + Intronic
1093531957 12:20176079-20176101 TTGGGGAGGAAGAAGGATGAAGG - Intergenic
1094498619 12:31004757-31004779 GAGGGCAGGAGGAAGGAAGAAGG + Intergenic
1095670750 12:44857463-44857485 AGGGGCCGGTGGAATGTTGACGG - Intronic
1095748097 12:45682162-45682184 ATGAGGAGGTGGAAGGGGGATGG - Intergenic
1095805759 12:46319183-46319205 GGGGGCAGGTGAAAGGAAGAGGG - Intergenic
1096160265 12:49370781-49370803 CTGGGCAGGTGGGAGGAGGTTGG - Intronic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098599839 12:72317888-72317910 AGGGGCAGGAGGAAGGATGTAGG + Intronic
1098639223 12:72819530-72819552 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
1099271738 12:80519525-80519547 ATGGGCACTTTGAAGGAGGAGGG + Intronic
1099849507 12:88074642-88074664 TAGGGCAGGTGAAAGGAGGATGG - Intronic
1099965446 12:89440459-89440481 AATGGCTGGGGGAAGGATGAAGG + Intronic
1100043208 12:90345516-90345538 ATGAGCAGGTAGAAGAATGAGGG + Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100837283 12:98578246-98578268 ATGGGTAGGTGGATGGGTGGAGG + Intergenic
1101588597 12:106107071-106107093 TTGGGCAAGAGGAAGGATGTAGG - Intronic
1102041329 12:109802807-109802829 ATGGATAGATGGATGGATGAAGG - Intronic
1102043164 12:109813822-109813844 ATGGACAGATGGAAGGATGATGG + Intronic
1102043175 12:109813899-109813921 ATGGACAGATGGAATAATGATGG + Intronic
1102426243 12:112846521-112846543 ATGGGGAGGAGGGAGGAAGATGG + Intronic
1102455081 12:113065979-113066001 AGAGCCAGGTGGAAGGATGGAGG - Intronic
1102504242 12:113373827-113373849 ATGGGTAGATGGATGGATGATGG - Intronic
1102789136 12:115629621-115629643 ATGGACAGGTGGATGGATAATGG + Intergenic
1102796667 12:115694993-115695015 ATGGGAAAGTGGAAGGAACATGG - Intergenic
1102856099 12:116295468-116295490 ATGGGTAGATGGATGGAGGATGG + Intergenic
1102856117 12:116295545-116295567 ATGGGTGGGTGGATGGATAATGG + Intergenic
1102894442 12:116587478-116587500 ATGGGTAGCTAGATGGATGAAGG - Intergenic
1102988423 12:117297376-117297398 TTGGGTAAGTGGAAGGATGGTGG + Intronic
1102998920 12:117370274-117370296 ATGGACAGATGGATGGATGGAGG - Intronic
1103012784 12:117470068-117470090 ATGGGTGGATGGATGGATGAAGG - Intronic
1103012814 12:117470277-117470299 ATGGGTGGATGGATGGATGAAGG - Intronic
1103038219 12:117673445-117673467 ATGGACAGATGGAAAGAGGAAGG + Intronic
1103427151 12:120845663-120845685 GTGGACAGGTGGAAGGACGCTGG + Intronic
1103444843 12:120988060-120988082 GTGGGTGGGTGGATGGATGATGG - Intronic
1103444860 12:120988123-120988145 GTGGGTGGGTGGATGGATGATGG - Intronic
1103444893 12:120988249-120988271 GTGGGTGGGTGGATGGATGATGG - Intronic
1104034688 12:125090140-125090162 ATGGATAGATGGATGGATGATGG - Intronic
1104188254 12:126453340-126453362 ATGGGCAGGTGTTAGCATGGAGG - Intergenic
1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG + Intergenic
1104320192 12:127743398-127743420 AAGGGCAGCTTGAAGGCTGAAGG + Intergenic
1104727125 12:131084953-131084975 AGGGACAGATGGAGGGATGAGGG - Intronic
1104778430 12:131404735-131404757 GTGGGTGGGTGGATGGATGATGG - Intergenic
1104778450 12:131404809-131404831 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778506 12:131405026-131405048 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778535 12:131405139-131405161 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778550 12:131405194-131405216 ATGGGTGGGTGGATGGATGATGG - Intergenic
1104778581 12:131405310-131405332 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778630 12:131405470-131405492 ATGGATGGGTGGATGGATGATGG - Intergenic
1104813973 12:131635343-131635365 ATGAGAAGGTAGATGGATGATGG - Intergenic
1104896088 12:132164541-132164563 GTGGGTGGGTGGACGGATGATGG - Intergenic
1104896102 12:132164584-132164606 ATGGCTAGGTAGACGGATGATGG - Intergenic
1104896220 12:132166305-132166327 ATGGCTGGGTGGATGGATGATGG - Intergenic
1104896271 12:132166523-132166545 ATGGCTGGGTGGATGGATGATGG - Intergenic
1104896432 12:132167125-132167147 ATGGGTGGGTGGATGGATGATGG - Intergenic
1104968041 12:132518290-132518312 ATGGACAGATGGGTGGATGATGG - Intronic
1104968159 12:132518850-132518872 ATGGACAGATGGGTGGATGATGG - Intronic
1105279828 13:18956988-18957010 ATGGGTAGATGGATGGATCATGG - Intergenic
1105722817 13:23134242-23134264 AGGAGCAGGTGGAAGAGTGATGG - Intergenic
1105850883 13:24335699-24335721 ATGGACAGATGGATGGATGGAGG - Intergenic
1106076347 13:26464465-26464487 TTGGGCAGGTGGCCTGATGATGG - Intergenic
1106184697 13:27399140-27399162 CTGGGCTGGTGCAGGGATGAAGG + Intergenic
1106792138 13:33166563-33166585 ATGAGCAGGTGGCAGGCTCAAGG - Intronic
1106945648 13:34824662-34824684 TTGGCCAGGTGGAAGAATGAGGG + Intergenic
1107846306 13:44516946-44516968 ATCAGCAGGTGGCAGGAAGAAGG - Intronic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1110190420 13:72723998-72724020 AGAGGCAGGAGGAAGGGTGATGG + Intronic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110980456 13:81890326-81890348 ATGGGCACGAGGAAACATGATGG - Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1112196032 13:97227271-97227293 ATGGGCAGGTCCAAGGTTTATGG + Intronic
1112696106 13:101949941-101949963 TTGGGCAGGTGGCAGGAAGTAGG + Intronic
1112729238 13:102341381-102341403 ATGGGTAGATGAATGGATGATGG - Intronic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1112869728 13:103955341-103955363 AAGGGCCGGTGGAAGGAAAAGGG - Intergenic
1113098125 13:106688048-106688070 ATGGTCAGGTTGAACTATGAAGG + Intergenic
1113641391 13:111959873-111959895 ATGGACAGATGGGTGGATGATGG + Intergenic
1113774432 13:112934740-112934762 ACAGGCAGGTGGAAGGTTGGAGG + Intronic
1113780263 13:112972741-112972763 ATGGGTGGGTGGATGGATGGAGG + Intronic
1114354023 14:21887777-21887799 AGGAGGAGGAGGAAGGATGAGGG + Intergenic
1115625248 14:35185551-35185573 ATTGGCAGGTGGAAGTTTGCAGG - Intronic
1116216126 14:42019581-42019603 ATTGACAGCTGGAAGGATGGTGG + Intergenic
1117258235 14:54002191-54002213 ATGGGCAGCTGGAAGGATCATGG - Intergenic
1117447723 14:55820748-55820770 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
1117508926 14:56429405-56429427 AGGGGCAGGTAAAAGGAAGAGGG - Intergenic
1117996026 14:61479152-61479174 ATGGACAGGTGGGTGGGTGAAGG - Intronic
1118354079 14:64997357-64997379 ATAGGGATGTGGAAGGAAGATGG - Intronic
1118474289 14:66102356-66102378 ATGGGGAGCTGGAAAGGTGATGG - Intergenic
1118722247 14:68602471-68602493 GTGGGTGGGTGGATGGATGATGG + Intronic
1119206615 14:72799175-72799197 ATGGGTTGATGGAAGGATGGAGG - Intronic
1119913314 14:78371372-78371394 AAGGGGAGGTGGAAGGGGGATGG - Intronic
1120988539 14:90354976-90354998 ATGGGGAGGGGAAAGGAGGAGGG + Intergenic
1121519747 14:94577840-94577862 ATGGGCAGAGGGAAGCATGGTGG + Intronic
1121585440 14:95060099-95060121 ATGGGGTGGTGGCAGGAGGATGG - Intergenic
1121604862 14:95233316-95233338 ATGGGTGGATGGAGGGATGATGG - Intronic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1121780459 14:96618840-96618862 ATAGACAGGAGGAAGGAGGAGGG - Intergenic
1121991608 14:98563119-98563141 AAGAGCAGGTGGATGGCTGAGGG + Intergenic
1122138379 14:99647443-99647465 GTGGGCAGGTGGATGGAGGAAGG + Intronic
1122216188 14:100206284-100206306 TTGGGCAGGTGAAAGGAGGCAGG - Intergenic
1122252798 14:100452003-100452025 ATGGATAGTTGGATGGATGATGG - Intronic
1122354980 14:101117546-101117568 ATGGACAGATGGATGGATGATGG - Intergenic
1122448826 14:101787350-101787372 TTTGCCAGGTGGAAGGAGGAAGG + Intronic
1122879821 14:104685739-104685761 ATGGGCAGATGGATGGATAAGGG + Intergenic
1122879862 14:104685891-104685913 ATGGGCAGATGAATGGATGAGGG + Intergenic
1122879911 14:104686051-104686073 ATGGGCAGATGGATGGATGAGGG + Intergenic
1122879963 14:104686263-104686285 ATGGGCAGATGGATGGATAAGGG + Intergenic
1122879999 14:104686408-104686430 ATAGGCAGATGGATGGATGAGGG + Intergenic
1122883370 14:104699928-104699950 TTGGACAGGTGGAGGGCTGAGGG + Intronic
1122958315 14:105083072-105083094 ATGGGTGGATGGATGGATGATGG - Intergenic
1122958337 14:105083153-105083175 ATGGGTGGATGGATGGATGATGG - Intergenic
1123058848 14:105585398-105585420 ATGGACTGATGGATGGATGATGG - Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1123469306 15:20538415-20538437 AGTGCCAGGTTGAAGGATGATGG + Intronic
1123648757 15:22462283-22462305 AGTGCCAGGTTGAAGGATGATGG - Intronic
1123729580 15:23133402-23133424 AGTGCCAGGTTGAAGGATGATGG + Intronic
1123747747 15:23330884-23330906 AGTGCCAGGTTGAAGGATGATGG + Intergenic
1123762533 15:23443940-23443962 AGTGCCAGGTTGAAGGATGATGG + Exonic
1124280115 15:28354735-28354757 AGTGCCAGGTTGAAGGATGATGG + Intergenic
1124302585 15:28556876-28556898 AGTGCCAGGTTGAAGGATGATGG - Intergenic
1124334303 15:28845678-28845700 AGTGCCAGGTTGAAGGATGACGG + Intergenic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125670062 15:41465141-41465163 AAGGGAAGGGGGAAGGAGGAAGG - Intronic
1125760868 15:42094622-42094644 AGGGGCAGGTGCAGGGCTGAAGG - Intergenic
1126101920 15:45123203-45123225 ATGGGGAGATGGATGGCTGAGGG - Intronic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1127288828 15:57552915-57552937 AAGGGCATGTGGTAGGATGTGGG + Intergenic
1127454291 15:59143347-59143369 GTGGGCAGGTGGGTGGAGGAGGG + Intronic
1127774725 15:62255840-62255862 AGCAGCAGGTTGAAGGATGACGG + Intergenic
1127975244 15:63992344-63992366 ATGGGCAGGTGGGTGGGTGGTGG - Intronic
1128228668 15:66019929-66019951 ATGGGCAGGTGAAGGATTGAAGG - Intronic
1128252239 15:66171526-66171548 ATGGAGAGGTGGGAGGAGGAGGG + Intronic
1128441028 15:67708675-67708697 ATGGGCAGGAGGAAGAAGGCAGG - Intronic
1128793748 15:70450360-70450382 ATGGGTGGATGGAGGGATGAAGG + Intergenic
1128924877 15:71645925-71645947 TTGGACAGGTGGAGGGATGAGGG - Intronic
1129029640 15:72609010-72609032 AGTGCCAGGTTGAAGGATGATGG - Intergenic
1129037579 15:72660044-72660066 AGTGCCAGGTTGAAGGATGACGG - Intronic
1129118371 15:73379358-73379380 ATGGGAAGGTAGAAGAGTGATGG - Intergenic
1129212308 15:74077181-74077203 AGTGCCAGGTTGAAGGATGACGG + Intronic
1129236594 15:74227388-74227410 CTGGGCACGTGAAAGGATCACGG + Intergenic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129351514 15:74958359-74958381 TAGGGCGGGTGGAAGGAGGACGG - Intronic
1129398089 15:75263898-75263920 AGTGCCAGGTTGAAGGATGACGG - Intronic
1129401700 15:75288179-75288201 AGTGCCAGGTTGAAGGATGACGG - Intronic
1129450990 15:75651357-75651379 TTGGGGAGGTGGCAGGAGGAAGG - Intronic
1129475292 15:75780886-75780908 AGTGACAGGTTGAAGGATGATGG - Intergenic
1129729437 15:77921499-77921521 AGTGCCAGGTTGAAGGATGATGG + Intergenic
1129839080 15:78732471-78732493 AGTGCCAGGTTGAAGGATGACGG - Intergenic
1130104202 15:80917285-80917307 ATGGGCAGGAGGCAGGAGGCAGG + Intronic
1130353648 15:83111488-83111510 ATGGATAGATGGATGGATGATGG - Intronic
1130560418 15:84953889-84953911 ATGGGCACCAGGAGGGATGAGGG + Intergenic
1130615111 15:85398941-85398963 AGAGGCAGGAGGAAGGGTGATGG - Intronic
1131254238 15:90851335-90851357 CAGGGCAGGTGAAAGGATGTGGG - Intergenic
1131774689 15:95781990-95782012 AGGGGCAGGTGGAATAATGTGGG - Intergenic
1132568516 16:634148-634170 TGGGGCACCTGGAAGGATGAGGG - Intergenic
1132644833 16:994055-994077 ATGGGTGGGTGGATGGATGGGGG - Intergenic
1132649599 16:1014500-1014522 ATGGGCAGGTGGACCCATGGAGG - Intergenic
1132709468 16:1259964-1259986 GAGGGCAGGTGGGAGGGTGAAGG + Intergenic
1133231264 16:4367799-4367821 ATGGGCAGGTGGAGGCTAGACGG + Intronic
1133715414 16:8442703-8442725 CTCGGCAGGTGGAAGGTGGAAGG + Intergenic
1134038272 16:11048730-11048752 AGGGGCTGGAGGAATGATGAGGG - Intronic
1134066595 16:11232462-11232484 AGGGGCAGGGGGGAGGAGGAGGG + Intergenic
1134106984 16:11492310-11492332 ATGGGTGGGTGGATGGATGATGG - Intronic
1134224406 16:12380392-12380414 GTGGGTGGGTGGATGGATGAGGG - Intronic
1134224447 16:12380514-12380536 GTGGACAGGTGGATGGATGAGGG - Intronic
1134224564 16:12380881-12380903 GTGGGTAGGTGGATGGATGGTGG - Intronic
1134224733 16:12381414-12381436 ATGGGTGGGTGGGTGGATGATGG - Intronic
1134224745 16:12381456-12381478 GTGGATAGGTGGATGGATGATGG - Intronic
1134224769 16:12381533-12381555 GTGGATAGGTGGATGGATGATGG - Intronic
1134224790 16:12381607-12381629 GTGGGTGGGTGGATGGATGATGG - Intronic
1134224857 16:12381822-12381844 ATGGGTGAGTGGATGGATGATGG - Intronic
1134320347 16:13157145-13157167 ATGGGGGGATGGACGGATGATGG - Intronic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135097733 16:19578507-19578529 AGGGACTGGTGGAGGGATGAAGG - Intronic
1135276917 16:21121110-21121132 GTGAGAAGGTGGAAGGGTGAGGG + Intronic
1135629368 16:24023780-24023802 ATGGGTAAGTGGAAGGTTGGGGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135828833 16:25755001-25755023 ATGGACAGATGGATGGATGATGG - Intronic
1135943498 16:26843258-26843280 ATTGGCAGGAGGAGGGAAGAAGG + Intergenic
1136071358 16:27789417-27789439 ATGGATAGATGGAGGGATGATGG + Exonic
1136071417 16:27789822-27789844 ATGGGTGGATGGATGGATGAAGG + Exonic
1136105821 16:28029685-28029707 ATGGACAGATGGAAGAATGATGG + Intronic
1136279085 16:29197554-29197576 ATGGGTGGGTGGATGTATGACGG + Intergenic
1136279091 16:29197589-29197611 ATGGGTGGGTGGATGTATGATGG + Intergenic
1137017491 16:35392543-35392565 ATGGGCAGGGGGCAGGAAGGTGG - Intergenic
1137402867 16:48167458-48167480 TTGGGCTGGTGGGAGGATGAGGG - Intronic
1137511996 16:49108899-49108921 GTGGGGAGGAGGAAGGATGATGG - Intergenic
1137569431 16:49555682-49555704 ATGGACAGGTGGATGGTAGATGG + Intronic
1137630065 16:49936925-49936947 ATGGGCAGGTGGACTCTTGATGG + Intergenic
1137832575 16:51558047-51558069 ATGGGGAGGGGGGAGGATGAGGG + Intergenic
1138495712 16:57408002-57408024 ATGGGTAGATGGATGGATGGAGG - Intronic
1138622707 16:58224608-58224630 ATGGCCACGGGGAAGGATGCTGG - Intergenic
1138637406 16:58352143-58352165 AAGGGCAGGGGGAGGGAAGAGGG - Intronic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1139982685 16:70872603-70872625 ATGGGTGGGTGGGTGGATGATGG - Intronic
1139982692 16:70872622-70872644 ATGCGAGGGTGGATGGATGATGG - Intronic
1140067681 16:71625363-71625385 ATGGGTGGGTGGATGGATGGTGG + Intergenic
1140962590 16:79930901-79930923 AAGGCCAAGTGGATGGATGATGG - Intergenic
1141110201 16:81265693-81265715 ATGGGTAGGTAGATGGATGGTGG - Intronic
1141308662 16:82891540-82891562 ATGAGCAGTTGGAGGGGTGATGG - Intronic
1141421528 16:83920982-83921004 ATGGATGGGTGGAAGGAAGATGG + Exonic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141447638 16:84072301-84072323 AAGGGCTGGTGGAAGGAAGAAGG + Intronic
1141483829 16:84325575-84325597 ATGGGTGGGTGGATGGATGGTGG - Intronic
1141641852 16:85346225-85346247 AGGGGCGGGTGGGTGGATGATGG + Intergenic
1141641874 16:85346331-85346353 ATGGGCAGGTAGATGGATGGTGG + Intergenic
1141641884 16:85346369-85346391 GTGGGCAGGTGGGTGGATGATGG + Intergenic
1141641894 16:85346403-85346425 ATGGGCGGGTGGATGGGTGATGG + Intergenic
1141641906 16:85346453-85346475 ATGGGCTGATGGGTGGATGATGG + Intergenic
1141641926 16:85346536-85346558 ATAGGCGGGTGGATGGGTGATGG + Intergenic
1141641938 16:85346589-85346611 GTGGGCAGATGGGTGGATGATGG + Intergenic
1141641994 16:85346840-85346862 ATGGGCAGGTGGATGGGTGATGG + Intergenic
1141641998 16:85346859-85346881 ATGGACAGGTAGATGGATGGTGG + Intergenic
1141642269 16:85348250-85348272 AGGGGCAGGTGGGTGGATGATGG - Intergenic
1141852721 16:86658468-86658490 GTGGGCAGGTAGAAAGATGAAGG - Intergenic
1141877947 16:86839025-86839047 CCGGGCAGGAGGAAGGAGGAAGG + Intergenic
1142083484 16:88163682-88163704 ATGGGTGGGTGGATGTATGATGG + Intergenic
1142152701 16:88519711-88519733 ATGGGAGGGTGGGTGGATGATGG + Intronic
1142257786 16:89023682-89023704 CTGGGCAGGTCCAAGGATGTGGG - Intergenic
1142567730 17:851461-851483 AAGGGCAGGTGGAAAGAGCAGGG + Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143152285 17:4815103-4815125 CTGGGCAGGTGGATGGATAGAGG + Intronic
1143319938 17:6061625-6061647 ATGGACAGGTGGGTGGATGTGGG + Intronic
1143603915 17:7969623-7969645 ATGGGGAGGTGGCGGGTTGATGG - Intergenic
1143666670 17:8366168-8366190 ATGGGCACGGGGAAGGAGAAAGG - Intergenic
1143688774 17:8542311-8542333 ATGGGGAGGTGGAGGGAAAATGG + Intronic
1143994756 17:10996954-10996976 TTGGGCAGGAGGAAGGACCAAGG - Intergenic
1144063243 17:11601788-11601810 ATGGGGAGGTGGAAGGAAAAGGG - Intronic
1144239909 17:13300458-13300480 ATGGGCAGATGGAAGGCGCAAGG + Intergenic
1144624271 17:16836807-16836829 ATGGGCAGGACGAAGGAGGGAGG - Intergenic
1144882158 17:18435912-18435934 ATGGGCAGGACGAAGGAGGGAGG + Intergenic
1145150075 17:20508474-20508496 ATGGGCAGGACGAAGGAGGGAGG - Intergenic
1145258758 17:21342422-21342444 CTCGGCAGGTGGAAGGCTGTGGG + Intergenic
1145978849 17:28999657-28999679 GTAGGCAGGTGGAAGGAAGCTGG + Intronic
1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG + Intronic
1146162009 17:30565117-30565139 ATGGGCAGGATGAAGGAGGGAGG - Intergenic
1146459010 17:33029050-33029072 GTGGGAAGGGTGAAGGATGAGGG + Intronic
1146489233 17:33268319-33268341 ATGGAAAGATGGATGGATGATGG - Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146683969 17:34827967-34827989 CTGAGCAGGTGGAGGGGTGATGG + Intergenic
1146764519 17:35507151-35507173 ATGGGCAGTAGGAAGAAAGATGG - Intronic
1146786231 17:35724326-35724348 ATGGAAAGGGGGAAGCATGAAGG - Intronic
1146820913 17:35983033-35983055 ATGTGTGGATGGAAGGATGAAGG - Intergenic
1146908599 17:36633490-36633512 TTGGGCAGGGGGATGGAGGAAGG + Intergenic
1147164915 17:38587912-38587934 AGGGGCAGGGGGAAGAAAGAGGG - Intronic
1147859845 17:43512516-43512538 TTGGGCAGCTGGATGGAAGATGG + Intronic
1148123857 17:45227045-45227067 GTGGGCAGGTGGCAGGGAGATGG + Intronic
1148346110 17:46904498-46904520 ATGGGTGGCTGGACGGATGATGG + Intergenic
1148455838 17:47810987-47811009 ATGGGAAGAAGGGAGGATGATGG - Intronic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148828608 17:50413884-50413906 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
1149989246 17:61372032-61372054 ATGGAAAGATGGAAGGGTGACGG - Intronic
1151365352 17:73613224-73613246 CTGGGCAGGGGGCAGGAAGATGG + Intronic
1151657939 17:75504330-75504352 ATGGAAAGGTGGCAGGAGGAAGG + Intronic
1151775647 17:76199729-76199751 ATGAGCAGGTGGCAGTAGGATGG - Intronic
1152035823 17:77871986-77872008 ATGGGGTGGGGGAAGGAGGAAGG + Intergenic
1152436447 17:80279155-80279177 AAAGGCAAGTGGAAGGATGTGGG - Intronic
1152455308 17:80412307-80412329 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1152473753 17:80504248-80504270 ATGGGTGGATGGAGGGATGATGG + Intergenic
1152559776 17:81072165-81072187 TTGGGCAGGTGGAATGCAGATGG - Intronic
1152813575 17:82393866-82393888 AAGGACAGGGGGAAGGATGGAGG + Intronic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153571826 18:6481344-6481366 ATGGGGAGGGGGAAGGGTTAGGG - Intergenic
1153830731 18:8920146-8920168 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1154025865 18:10706470-10706492 GTGGGCAGCTGGAAGGGAGAAGG - Intronic
1154155925 18:11944057-11944079 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1154333809 18:13450574-13450596 ATGGGCAGGTGCAGGGCTGCAGG + Intronic
1155135747 18:22990697-22990719 AGTGGGAGGTGGAAGAATGAGGG - Intronic
1155268656 18:24118291-24118313 GTGGGCAGATGGGAGAATGATGG + Intronic
1155354726 18:24941210-24941232 ATGTGAAGATGGAAAGATGAGGG + Intergenic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1156205555 18:34882289-34882311 AAGGGAGGGTGGAAGGAAGAAGG - Intronic
1156444188 18:37222799-37222821 ATGGGCAGCTGCCAGGCTGATGG - Exonic
1156597742 18:38566686-38566708 ATGGACAGATGGAGGGATGGAGG + Intergenic
1157300000 18:46472456-46472478 ATGGGTAGGTGGGTGGATGGGGG - Intergenic
1157311483 18:46556633-46556655 GTGGGCAGGTATGAGGATGAGGG - Intronic
1157353869 18:46916228-46916250 ATGGGATGGGGGAAGGATGTTGG - Intronic
1157443891 18:47730652-47730674 CTGGGCAGGAGGCATGATGAGGG - Intergenic
1157484395 18:48076643-48076665 ATGGGCAGGGAGCAGGGTGAGGG + Intronic
1157504974 18:48219686-48219708 GTGGGCAGGTGGCAGGAGGGAGG + Intronic
1157687409 18:49653370-49653392 AGGGGCATGTGCAAGGGTGAGGG + Intergenic
1157777833 18:50410153-50410175 ATGGGCAGGTGGGAGGAGCCTGG - Intergenic
1158406596 18:57165464-57165486 AGGGGCAGCTGGATGGAGGAGGG - Intergenic
1158439867 18:57466147-57466169 ATTGGCAGGTGGAAGGGAGTGGG + Intronic
1158923935 18:62230333-62230355 TTGGGCAAGTGGAAGGATTATGG + Intronic
1159060959 18:63513305-63513327 AGGGGCAGAAGGAAGGATAAAGG + Intergenic
1159754222 18:72343680-72343702 AGGGGTAGGGGGAAGGATGGAGG + Intergenic
1160016149 18:75142080-75142102 ATAGGTAGCTGGAAGGATGTAGG + Intergenic
1160288847 18:77572023-77572045 ATGTGCATGTAGAAGGATGGAGG + Intergenic
1160319244 18:77875055-77875077 CTGGGCGGGTGGATGGAGGAGGG - Intergenic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1160384718 18:78488207-78488229 AGGGGCAGGAGGAAGGAAGCTGG - Intergenic
1160687129 19:442328-442350 ATGGGTGGGTGGATGGATGGAGG + Intronic
1160687365 19:443067-443089 ATGGGTGGGTGGATGGATGGAGG + Intronic
1160709562 19:544806-544828 ATGGGTAGAGGGATGGATGATGG - Intronic
1160834047 19:1116373-1116395 AGGGGCAGGGGGCAGGGTGAAGG + Intronic
1160977805 19:1802322-1802344 ATGGGTGGGTGGATGGATGTGGG - Intronic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161227654 19:3154557-3154579 GTGGACAGGTGGATGGATGATGG + Intronic
1161227674 19:3154644-3154666 ATGGGTGGGTGGATGGATGATGG + Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161258482 19:3322735-3322757 ATGGGCTGATGGATGGATGCAGG + Intergenic
1161287293 19:3475445-3475467 GTGGGTGGGTGGATGGATGATGG + Intronic
1161287572 19:3476892-3476914 GTGGGTGGGTGGATGGATGATGG + Intronic
1161329279 19:3678620-3678642 ATGGAGAGATGGAAGGATGGAGG + Intronic
1161347723 19:3776504-3776526 ATGGGTATGTGGATGGATGATGG + Intergenic
1161422747 19:4184773-4184795 ATGGGTGGGTGGATGGATGGGGG + Intronic
1161449133 19:4334870-4334892 ATGAGTAGGTGGATGGATGGAGG - Intronic
1161449153 19:4334951-4334973 ATGAGTGGGTGGATGGATGATGG - Intronic
1161449198 19:4335151-4335173 ATGAGTAGGTGGATGGATGATGG - Intronic
1161449213 19:4335220-4335242 ATGAGTAGGTGGATGGATGATGG - Intronic
1161681463 19:5681764-5681786 ATGGGTGGATGGATGGATGATGG - Intronic
1161916067 19:7229154-7229176 ATGGGTGAGTGGATGGATGATGG + Intronic
1162085825 19:8248597-8248619 ATGGGTAGGTGGATGGATGATGG + Intronic
1162085882 19:8248854-8248876 ATGGGTGGGTGGATGGATGGTGG + Intronic
1162085912 19:8249017-8249039 ATGGGTGGATGGATGGATGATGG + Intronic
1162155920 19:8677891-8677913 ATGGAAAGGAGGAAGGAAGAGGG - Intergenic
1162180893 19:8867934-8867956 ATGGGCAGGAGGATGGGTGATGG + Intronic
1162500786 19:11052469-11052491 ATGGCCAGGTGGAGGAAGGAGGG - Intronic
1162865141 19:13540266-13540288 AGTGGCAGCTGGAACGATGAGGG - Intronic
1162979349 19:14228602-14228624 GTGGGCAGGAGGATGGAGGATGG + Intergenic
1163058416 19:14740137-14740159 ATGGGAATGTGGAAGGTGGATGG + Intronic
1163238382 19:16043222-16043244 ATGGATGGGTGGATGGATGAAGG + Intergenic
1163238464 19:16043532-16043554 ATGGATGGGTGGATGGATGAAGG + Intergenic
1163283022 19:16328552-16328574 TTGGGGAGGAGGAAGGATGCAGG - Intergenic
1163360127 19:16840700-16840722 ATGATCAGGTGAACGGATGAAGG - Intronic
1163462143 19:17445426-17445448 GTGGGCAAGTAGATGGATGATGG - Intronic
1163571277 19:18083788-18083810 ATGGTGGGGTGGATGGATGATGG - Intronic
1163878427 19:19896599-19896621 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1164216552 19:23155722-23155744 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
1164678878 19:30120987-30121009 ATGGGTAGGTGGATGGATGATGG - Intergenic
1164700316 19:30280159-30280181 AAGTGCAGATGGAAGGATGGAGG - Intronic
1164826465 19:31288167-31288189 AGGGGATGGAGGAAGGATGATGG + Intronic
1165176516 19:33934388-33934410 AAGGGAAGGTGGAGGGGTGATGG + Intergenic
1165190314 19:34057442-34057464 ATGGGTAGATGGATGGATGATGG + Intergenic
1166069026 19:40377025-40377047 ATGGGCAGGTAGAGGGGTCAGGG + Intronic
1166174809 19:41059753-41059775 ATAGGAAGGTGGAAGGTGGAGGG + Intergenic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
1166561354 19:43734339-43734361 GTGGGCAGGAGGAAAAATGAGGG - Intronic
1167075405 19:47245501-47245523 GGGGGCAGCCGGAAGGATGAAGG + Intergenic
1167122853 19:47529314-47529336 ATGGCCAGGGGGAGGGAAGATGG - Intronic
1167277688 19:48548766-48548788 ATGGTCGGGTGGATGGATGATGG + Intergenic
1167469788 19:49669207-49669229 ATGGTCAGGTGGAAAGAGGCTGG + Intronic
1167581709 19:50348216-50348238 ATGGGCAGCAGGAAGAAAGATGG + Intronic
1167592706 19:50413221-50413243 ATGGTCAGGTGGAAAGAAGTGGG - Intronic
1167598194 19:50438270-50438292 ATGGGTAGGTGGATGGATAACGG + Intronic
1168330909 19:55567961-55567983 ATGGATAGGTGAATGGATGATGG + Intergenic
1202696438 1_KI270712v1_random:130212-130234 ATGGCCAGGTGGAAGGGAGCAGG - Intergenic
1202701548 1_KI270712v1_random:168832-168854 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
925068649 2:950179-950201 AAGGGAGGGTGGAAGGAGGAGGG + Intergenic
925192756 2:1898799-1898821 TCGGGCAGGTGGAGGGAAGAAGG + Intronic
925260197 2:2522047-2522069 ATGGGCAGGTGGATGGTGTATGG - Intergenic
925260240 2:2522311-2522333 GTGGGCAGGTGAATGGGTGAAGG - Intergenic
925383115 2:3441952-3441974 ATGGGCAGTTGTCAGGATAAGGG + Intronic
925658846 2:6181321-6181343 ATGGGGAGGAGGGAGGAAGACGG - Intergenic
925738571 2:6985469-6985491 ATGAGTAAGTGGAAGGATTAGGG + Intronic
925892299 2:8445445-8445467 ATGTGCAGGTGGAGGAATAAAGG + Intergenic
925925714 2:8668532-8668554 ATGGATGGGTGGATGGATGAGGG + Intergenic
926191829 2:10734227-10734249 AGGGGCAGATGGGAGGAGGAGGG - Intronic
926314711 2:11700839-11700861 CTGGGGAGGTGGAGGGATGTGGG - Intronic
926491091 2:13527152-13527174 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
926503482 2:13682638-13682660 ATAGGCAGGTGGAAGAAAAATGG - Intergenic
926550271 2:14293208-14293230 AAGGGCATGTAGAAGGATAATGG + Intergenic
926698626 2:15787910-15787932 ATGGACGGATGGAAGGAAGATGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927474924 2:23405886-23405908 ATGGGTAGGTGTAAGGAAGAGGG + Intronic
927521435 2:23701108-23701130 ATGGGAAGGTTGAGGGAGGAGGG - Intronic
928129388 2:28638600-28638622 GTGGGCTGGCGGATGGATGATGG + Intronic
929935811 2:46294048-46294070 GTGGGCTGGTGGAAGAAAGATGG - Intronic
930380526 2:50622134-50622156 AAAGGCAGGTGGAAGCATGCAGG + Intronic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932084879 2:68749105-68749127 AGAGGCAGATGGAAGGAAGAAGG + Intronic
932366409 2:71156224-71156246 GAGAGCAGGTGGAAGGATCAGGG + Intergenic
932430605 2:71671819-71671841 CTGGTCAGGAGGAAGGAAGAAGG + Intronic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
933809530 2:86024351-86024373 CTGGGGAGGTGGAAGGAATAGGG + Exonic
934026150 2:88003162-88003184 AGGGGCAGGAGGAAGGCCGAGGG - Intergenic
934038683 2:88109896-88109918 ATGGACATGTGGGAGGATGAGGG + Intronic
934172465 2:89552279-89552301 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
934282778 2:91626631-91626653 ATGGGCAGGTAGGAAGATGCTGG - Intergenic
935023299 2:99252577-99252599 ATGGATAGTTGGATGGATGAAGG + Intronic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935622695 2:105143666-105143688 GCGGGCGGGTGGAAGGAGGAAGG + Intergenic
935735726 2:106105383-106105405 ATGCGGAGGTGGCAGGAGGAGGG + Intronic
935970932 2:108530244-108530266 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
936509431 2:113133195-113133217 ATGGGAAGGTGGAATGAGGGAGG - Exonic
936956991 2:118032435-118032457 ATGGGTGGATGGATGGATGAAGG + Intergenic
937041439 2:118823803-118823825 GGGGGCAGCTGGAAGGATGCCGG + Intergenic
938143302 2:128813318-128813340 ATGGGCAGGAGGTAGGTTGGGGG - Intergenic
938668737 2:133566547-133566569 ATGTGCAGGTGTACAGATGAAGG - Intronic
938710921 2:133975668-133975690 CTGACCAGGTGGAAGGCTGATGG - Intergenic
938776524 2:134545901-134545923 AAGGAGAGGTGGAAGGATAATGG - Intronic
939679659 2:145114843-145114865 TTGGGCAGGTGGAAGGCTAAAGG + Intergenic
939871309 2:147529058-147529080 CTGGGCTGGTGGAAGGAGTAGGG - Intergenic
940008129 2:149028372-149028394 CTGGGCATGGGGAAGGGTGAAGG - Intergenic
940939140 2:159537571-159537593 ATGGGCAGGAGGGAAGAAGAAGG - Intronic
942546393 2:177068810-177068832 ATGGGCAGATGGATGAATCACGG + Intergenic
942980077 2:182070244-182070266 ATGAGCAGGAGGAATGATCATGG - Intronic
943681291 2:190770658-190770680 ATTGGCAGGTGGGAGAATCAGGG - Intergenic
944358702 2:198825251-198825273 ATAGGCAGGTGGGAGGGGGATGG - Intergenic
944537619 2:200726512-200726534 ATGGATGGGTGGATGGATGATGG - Intergenic
944898391 2:204189065-204189087 CTGGGCAGGTGGCAGGAGAAAGG + Intergenic
946172463 2:217903717-217903739 ATCTGCAGCAGGAAGGATGAGGG - Intronic
946335274 2:219031540-219031562 ATGGGCAGCTGCAGGGATGGTGG + Exonic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947143307 2:227040239-227040261 AAAGGCAGGTGGAAGGAGAAAGG + Intronic
947760947 2:232603418-232603440 AGGAGGAGGTGGAAGGAGGAAGG + Intergenic
948220502 2:236265754-236265776 TTGGGCAGGTGGAAGGAGAATGG - Intergenic
948230947 2:236349002-236349024 ACGGGCAGGAGGCAGGATGGAGG - Intronic
948375509 2:237517999-237518021 ATGGGTGGGTGCATGGATGAAGG + Intronic
948421795 2:237864487-237864509 CGGGGGAGGTGGATGGATGAGGG + Intronic
948814297 2:240502101-240502123 ATGGACAGGTGGGTGGATGATGG + Intronic
949065863 2:241990054-241990076 ATGGGTGGATGGATGGATGATGG - Intergenic
1169004039 20:2192216-2192238 GTGGAGAGGAGGAAGGATGACGG - Intergenic
1169178619 20:3542548-3542570 AAGGGGAGGTGGAAGGGGGAAGG - Intronic
1169864525 20:10185673-10185695 GTGGTAAGGTGGAAGGAGGAAGG + Intergenic
1170029651 20:11931608-11931630 AGAAGCAGATGGAAGGATGAGGG - Intergenic
1170847479 20:19974684-19974706 ATGGGGAGGTGGAAGGTTCGGGG - Exonic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171988876 20:31680285-31680307 TTGGGTAGGTGAAAGGGTGAAGG - Intronic
1172110879 20:32544270-32544292 AGGAGCTGCTGGAAGGATGATGG + Intronic
1172194180 20:33080869-33080891 ATGGGAAGATGGATGGATGGTGG + Intronic
1172780795 20:37436085-37436107 ATGGGGACATGGATGGATGATGG - Intergenic
1172780837 20:37436222-37436244 ATGGGAACATGGATGGATGATGG - Intergenic
1172780850 20:37436274-37436296 ATGGGTGGGTGGATGCATGACGG - Intergenic
1173059518 20:39648121-39648143 ATGGGAAGCTGGAAGGTGGAGGG + Intergenic
1173285760 20:41670274-41670296 ATAGGTAGGGGGAAGGATGCTGG + Intergenic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173767789 20:45629912-45629934 ATGGGCTGCTGGATGGGTGAGGG + Intronic
1173773786 20:45685872-45685894 ATGGGCTGCTGGATGGGTGATGG - Intronic
1174125635 20:48303088-48303110 ATGTGCATATGGAAGGATGATGG - Intergenic
1174410202 20:50330340-50330362 ATGGGTGGGTGGATGGATGGAGG + Intergenic
1174413169 20:50349210-50349232 CTGGGCAGGTGGGAGGCTGAGGG + Intergenic
1174421862 20:50404572-50404594 CTGGGCTGGTGGCAGGATGGGGG - Intergenic
1174581022 20:51571787-51571809 GTGGGCAAGTGCAAGGATGGAGG + Intergenic
1175257993 20:57658387-57658409 AGGAGCAGGTGCACGGATGAAGG - Intronic
1175293672 20:57894659-57894681 AAGGGAAGGAGGAAGGAAGAAGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175762831 20:61572889-61572911 ATGGACAGACGGATGGATGATGG + Intronic
1175817291 20:61889913-61889935 ATGGGTAGATGGATCGATGATGG + Intronic
1176047135 20:63098574-63098596 ATGGACAGATGGATGGATGATGG + Intergenic
1176097065 20:63349146-63349168 ATGGGCTGGTGGCAGGAGGACGG - Intronic
1177493392 21:21857249-21857271 ATTGGCAGGTGGAAGGTGGGAGG + Intergenic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178434745 21:32548083-32548105 ATGGAGATTTGGAAGGATGAGGG - Intergenic
1178448073 21:32663547-32663569 ATGGGCAGTAGGAAGAAAGATGG - Intronic
1178484605 21:33010705-33010727 CTGAGCAGCTGGACGGATGAGGG - Intergenic
1179146294 21:38770898-38770920 ATGGGCAGGTGGAGGTGTGCAGG - Intergenic
1179549176 21:42132561-42132583 ATGAACAGATGGATGGATGATGG - Intronic
1179564728 21:42240106-42240128 GAGGGCAGGTGGCAGGATGAGGG + Intronic
1179580315 21:42339125-42339147 GTGAGCAGGTGGAATGCTGAGGG + Intergenic
1179581187 21:42345222-42345244 ATGGACATGTGGATGGCTGACGG + Intergenic
1179669400 21:42935566-42935588 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1179791827 21:43760133-43760155 ATCTGCAGGTGGAAGGAGGTGGG + Exonic
1180024907 21:45155583-45155605 ATGGGTGAGTGGATGGATGATGG - Intronic
1180024982 21:45155912-45155934 ATGGGTGGGTGGGTGGATGATGG - Intronic
1180086080 21:45508483-45508505 ATGGGTGGGTGGATGGATGGTGG + Intronic
1181002465 22:19994314-19994336 ATGGGTGGGTGGAGGGATGGTGG + Intronic
1181175694 22:21033543-21033565 TTGGGCTGGTGACAGGATGATGG + Intergenic
1181275175 22:21683510-21683532 GTGGGCAGGTGGTGGGGTGATGG + Intronic
1181459512 22:23077958-23077980 CTGGGCAGGAGGAGGCATGAGGG - Intronic
1181536720 22:23550122-23550144 ATGGACAGGGGGACGGTTGAAGG - Intergenic
1181537227 22:23552741-23552763 ATGGGTGGGAGGAAAGATGAAGG - Intergenic
1181783195 22:25207608-25207630 GTGGGTGGGTGGAAGGATGATGG - Intergenic
1182065291 22:27427006-27427028 ATGGGCAGGGGTAGGGAAGAGGG - Intergenic
1182086638 22:27565500-27565522 ATGGATAGATGGATGGATGATGG + Intergenic
1182116275 22:27758254-27758276 GTGTGGAGGTGGAAGGATCAGGG - Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182351675 22:29703278-29703300 GTGAGGAGGGGGAAGGATGAAGG - Intergenic
1182443897 22:30379459-30379481 GTGGGTGGGAGGAAGGATGAGGG - Exonic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1183105262 22:35610848-35610870 CTGGGCAGGTGGGAGGATGCGGG - Intronic
1183226152 22:36551283-36551305 ATGGGGGGATGGATGGATGACGG - Intergenic
1183243860 22:36678594-36678616 ATGTGCTGGGGGAAGGATGGAGG - Intronic
1183304119 22:37072961-37072983 ACGGATGGGTGGAAGGATGATGG + Intronic
1183304136 22:37073044-37073066 ATGGGTGGATGGATGGATGATGG + Intronic
1183724882 22:39582977-39582999 ATGGGTGGGTGGATGGATGGAGG - Intronic
1183868225 22:40721140-40721162 GTGGGGTGGGGGAAGGATGAGGG - Intergenic
1184259592 22:43307027-43307049 ATGGGCGGGTGGCAGGGTAACGG - Intronic
1184292995 22:43508327-43508349 ATGGATAGATGGAAGGATGGGGG - Intergenic
1184434281 22:44460604-44460626 GTGGGTAGATGGATGGATGAGGG - Intergenic
1184444510 22:44539521-44539543 ATGGGTAGGTGGATGGTGGATGG + Intergenic
1184444604 22:44539903-44539925 ATGGGTAGGTGGACGGTGGATGG + Intergenic
1184731323 22:46372541-46372563 GTGTGCAGGTGGATGGATGGAGG - Intronic
1184851436 22:47123527-47123549 ATGGGCAGGTTGAGGCCTGACGG - Intronic
1184855161 22:47142598-47142620 ATGTGCAGATGGATGGATGATGG - Intronic
1185053503 22:48565984-48566006 ATGGACAGATGGATGTATGATGG + Intronic
1185053601 22:48566514-48566536 ATGGGTGAGTGGAAAGATGAAGG + Intronic
1185104459 22:48859331-48859353 AGGGACAGGTGGATGGATGGAGG - Intergenic
1185193321 22:49452515-49452537 ATGCGCAGGTGGATGGATGGTGG + Intronic
1185280776 22:49968995-49969017 GAGGGCAGGTGGCAGGATTAGGG - Intergenic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949725646 3:7041287-7041309 ATGGGAAGGTGGAAGGAGTCAGG - Intronic
949754998 3:7399103-7399125 AGTGGAAGGTGGAAGCATGAAGG - Intronic
949777335 3:7647557-7647579 ATGGGGAGTTGGAAGTATGAGGG + Intronic
950027066 3:9827370-9827392 AAGGACAGCTGGCAGGATGAGGG - Intronic
950044885 3:9943246-9943268 ATGGGCAGGTGGGGGAAGGAAGG + Intronic
950437866 3:12991549-12991571 AGGGGCAGGGGGAGTGATGAGGG + Intronic
950474330 3:13206026-13206048 ATGGGCAGATGGGGGGATGGGGG - Intergenic
950573508 3:13816770-13816792 ATGGGTAGATGGATGGATGAAGG - Exonic
950726247 3:14918836-14918858 ACGGGCAGGTGGAGGGAGGATGG + Intronic
950741588 3:15056550-15056572 AGAGGGAGGTGGAAGGATGGAGG + Intronic
950750785 3:15126470-15126492 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
951165698 3:19483118-19483140 ATGGGCAGTAGGAAGAAAGATGG + Intronic
951248195 3:20365165-20365187 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
951526406 3:23657070-23657092 GTGGGCTGGTGGAAAGAGGAGGG + Intergenic
952284436 3:31954585-31954607 GGGGGCAGGGGGAAGGATGGTGG + Intronic
952946558 3:38481536-38481558 CTGGGGAGGTGCAGGGATGAGGG + Intronic
953003185 3:38953253-38953275 ATGGGAAGGTGGAGGGTGGAAGG + Intergenic
953406737 3:42663495-42663517 CTGATCAGGAGGAAGGATGAGGG + Intronic
954240074 3:49286770-49286792 ATGGATAGATGGATGGATGATGG - Intronic
954294245 3:49665342-49665364 ATGGGCCGGAGGAGGGGTGAAGG + Intronic
954745781 3:52786878-52786900 ATGGATAGGTGAAAGGATGAGGG + Intronic
955410451 3:58652351-58652373 ATGGACAGGTGGAAGGATGCTGG - Intronic
955628247 3:60944077-60944099 ATTGTTAGGTGGTAGGATGAAGG - Intronic
955658933 3:61276098-61276120 ATGGGCAGGTGGAAACAGGGAGG + Intergenic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
957070663 3:75565342-75565364 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
957406574 3:79779778-79779800 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
957550530 3:81697793-81697815 TGGAGCAGGTGGAAGGAAGAAGG + Intronic
957999559 3:87734767-87734789 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
959136955 3:102435133-102435155 ATGTGCAGGGGAAATGATGAAGG + Exonic
959574427 3:107919223-107919245 ATGGGATGGTGGAAGGACCATGG - Intergenic
959575143 3:107925876-107925898 ATGGATAGGAGGTAGGATGAGGG - Intergenic
960246822 3:115408775-115408797 ATGGGCTGCTGCAATGATGAAGG - Intergenic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
961283433 3:125781225-125781247 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
962371436 3:134823948-134823970 CTGGGCAGGGGGAGGGCTGATGG - Intronic
962849292 3:139295853-139295875 ATGGAAAGGTGGAAGGGAGAAGG - Intronic
962914830 3:139891539-139891561 CTGGGCAGGTAGAAGGAAGGAGG + Intergenic
963234713 3:142945532-142945554 ATGGGGAGGTGGAAGGGGGATGG + Intergenic
963704353 3:148666985-148667007 ATGGATAGTTGGATGGATGAAGG + Intergenic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
964136577 3:153351532-153351554 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
964808046 3:160633074-160633096 AGGTGCTGCTGGAAGGATGAAGG - Intergenic
964924374 3:161937894-161937916 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
964932651 3:162045718-162045740 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
966937743 3:184724821-184724843 ATGGGGAGGAGGGAGCATGATGG - Intergenic
967218670 3:187231027-187231049 GTGGGCATGTGGAATGATGCTGG - Intronic
967421482 3:189278118-189278140 AAGGGCATGTGGAAGGAGCATGG - Intronic
967884502 3:194323914-194323936 ATGGGCAGGCAGAAGGCTGCAGG + Intergenic
967969548 3:194988814-194988836 TGGGGCTGCTGGAAGGATGAAGG + Intergenic
968594669 4:1476243-1476265 ATGGGTAGATGGATGGATGGTGG + Intergenic
968598667 4:1498627-1498649 ATAGGTAGGGGGATGGATGATGG + Intergenic
968650533 4:1758561-1758583 CTGGGCAGGTGGATGGAGGTGGG + Intergenic
968914349 4:3490737-3490759 ATGAGCAGGAGGAAGAAGGAAGG - Intronic
968914441 4:3491152-3491174 ATGAGCAGGAGGAAGAAGGAAGG - Intronic
968930979 4:3578634-3578656 ATGGGCAAAGGGAAGGATGTGGG - Intronic
968936037 4:3611041-3611063 ATGGATGGGTGGATGGATGATGG - Intergenic
969014279 4:4093008-4093030 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
969027277 4:4183589-4183611 ATGGGCAGGTAGGAAGATGCTGG + Intergenic
969256760 4:6007700-6007722 ATAGGTAGATGGATGGATGATGG + Intergenic
969501608 4:7556808-7556830 ATGGGTAGATGGATGGATGATGG - Intronic
969523098 4:7690211-7690233 ATGAGTGGGTGGATGGATGATGG + Intronic
969523145 4:7690466-7690488 ATGAGTGGGTGGATGGATGATGG + Intronic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
969739691 4:9015404-9015426 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970139236 4:12962445-12962467 ATGGAGAGATGGCAGGATGAAGG - Intergenic
970479572 4:16459377-16459399 ATGGACAGGTGGATGGTAGACGG - Intergenic
971502062 4:27328366-27328388 ATGGGAAGCTGGAAGGGGGATGG + Intergenic
971734245 4:30425641-30425663 AAGGACAGGAGGAAGGAAGAAGG + Intergenic
972077807 4:35108006-35108028 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
972217389 4:36912137-36912159 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
972840058 4:42920201-42920223 ATTGGCAAGGTGAAGGATGAAGG + Intronic
973012934 4:45099579-45099601 ATGTACAGGTGCAAGGATCAGGG + Intergenic
973029383 4:45316585-45316607 GTGGAAAGGTGGAAGGGTGAAGG + Intergenic
973158879 4:46992417-46992439 ATGGACACGTGGGAGGATGAGGG + Intronic
973253269 4:48083220-48083242 ATGGGCAGGTGCAGGAATCAGGG - Intronic
974166839 4:58214892-58214914 ATGGGGAGTGGGAAGGACGATGG + Intergenic
974321170 4:60352514-60352536 ATGGGGTGGGGGAAGGAAGAAGG - Intergenic
974621462 4:64361260-64361282 AGTGGCAGGTGGAAGGCTGCAGG - Intronic
974978122 4:68917479-68917501 ATGGGGAGCTGGAATGGTGATGG + Intergenic
975206017 4:71644774-71644796 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
975329502 4:73098786-73098808 AGGAGCAGGTGGAAGATTGATGG - Intronic
975329605 4:73099270-73099292 GGGTGCAGGTGGAAGGATGGGGG - Intronic
975759345 4:77603682-77603704 ATGGACAGATGGATGGATGGGGG + Intronic
975836647 4:78429351-78429373 ATGGGCAGGAGGAAGGATACAGG - Intronic
976399269 4:84589012-84589034 ATGGGCAGCTTGAAGGTTAAAGG + Intronic
976837969 4:89397672-89397694 GTTGGCAGGTGCAAGGAGGAAGG + Intergenic
977043203 4:92039632-92039654 ATGGGCAGTAGGAAGAAAGACGG + Intergenic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
977355378 4:95939841-95939863 ATAGGCAGGTGAAGGGGTGAGGG - Intergenic
977441200 4:97070342-97070364 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
977972739 4:103230248-103230270 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
978927037 4:114259333-114259355 ATGGGTAAGTGCAATGATGAGGG + Intergenic
979052783 4:115955281-115955303 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
979480758 4:121214228-121214250 AAGTGCAGAAGGAAGGATGAGGG - Intronic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
980533693 4:134087790-134087812 AAGGCCAGGAGGAAGGAAGAAGG - Intergenic
980780508 4:137485828-137485850 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
980824964 4:138062146-138062168 ATGGGGAAGTTTAAGGATGAGGG - Intergenic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982687814 4:158513038-158513060 AAGGGCAGGTGGGAGGAGGATGG - Intronic
983134135 4:164058627-164058649 ATGGGGAGGTGGCAGGATGCAGG - Intronic
983257415 4:165416290-165416312 AGGGGCAGGTGAATGAATGAAGG - Intronic
983898319 4:173105037-173105059 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
984559697 4:181253900-181253922 CTGGGCAGGTGGGAGGGTGAAGG - Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985646276 5:1086104-1086126 CGGGGCAGGTGGAAAGATGGAGG + Intronic
985709152 5:1418599-1418621 ATGGGTGGATGGATGGATGATGG - Intronic
985709199 5:1418825-1418847 ACGGGTGGGTGGATGGATGATGG - Intronic
985709239 5:1419023-1419045 ATGGATGGGTGGATGGATGATGG - Intronic
985820990 5:2160415-2160437 ATGGGTGGGTGGGTGGATGATGG - Intergenic
985833803 5:2256418-2256440 ATGGGGAGGGGGCAGGATGGAGG + Intergenic
985913465 5:2900583-2900605 AGGGGAAGGTGGAAGGGAGAAGG - Intergenic
985976087 5:3420137-3420159 ATGGCCAGGTGGTGGGATCATGG + Intergenic
986062980 5:4209265-4209287 AGGGTCGGGGGGAAGGATGATGG + Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986299334 5:6466042-6466064 AGGGGCAGAGGGAAGGAAGAGGG - Intronic
986393163 5:7303690-7303712 AGTGCCAGGTTGAAGGATGACGG + Intergenic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987334641 5:16888133-16888155 ATGGACTTGTGGAAGTATGAGGG - Intronic
988422619 5:31024635-31024657 GTGGGCAGGAGGTAGGAGGAGGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988732796 5:33990141-33990163 ATGGATGGGTGGATGGATGATGG - Intronic
988981378 5:36572740-36572762 ATGGGCAGGTGGAATAGGGATGG - Intergenic
989095684 5:37779254-37779276 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
989115707 5:37950489-37950511 ATGGGAAGGTGGAAGAAGGGTGG + Intergenic
989750429 5:44886315-44886337 ATTGTCAGGTGGTAGGGTGAGGG + Intergenic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990468958 5:56095727-56095749 ATTGGAAGGTGGGAGGAGGACGG - Intergenic
990597931 5:57329925-57329947 ATGGGAAGGAGGCAGGAGGATGG - Intergenic
991675817 5:69089035-69089057 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992989365 5:82268490-82268512 ATGGGCAGTAGGAAGAAAGATGG + Intronic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
994014629 5:94951117-94951139 CTGGACAGTTGGAAGGATGAGGG - Intronic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
996340647 5:122435208-122435230 ATGTGAAGGTGGAAGCATCAGGG + Intronic
996398166 5:123033820-123033842 GTGTGCAGCTGGAAGGATGGTGG + Intronic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
998174488 5:139893558-139893580 AGGGGCAGGTGGCAAGCTGATGG + Intronic
1000237164 5:159372657-159372679 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1000594885 5:163203329-163203351 GTGGGCAGGTTGAACTATGATGG + Intergenic
1000865978 5:166515235-166515257 ATGGGGAGGTGGGAGGTAGAAGG - Intergenic
1000867956 5:166538429-166538451 ATGGGGAGTTGGAAGGGGGATGG - Intergenic
1001435443 5:171695868-171695890 ATGGGTGGGTGGATGGATGGTGG + Intergenic
1001435468 5:171695978-171696000 GTGGGCAGATGGATGGATGGTGG + Intergenic
1001751465 5:174134706-174134728 ATGGGTGGATGGATGGATGATGG - Intronic
1002298622 5:178245448-178245470 ATGGGTGGGTGGATGGATAATGG - Intronic
1002407797 5:179049746-179049768 ATGGGCAGTAGGAAGAAAGACGG + Intergenic
1002452164 5:179325344-179325366 ATGGGCAGCTGGAAGGGAGTGGG + Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1003035648 6:2638524-2638546 TTGGGCAGGTGGGAGGATCCTGG + Intergenic
1003147254 6:3518740-3518762 ATGGGGAGGTGCAAAGCTGATGG + Intergenic
1003420153 6:5950365-5950387 ATGGGAAGGTGGTTGGATGGTGG + Intergenic
1003788695 6:9517213-9517235 ATTGGCAGGTGGAAAGAAGAAGG - Intergenic
1004017928 6:11749221-11749243 TTGGGCAATTGGGAGGATGATGG + Intronic
1004054809 6:12124686-12124708 ATGGGCAGCATGAATGATGATGG - Exonic
1004458404 6:15813113-15813135 ATGGGCAGGTGGACGGAACATGG + Intergenic
1004551986 6:16656675-16656697 ATGGGCAAGGTGAAAGATGATGG - Intronic
1005462287 6:26080527-26080549 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1005976824 6:30806566-30806588 ATGGTCATGTGGAAGCATTATGG + Intergenic
1006473430 6:34240745-34240767 AGGAGCAGGTGGAAGAGTGATGG - Exonic
1006557872 6:34884418-34884440 AAGGGTATATGGAAGGATGAAGG + Intronic
1006570871 6:35003063-35003085 ATGGGCAGTAGGAAGAAAGATGG - Intronic
1007035161 6:38666537-38666559 GTCTGCAGGTGAAAGGATGAGGG + Intergenic
1007038278 6:38698337-38698359 ATGGAAAGGAGGAAGGAAGAAGG - Intronic
1007279578 6:40700700-40700722 CTGGGCAGGTGCAAGGAGCAGGG + Intergenic
1007482928 6:42162044-42162066 CTGGGTAGGTGGAGGGATGGAGG + Intronic
1008307298 6:49918850-49918872 ATGAGCTGGTGGAAGTGTGATGG - Intergenic
1008921740 6:56850117-56850139 AAGGGGAGGTGGAGGGAGGATGG - Intronic
1010316050 6:74451988-74452010 ATGGGGAGCTGGAAGGAAAATGG - Intergenic
1010327178 6:74577858-74577880 ATGGCCTGGAGGAAGGATGGGGG + Intergenic
1011155347 6:84324132-84324154 AAGGGGAGGTGGCAGGATGTGGG - Intergenic
1011234020 6:85195419-85195441 AGGGGCAGGAGGAAGTATAAAGG + Intergenic
1012046205 6:94276802-94276824 ATTTGCAGGTGGAACCATGAAGG + Intergenic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1013180473 6:107713162-107713184 ATGGGCATGTGTAAGGCAGAGGG - Intronic
1013944968 6:115711768-115711790 ATGTTCAGGTGTCAGGATGATGG + Intergenic
1014095580 6:117456971-117456993 ATGGGCAGGAGGTAGCAAGAGGG - Intronic
1014546536 6:122742707-122742729 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
1014671727 6:124312936-124312958 TTGGGCAGGTGCAAGGAGGATGG + Intronic
1015662563 6:135591622-135591644 ATGGGAGGGTGGGTGGATGATGG - Intergenic
1016155914 6:140808564-140808586 ATGGGAAGCTGGAAGGGGGATGG + Intergenic
1016345205 6:143105828-143105850 ATGGGCAGATGGCAGAATCAGGG + Intronic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1017195002 6:151690596-151690618 ATGGGCAGGAGAAAGGAGCATGG - Exonic
1017616578 6:156252583-156252605 ATGGAGATTTGGAAGGATGAGGG - Intergenic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1019738620 7:2662231-2662253 ATGGGCACGTGGAGGGACCACGG - Exonic
1019757379 7:2782802-2782824 AAGGTCAGGAGGAAGGAGGATGG - Intronic
1019792961 7:3029298-3029320 CTGGGCAGGTGGCAGCCTGAAGG - Intronic
1019871150 7:3763473-3763495 ATGGACTGGTGGAAGAATGGAGG - Intronic
1019914734 7:4125396-4125418 ATGGATAGATGGATGGATGATGG + Intronic
1019941846 7:4298155-4298177 AAGGGCAGGAGGAAAGAAGAGGG - Intergenic
1020043481 7:5022072-5022094 ATGGGCAGTAGGAAGAAAGATGG + Intronic
1020785466 7:12568029-12568051 AAGGGAAGGTGGAAGGGTGCAGG + Intergenic
1020914327 7:14172924-14172946 ATGCTCAGGAGGAAGGATGGGGG + Intronic
1021334313 7:19379885-19379907 ATAGGGAGATGGAAGGAGGAAGG - Intergenic
1021777970 7:24072476-24072498 ATGGGCTGGGGGAAGGAGGCTGG + Intergenic
1021849087 7:24790464-24790486 ATGGGCAGTAGGAAGAAGGATGG + Intergenic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022977808 7:35575009-35575031 ATCTGCAGGTGGAGGGAGGACGG - Intergenic
1023842757 7:44106262-44106284 TTTGGCAGGTGGGGGGATGAGGG + Intronic
1024051181 7:45624342-45624364 AGGGGCAGGGGGAAGGAGGGTGG + Intronic
1024331586 7:48160542-48160564 AAGTGCAGGGGGAAGGATGGAGG + Intergenic
1024778468 7:52816730-52816752 TAGGGCAGCTGGTAGGATGACGG - Intergenic
1025257324 7:57393361-57393383 CTAGGCAGGTGGGAGGCTGAGGG - Intergenic
1026114972 7:67488449-67488471 CTGGGCAGCTGGAATGATCATGG + Intergenic
1026275203 7:68870310-68870332 ATGGAAAGATGGATGGATGATGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026530069 7:71189530-71189552 AGGGGCAGTTGGAGGGAGGAAGG + Intronic
1026562083 7:71458678-71458700 ATGGGAACGTGGAAAGGTGATGG + Intronic
1026828600 7:73598342-73598364 ATGGGTTGGTGGATGAATGATGG - Intronic
1026855276 7:73749418-73749440 ATGGGGAGGGGGAAAGATGGTGG + Intergenic
1026901076 7:74037849-74037871 ACGGGCAGGAGGAAGGAGGGAGG + Intronic
1026994037 7:74604418-74604440 AGGGGCAGGTGGGAAGTTGAAGG + Intergenic
1027525057 7:79258425-79258447 ATGGCCTGGTTGAAGGAAGAAGG - Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027743297 7:82040262-82040284 ATGGGCATCTGGAAGGATAGAGG + Intronic
1027859862 7:83563813-83563835 ATGGGCAGGAGGAAGATTAATGG - Intronic
1028519323 7:91712312-91712334 ATGGGAAGGAGGAAGAAGGAAGG + Intronic
1028720973 7:94031162-94031184 GTGTGCAACTGGAAGGATGAAGG - Intergenic
1028789127 7:94833879-94833901 GTGGACAGGTGGAAGGATGCTGG - Intergenic
1029039472 7:97557694-97557716 ATCCTAAGGTGGAAGGATGATGG - Intergenic
1029072946 7:97914646-97914668 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1029486499 7:100845665-100845687 ATGGGCAGTAGGAAGAAAGATGG - Intronic
1029697165 7:102221076-102221098 AAGGGCGGGTGGAAGGAGGGAGG - Intronic
1030407777 7:109136386-109136408 ATCAGCAGATGAAAGGATGAAGG - Intergenic
1031719168 7:125148478-125148500 TTGGGCAGGGAGGAGGATGATGG + Intergenic
1031777027 7:125918015-125918037 AAGAGCAGGAGGAAGGATAAGGG - Intergenic
1032667279 7:134049296-134049318 ATGGGTGAGTGGAAGGATGAAGG - Intronic
1033238553 7:139657895-139657917 AAGGGCATCTGGAAGGATGGTGG - Intronic
1033285941 7:140040501-140040523 ATTGGCTGATGGAAGGAGGAGGG - Intronic
1033590568 7:142804979-142805001 ATTAGCAGGTGGGAGGATGTGGG + Intergenic
1034466106 7:151230150-151230172 GTGGGCAGGGGGAGGGATGGTGG - Intergenic
1034864287 7:154627680-154627702 ATGCGGAAGTTGAAGGATGATGG - Intronic
1034865389 7:154637247-154637269 AAGGGCAGTTGGAAGTATCACGG - Intronic
1034883646 7:154781049-154781071 ATGGGTGGATGGATGGATGATGG + Intronic
1034978909 7:155463431-155463453 AGGAGCAGGAGGAAGGAGGAAGG - Exonic
1035058507 7:156052239-156052261 ATGGGCAAATGGAGGGATGGAGG - Intergenic
1035120929 7:156566234-156566256 ATGGCCAGGTGAAAGGTGGAAGG - Intergenic
1035278924 7:157765326-157765348 ATGGATGGGTGGATGGATGATGG - Intronic
1035278929 7:157765345-157765367 ATGGATGGGTGAAAGGATGATGG - Intronic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035318752 7:158014611-158014633 ATAGGTGGGTGGATGGATGAGGG - Intronic
1035407295 7:158607444-158607466 ATCTGCAGGTGGAAGGGTGGAGG - Intergenic
1036244734 8:7106623-7106645 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
1036255999 8:7207093-7207115 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1036361488 8:8080406-8080428 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1036889490 8:12586617-12586639 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1036897090 8:12644809-12644831 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1037887789 8:22604193-22604215 ATGGGGAGGTCGGAGGATAAGGG + Intergenic
1037915385 8:22769852-22769874 AATGGCGGGAGGAAGGATGACGG - Intronic
1038090023 8:24242114-24242136 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1038177624 8:25195430-25195452 ATGGGAAGGTGGAAGCAGGGAGG - Intronic
1038316836 8:26491477-26491499 GTGGGCTGGTGGAAGAATCAAGG - Intronic
1038852864 8:31297114-31297136 ATCTGAGGGTGGAAGGATGAAGG + Intergenic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039285929 8:36040895-36040917 AAGGCCAGATGGAAGCATGAGGG - Intergenic
1039447182 8:37642202-37642224 AGGGGCAGGTGAAAGCAGGAGGG + Intergenic
1039477194 8:37845388-37845410 AGGGGAAGGTGGAGGGATGGAGG + Intronic
1039758671 8:40550270-40550292 ATGGTCAGGTGGAAGCATCCTGG - Intronic
1039876645 8:41592170-41592192 ATGGGCAGTAGGAAGAAAGATGG + Intronic
1040289237 8:46115939-46115961 ATGGGCAGGCGGCAGGGTCAGGG - Intergenic
1040546445 8:48401633-48401655 AGGGGTAGGAGGAAGGAGGAGGG + Intergenic
1040617082 8:49047640-49047662 AGTGGCAGGTGTACGGATGAGGG + Intergenic
1041095078 8:54342027-54342049 ATTGGCATGTGGAAGGAAGAAGG + Intergenic
1041374022 8:57193747-57193769 TTGGGCAGGGGGAAGGGCGAGGG + Intergenic
1041515816 8:58697653-58697675 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1042035307 8:64526457-64526479 ATGGGGAGTTGGAAGCATTATGG + Intergenic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042601441 8:70503192-70503214 ATGGGAAGCTGGAAGAGTGATGG + Intergenic
1042740766 8:72042896-72042918 AAGGGCTGGGGGAAAGATGATGG + Intronic
1042756393 8:72217836-72217858 AAGGGCTGGGGGAAGGTTGAGGG + Intergenic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1043909484 8:85844613-85844635 ATGAGTGGGTGGATGGATGATGG + Intergenic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044211714 8:89558442-89558464 ATATCCAGGTGGATGGATGATGG + Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1047061431 8:121231221-121231243 ATGTGAAGGTAGAGGGATGAAGG + Intergenic
1047333163 8:123910886-123910908 ATGGTCAGGTGGAATAATCATGG + Intronic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1048295357 8:133209846-133209868 GGGGGCAGTTGGAAGGGTGAAGG - Intronic
1048479785 8:134778488-134778510 ACGAGCAGATGGATGGATGAAGG - Intergenic
1048648699 8:136450945-136450967 ATGGGGAGTTGGAAGGGGGATGG + Intergenic
1048927603 8:139284624-139284646 GTGGGCAGGGGGAAGGTTGACGG - Intergenic
1049033829 8:140059096-140059118 AGGGGCAGGAGGAAGGTTTAGGG - Intronic
1049096543 8:140551636-140551658 ATGGGTGGGTGGATGGTTGATGG + Intronic
1049096549 8:140551655-140551677 ATGGGTGGGTGGATGGTTGATGG + Intronic
1049096555 8:140551674-140551696 ATGGGTGGGTGGATGGTTGATGG + Intronic
1049096581 8:140551779-140551801 ATGGGTGGGTGGATGGTTGATGG + Intronic
1049155292 8:141062534-141062556 ATGGGGAAGTGGAGGGATCATGG + Intergenic
1049155352 8:141062863-141062885 AGGAGTAGGTGGATGGATGATGG + Intergenic
1049223506 8:141438677-141438699 ATGGGTGGGTGGATGGATGGAGG + Intergenic
1049223581 8:141438997-141439019 GTGGGTGGGTGGATGGATGAAGG + Intergenic
1049321270 8:141997823-141997845 AAGGGCAGGTGGGTGGATGGTGG - Intergenic
1049350720 8:142163125-142163147 ATGGATGGATGGAAGGATGAAGG + Intergenic
1049350795 8:142163521-142163543 ATGGATGGATGGAAGGATGAAGG + Intergenic
1049359908 8:142207479-142207501 ATGGATAGGTGGATGGATGGGGG + Intergenic
1049359949 8:142207637-142207659 ATGGGTGGGTGGATGGATGGGGG + Intergenic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049374966 8:142285074-142285096 ATGGGTAGATGAAAGGATGATGG + Intronic
1049464955 8:142746850-142746872 ATGGGTGGGTGGATGGATGGGGG + Intergenic
1050440661 9:5659989-5660011 AGGGGCAGGGCGCAGGATGAGGG - Intronic
1050448080 9:5748384-5748406 ATGGTCATGTGAAAGGTTGAAGG + Intronic
1050606292 9:7304692-7304714 ATGGACGGGTGGATGGGTGAGGG + Intergenic
1050681228 9:8114131-8114153 TTGTTCAGGGGGAAGGATGAAGG + Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051716181 9:19987136-19987158 ATTGGAATGTGGAAGGAAGATGG + Intergenic
1051890057 9:21932206-21932228 ATGGGCAGCTTGAAGGCTAAAGG - Intronic
1052207663 9:25862884-25862906 ATAGGCAGGTAGAAGGACTAGGG + Intergenic
1052220077 9:26010187-26010209 CTGGATAGGTGGATGGATGACGG - Intergenic
1052993310 9:34535418-34535440 AGAGGGAGGTTGAAGGATGAAGG - Intergenic
1055449277 9:76416268-76416290 ATGGGCAGCTGGAAAGGGGATGG - Intergenic
1056778652 9:89532971-89532993 CAAGGCAGGTGGAAGGAGGATGG + Intergenic
1057021143 9:91698635-91698657 AGGAGCAGGTGGAAGGAGGGTGG - Intronic
1057217766 9:93238862-93238884 TTGGTCAGGTGGAAGGCTGGGGG + Intronic
1057518143 9:95738658-95738680 AAGGGCAGGAGGAAGGGTGGTGG - Intergenic
1057636533 9:96774630-96774652 ATTGGCATGTGGAAAGATGGAGG - Intronic
1058093856 9:100836984-100837006 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
1058702984 9:107616129-107616151 ATGGGCAGATGGAAAGATGAAGG - Intergenic
1059252158 9:112895531-112895553 GTGGGTAGATGGATGGATGATGG - Intergenic
1059252230 9:112895801-112895823 ATGGGTAGATGGATGGATGATGG - Intergenic
1059339613 9:113590338-113590360 GTGGGTGGGTGGATGGATGAAGG - Intronic
1059416513 9:114165934-114165956 ATGGATAGATGGATGGATGATGG - Intronic
1059448020 9:114351083-114351105 TTGTGCAGGTGGAATGATGGGGG + Intronic
1060281307 9:122217338-122217360 ATTGGGTGGTGGAAGGAGGAAGG - Intronic
1060411030 9:123400403-123400425 ATGGACAGATGGAATGATGGAGG + Intronic
1060650982 9:125326806-125326828 TTGGGCAGCTGGGAGGAGGATGG - Intronic
1061063912 9:128265748-128265770 AGTGCCAGGTTGAAGGATGATGG + Intronic
1061203860 9:129152061-129152083 ATGGGCAGCTGGCTGGATGCTGG + Intergenic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061255583 9:129453153-129453175 ATGGAAGGATGGAAGGATGAAGG + Intergenic
1061255806 9:129453770-129453792 ATGGGAAGATGGAGGGATGGGGG + Intergenic
1061417464 9:130454864-130454886 ATGGATGGGTGGATGGATGATGG - Intronic
1061417575 9:130455474-130455496 ATGGACAGAAGGATGGATGATGG - Intronic
1061846718 9:133392448-133392470 GTGGGTAAGTGGATGGATGATGG + Intronic
1061936361 9:133859699-133859721 ATGGGCTGGTGGAAAGGAGAAGG + Intronic
1061962919 9:133997676-133997698 AGGGGCAGGTGGAGGGATGATGG - Intergenic
1061963178 9:133998493-133998515 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963204 9:133998581-133998603 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963230 9:133998669-133998691 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963256 9:133998757-133998779 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1061963282 9:133998845-133998867 ATGGATTGGTGGAAGGATGGAGG - Intergenic
1062246725 9:135572386-135572408 ATTGGCAGATGGATGGATGGTGG - Intergenic
1062247723 9:135578053-135578075 ATGGGTGGGTGGATGGATGGTGG - Intergenic
1062247792 9:135578399-135578421 ATGGGTGGGTGGATGGATGGTGG - Intergenic
1062247861 9:135578745-135578767 ATGGGTGGGTGGATGGATGGTGG - Intergenic
1062469747 9:136697088-136697110 AGGGGGAGGGGGAAGGAGGAGGG - Intergenic
1185477504 X:424260-424282 ATGGCAAGGTGGAGGGTTGAAGG + Intergenic
1185497379 X:565747-565769 ATGGGTAGATGGATGCATGATGG + Intergenic
1185497422 X:566017-566039 ATGGGTAGATGGATGTATGATGG + Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185583246 X:1226853-1226875 ATGGGTTGGTGGATGGATGGGGG + Intergenic
1185583282 X:1227017-1227039 ATGGGTTGGTGGATGGATGGGGG + Intergenic
1185611439 X:1395707-1395729 ATGGGTGGGTGGATGGATAATGG + Intergenic
1185624530 X:1472964-1472986 ATGGGTGGGTGGATGGATGGGGG + Intronic
1185867840 X:3639225-3639247 GTGGGTGGGTGGATGGATGAAGG + Intronic
1185867929 X:3639453-3639475 GTGGGGGGGTGGATGGATGAAGG + Intronic
1185867951 X:3639516-3639538 GTGGGTGGGTGGATGGATGACGG + Intronic
1185867960 X:3639540-3639562 GTGGGTGGGTGGATGGATGAAGG + Intronic
1185910325 X:3974970-3974992 ATGGGCAGTGGGAAGAAAGATGG - Intergenic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186254987 X:7708686-7708708 ATGGGCAGGTGAAAAGAAGAAGG - Intergenic
1186401594 X:9265348-9265370 TTGGGGAGGTGGGGGGATGACGG + Intergenic
1187480180 X:19648235-19648257 ATGGGTAGGTGGAAGGAAGGAGG + Intronic
1187934109 X:24319314-24319336 TAGGGTAGGGGGAAGGATGAAGG + Intergenic
1190270639 X:48860581-48860603 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1190417446 X:50193953-50193975 ATGGACAGATTGAATGATGAAGG + Exonic
1190425474 X:50331179-50331201 ATGGGCAGTAGGAAGAAAGATGG + Intronic
1190445627 X:50520967-50520989 ATGGCCAGGTAGAAGTAGGAAGG + Intergenic
1190912924 X:54788788-54788810 TGGGGCAGGTGGAAAGATGTAGG - Intronic
1191715315 X:64190198-64190220 ATGGGCAGGTGTAGGTGTGAGGG + Exonic
1192050776 X:67722072-67722094 ATGGGGAGGGGGAATGAAGAAGG - Intronic
1192781026 X:74293757-74293779 ATGGGCTGAGGGAGGGATGATGG - Intergenic
1193308699 X:79979743-79979765 ATGGGAGGGTGGAAGGTGGAAGG - Intergenic
1193716226 X:84937409-84937431 AAGGGGAGATGGAGGGATGAAGG + Intergenic
1193772315 X:85602808-85602830 GTGAGCAGGTGGGAGGATGAGGG + Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1194951228 X:100128829-100128851 ATGGGCAGGGAGGAGGATGTAGG + Intergenic
1196009244 X:110869418-110869440 AGGGGCTGGAGGAGGGATGATGG + Intergenic
1196010050 X:110877056-110877078 GTGGGCAGCTTGAAGCATGATGG - Intergenic
1196024804 X:111030563-111030585 ATGGGTGGGTGGATGGATGAAGG + Intronic
1196459708 X:115917630-115917652 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
1196645731 X:118116305-118116327 ATGCGAAGGTGTAAGGATGAGGG + Intronic
1197077556 X:122371402-122371424 CTGGGAAGGTGGAGGGTTGAGGG - Intergenic
1197332733 X:125174067-125174089 AAGGGTAGCTGGAAGAATGATGG + Intergenic
1198975115 X:142327592-142327614 ATGGGGAGGTGGAAGTTTCAGGG + Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1200360277 X:155598059-155598081 AAAAGCAGGTGGAAGGGTGAAGG + Intronic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200943707 Y:8810500-8810522 ATGGGCAGTAGGAAGAAAGATGG - Intergenic
1201289470 Y:12408675-12408697 ATGGGTGGATGGATGGATGATGG - Intergenic
1201297117 Y:12473416-12473438 ATGGGCAGTAGGAAGAAAGATGG + Intergenic
1201305915 Y:12550408-12550430 ATGGGAAGGTGGATGGATGGGGG + Intergenic
1202152166 Y:21853446-21853468 ATGGGCAGTAGGAAAAATGATGG + Intergenic