ID: 1146006904

View in Genome Browser
Species Human (GRCh38)
Location 17:29166240-29166262
Sequence GAGAAGCCAAAGTCTCCAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146006898_1146006904 5 Left 1146006898 17:29166212-29166234 CCGATCCAGCATGGTTGTGCGCC 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 154
1146006894_1146006904 15 Left 1146006894 17:29166202-29166224 CCTCGGGGCCCCGATCCAGCATG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 154
1146006891_1146006904 29 Left 1146006891 17:29166188-29166210 CCGACAGGCCTGGCCCTCGGGGC 0: 1
1: 0
2: 2
3: 27
4: 298
Right 1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 154
1146006896_1146006904 7 Left 1146006896 17:29166210-29166232 CCCCGATCCAGCATGGTTGTGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 154
1146006899_1146006904 0 Left 1146006899 17:29166217-29166239 CCAGCATGGTTGTGCGCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 154
1146006893_1146006904 16 Left 1146006893 17:29166201-29166223 CCCTCGGGGCCCCGATCCAGCAT 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 154
1146006892_1146006904 21 Left 1146006892 17:29166196-29166218 CCTGGCCCTCGGGGCCCCGATCC 0: 1
1: 0
2: 0
3: 18
4: 271
Right 1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 154
1146006897_1146006904 6 Left 1146006897 17:29166211-29166233 CCCGATCCAGCATGGTTGTGCGC 0: 1
1: 0
2: 1
3: 4
4: 32
Right 1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146006904 Original CRISPR GAGAAGCCAAAGTCTCCAGT GGG Exonic
902979985 1:20115652-20115674 GAGCAGCCAGAGACCCCAGTAGG - Intronic
904258290 1:29271495-29271517 GAGATGCCTAAGTCTGAAGTTGG + Intronic
907540791 1:55214629-55214651 GAGAAGCCCCAGGCTCCAGTTGG - Intronic
907588208 1:55640425-55640447 GAGAAGCTCCAGTCTCCAGCAGG - Intergenic
908261006 1:62339171-62339193 GAGAAGCCAAACAGCCCAGTTGG - Intergenic
912499457 1:110112452-110112474 GAGAAGCCAACATCTCCCGCAGG + Exonic
912592321 1:110835969-110835991 GAAAACCCAAAGACTCCAGTAGG - Intergenic
912651560 1:111443989-111444011 CATAGGCCAAAGTCTCTAGTGGG - Intronic
913130792 1:115837630-115837652 GAGAACTCAAAGTCTCCAGTGGG + Exonic
915512250 1:156392708-156392730 GAGAAGCCCAAGCCCCCAGCTGG - Intergenic
918435858 1:184512113-184512135 CAGAAACCAAAGCCTCCTGTGGG - Intronic
921558342 1:216626464-216626486 GTGGAGCCACAGTATCCAGTAGG - Intronic
1063128465 10:3156427-3156449 GTGAAGGGAAACTCTCCAGTAGG - Intronic
1063803272 10:9606188-9606210 GAAGAGGCAAATTCTCCAGTGGG + Intergenic
1065179057 10:23106752-23106774 GAGAAGCCATGGCCTCCACTAGG - Intronic
1068168954 10:53368728-53368750 GTAAAACCAAAGTCCCCAGTTGG - Intergenic
1070348604 10:75569979-75570001 GCAAAGCAAAAGTCTCCTGTGGG - Intronic
1071983875 10:91031479-91031501 CAGAAGCAAAAGTCTCCAGGAGG + Intergenic
1072312293 10:94168072-94168094 GAAGAGCCACAGTGTCCAGTGGG + Intronic
1073120955 10:101122340-101122362 GAGAAGGCAAAGTTGCCCGTGGG + Intronic
1074338247 10:112599877-112599899 GAGCATAGAAAGTCTCCAGTGGG - Intronic
1076836363 10:133023058-133023080 CTGAAGCCAAAATCTCCACTAGG - Intergenic
1077917747 11:6622269-6622291 GGGAAGCCATAGTCCCCAGTGGG + Exonic
1078054256 11:7994394-7994416 GAGAAGCCAAAGTAAACAGATGG - Intronic
1079136878 11:17780393-17780415 GAGAAGCCTCTCTCTCCAGTGGG - Intronic
1081563042 11:44236617-44236639 CAGAAGCCAAATTCTCCATGTGG + Intronic
1084987422 11:72888322-72888344 GAGAAATCAAAGTGTCCACTTGG + Intronic
1085199268 11:74691899-74691921 GAGATGCCATTGTGTCCAGTGGG + Intergenic
1088897187 11:114087503-114087525 ATGATGCCAAAGTCTGCAGTTGG - Intronic
1089860925 11:121589474-121589496 GGGAAGGCCAAGTCTGCAGTGGG - Intronic
1091171307 11:133521839-133521861 GAGAAGCCAAAGGCTTCTGTAGG + Intronic
1091666949 12:2425845-2425867 GAGAAGAAAAAGTTTCCAGAGGG + Intronic
1094427997 12:30336080-30336102 GCAAAACCAAAGTCTCCAGGTGG + Intergenic
1100635309 12:96429880-96429902 GAGAAGCCAAAGTGTCCATTAGG + Intergenic
1100639641 12:96470368-96470390 GGGAAGTCAAAGTCCCCATTGGG + Intergenic
1101264368 12:103067774-103067796 GAGAGCCCAAAGTGTCCAGGTGG - Intergenic
1104030094 12:125058802-125058824 TAAAGGCCAAAGTCTCCACTGGG + Intergenic
1111894928 13:94129553-94129575 CACAAGCCAAAGTCTCTGGTGGG - Intronic
1112735238 13:102408819-102408841 GATAAGCCAACTACTCCAGTGGG - Intergenic
1114403816 14:22435277-22435299 GAGAAGACCAAGTCAGCAGTGGG - Intergenic
1114406072 14:22457444-22457466 CAGTAGACAATGTCTCCAGTAGG - Intergenic
1114554817 14:23555953-23555975 GAGATGGCAAAGTCTCCCTTTGG + Intronic
1114758028 14:25282240-25282262 GGGAACCCAAAGTGTCCAGGTGG + Intergenic
1115059930 14:29175524-29175546 GAGGAGCCCAAGTGTCCAGGTGG - Intergenic
1116310824 14:43324733-43324755 GAGTAGCCAAAGTCTGCCTTGGG - Intergenic
1116928332 14:50664879-50664901 GAGAATTTAATGTCTCCAGTTGG - Intronic
1117819737 14:59635594-59635616 GAGTTGCCAAAGTCTACAGCTGG - Intronic
1119085750 14:71737368-71737390 GAGAACCCAAAGTCTTCCATCGG - Intronic
1121424278 14:93837321-93837343 GAGAAGCCAAGGCTTCCAGCAGG + Intergenic
1122695207 14:103549061-103549083 GAGAAGCCAGAGAGCCCAGTGGG - Intergenic
1123403848 15:20009281-20009303 GTGGAGCCAAAGTGTCCAGGAGG + Intergenic
1123513187 15:21015927-21015949 GTGGAGCCAAAGTGTCCAGGAGG + Intergenic
1125797574 15:42414862-42414884 GAGAAGCCAAACTGTTCTGTGGG - Exonic
1125921440 15:43527963-43527985 GAGAAGCCAAAGGCTGAAGCAGG - Exonic
1127201176 15:56653324-56653346 CATAAGCCAAAGCCCCCAGTGGG + Intronic
1128714489 15:69897627-69897649 GAGAAGCCAAGGCCCTCAGTTGG + Intergenic
1129061593 15:72864635-72864657 GAGAAGCCGTAGTCTCCAACGGG + Intergenic
1133326915 16:4947502-4947524 CAGGAGACAAAGTCTGCAGTCGG + Intronic
1134255188 16:12604470-12604492 GAGAATCGACAGTCTCAAGTGGG + Intergenic
1134821444 16:17250749-17250771 GAGATGCCAAAGGGCCCAGTTGG + Intronic
1142142942 16:88480617-88480639 GATGAGCCTAAGTCCCCAGTGGG - Intronic
1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG + Exonic
1146639214 17:34527422-34527444 GAGATGCCAAGGTCCCCAGAAGG - Intergenic
1146947746 17:36885238-36885260 GAGGCGGCAAAGCCTCCAGTGGG + Intergenic
1148902351 17:50887936-50887958 GAGAAGACTGAGTCTCAAGTGGG - Intergenic
1149162592 17:53712157-53712179 GAGCACCCAAAGTCTAAAGTTGG + Intergenic
1150613079 17:66749205-66749227 GAGAAGCCAAAGCCTTCACAGGG + Intronic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1153174749 18:2358152-2358174 AAGAAGGCAATGTCTCCACTAGG + Intergenic
1154082020 18:11267000-11267022 GTGAAGGCACAGTCTTCAGTCGG + Intergenic
1155650771 18:28138796-28138818 GTGACGCCAAAGTCACCAGTGGG + Intronic
1156844145 18:41644432-41644454 CATAAGCCAAAGTCTCAACTAGG + Intergenic
1158721482 18:59929179-59929201 GAGAATGCAAAGACTCCACTGGG - Intergenic
1158829339 18:61260403-61260425 AAGCAGCCAGACTCTCCAGTGGG + Intergenic
1160078973 18:75704584-75704606 GTGATGCCAAGGTCTCCTGTGGG - Intergenic
1160949222 19:1657740-1657762 AAGAAGGCACAGTCCCCAGTCGG + Intergenic
1165372957 19:35421360-35421382 GAGCATCCAAGGTCTCCAGGCGG + Intergenic
1166939714 19:46355403-46355425 GAGAAGCACGAGTCTGCAGTCGG + Intronic
1168144127 19:54410036-54410058 AAAAAGACAAAGTCTCCAGTTGG - Intergenic
925809764 2:7687673-7687695 GGGAAGCCAGAGTTTCCAGGTGG - Intergenic
926645407 2:15285586-15285608 GAAAAGGCCAAGTCTGCAGTTGG - Intronic
928461246 2:31474921-31474943 GAGAAGCCAAAGAATCAAGCTGG - Intergenic
928584568 2:32745770-32745792 GAGCAGCCAGAGTCTCATGTTGG + Intronic
928868876 2:35951055-35951077 GAGAAGCCAAAGGCTTCTTTGGG + Intergenic
929020681 2:37549600-37549622 GAGAACCTCAAGTCACCAGTGGG - Intergenic
931797276 2:65723284-65723306 GAGAAGCTGAAGCTTCCAGTGGG - Intergenic
932852318 2:75199435-75199457 GAGAAGGAAAAATCTCCAGCTGG - Exonic
933692886 2:85193280-85193302 GAGGAGCCAAAGTCTCAGGCAGG + Intronic
939268842 2:139912052-139912074 GAGGAGGCCCAGTCTCCAGTCGG + Intergenic
939444710 2:142293304-142293326 GCAAAGCCAAAATTTCCAGTTGG - Intergenic
945423588 2:209670425-209670447 TAGAAGCAAAATTTTCCAGTAGG + Intronic
945545070 2:211139753-211139775 AAGAATCCAAAGTGTCCAGGTGG - Intergenic
1168842742 20:920206-920228 CAAAAGCCAAAGTATCCAGGTGG - Intergenic
1169737121 20:8849155-8849177 GAGAAGCCAAACACTCAAGTGGG + Intronic
1171013531 20:21521588-21521610 GAGAAGCCCCTGTCTCCACTGGG + Intergenic
1172091117 20:32433641-32433663 GAGAAGCCACAGACTCAACTGGG - Exonic
1174081184 20:47971835-47971857 GAGAGGCCAAAGGCACCCGTGGG + Intergenic
1174286204 20:49475463-49475485 GAGAAGCCAAACTCTGAACTTGG + Intronic
1178074464 21:29002387-29002409 GAAAAGCCAAATGCCCCAGTGGG + Intergenic
1178485773 21:33019566-33019588 CATAAGCCAAAGTCCCCAGGTGG - Intergenic
1180045002 21:45301263-45301285 GAGATCCCCACGTCTCCAGTCGG + Intergenic
1181166156 22:20984141-20984163 GGGAAGCAATGGTCTCCAGTTGG - Intronic
1181457692 22:23069129-23069151 GAGATGCCACAGTGTCCAGCTGG + Intronic
1184122196 22:42459195-42459217 GAGAAACCAAAGGCTCGAGCAGG - Intergenic
1184341997 22:43891282-43891304 GAGCAGCAGAAGTCTGCAGTGGG + Exonic
1184946682 22:47808807-47808829 GAGCAGCAAAACTCTCCATTAGG - Intergenic
949876804 3:8631627-8631649 GAGAAGCTTAGGCCTCCAGTGGG + Intronic
950485876 3:13273782-13273804 TCAAAGCCAAAGTCCCCAGTGGG + Intergenic
951064611 3:18249310-18249332 CAGAAACCAAAGAATCCAGTGGG + Intronic
951086771 3:18520914-18520936 AGGAACCCAAAGTCTCCAGGTGG - Intergenic
951891810 3:27574617-27574639 GAGAAGCCATAGGCCCCAGCTGG - Intergenic
952417788 3:33105285-33105307 GAGGAGCCAGAGACTCCAGATGG - Intergenic
952420713 3:33128796-33128818 TAGAAGCAAAAGACTCCAGAAGG - Intronic
953100557 3:39821418-39821440 GAGAAGACAAAGTCAAAAGTTGG - Intronic
954883654 3:53853481-53853503 GAGAATCTACAGACTCCAGTTGG + Intronic
955579796 3:60406648-60406670 GAGAAGCCAAATTCTAGAGAAGG + Intronic
955928950 3:64036599-64036621 GAGAAGCCAATTGGTCCAGTTGG + Intergenic
955959286 3:64322433-64322455 GAGCAGCCAAAGTTTCCCTTGGG + Intronic
960611536 3:119559273-119559295 GGGAAGCCACAGCCTCCTGTGGG + Intronic
963115699 3:141727308-141727330 GGGAAGGCAAAGTCTTCAGTAGG - Intergenic
969141287 4:5076154-5076176 GAGAACCCAAAGTCAAAAGTTGG + Intronic
969192811 4:5535898-5535920 TAGAAGACAAAGGCTGCAGTGGG - Intergenic
970035931 4:11736059-11736081 CAGAAGAAAAAGTCTCAAGTTGG - Intergenic
971010055 4:22424257-22424279 GGGAAGCTAAAGCCTGCAGTAGG - Exonic
973122301 4:46537036-46537058 GAGAAAACAAAGTCTCCCTTTGG - Intergenic
977553776 4:98468524-98468546 GAGAAGCCAAACTCTGAACTTGG - Intergenic
978809529 4:112835281-112835303 GATAAACCAAAGTATACAGTTGG + Intronic
979756489 4:124346525-124346547 GAGAAGGAAAAGTTTCCAGAAGG - Intergenic
980169424 4:129270699-129270721 GATATGGCAAAGTCACCAGTAGG + Intergenic
981366574 4:143911216-143911238 GAGAATTTAATGTCTCCAGTTGG - Intergenic
984554312 4:181195753-181195775 GAGAAGCCAGAGTCTGAAGCAGG - Intergenic
985553864 5:546649-546671 GCCAAGCCTCAGTCTCCAGTCGG - Intergenic
988205076 5:28123712-28123734 GAGGAGCCAAAGTGTCCAGGTGG + Intergenic
988445542 5:31282310-31282332 GAGAAGCCAAAGAATGCAGGTGG - Intronic
991248188 5:64530032-64530054 TAGAAGCCAAAGTGTTCAGATGG + Intronic
998053425 5:139055431-139055453 GAGAAGGCACACTCTGCAGTAGG - Intronic
998638268 5:143981379-143981401 GAGAAGCCAAAATGTCAGGTGGG - Intergenic
1001889047 5:175323737-175323759 GAGAAAGCTAAGTCTACAGTTGG - Intergenic
1006913105 6:37577024-37577046 CAGAAGCCCATATCTCCAGTTGG + Intergenic
1007857087 6:44868938-44868960 GAGAAGCCAGGGTCAGCAGTAGG - Intronic
1008195344 6:48512461-48512483 CAGGAGCAAAACTCTCCAGTTGG - Intergenic
1008396953 6:51019935-51019957 GAGCAGCCAAAGTCTACTCTAGG - Intergenic
1014304109 6:119718832-119718854 AAGAAGTTAAAGTCTCCAGGGGG - Intergenic
1022261507 7:28709597-28709619 AACAAGGCAAAGTCTCCAGCAGG + Intronic
1026177373 7:68009732-68009754 AAGATGCCACAGTCACCAGTAGG + Intergenic
1026215277 7:68342942-68342964 GAAAATACAAAGTCCCCAGTGGG + Intergenic
1029350831 7:100011777-100011799 GAGAAGCCACAGCTTCCAATAGG + Intergenic
1030355638 7:108539164-108539186 GAGGAGCCCAAGTGTCCAGGTGG - Intronic
1031904214 7:127442997-127443019 GAGAAGAAAAAGAATCCAGTGGG - Intergenic
1032559993 7:132879550-132879572 CAGAAGCCACAGTCTCCCATGGG - Intronic
1032851057 7:135795679-135795701 GAGAATCCAAATTCTACTGTCGG - Intergenic
1037744639 8:21632956-21632978 GAGAAGCCAACGTGACCACTTGG - Intergenic
1040105489 8:43539236-43539258 CAGGAGCCCAAGTATCCAGTTGG + Intergenic
1043432361 8:80207396-80207418 GAAAATCCAAGGACTCCAGTTGG + Intronic
1043508421 8:80925310-80925332 AAGAAGCAAAACTCTCCAGTGGG + Intergenic
1045404942 8:101856410-101856432 GAGAAGCCAAGGTCGGCAGATGG - Intronic
1046381285 8:113453773-113453795 GAAAAGCATAATTCTCCAGTTGG - Intergenic
1052368877 9:27642476-27642498 GAGGAGCCCAAGTGTCCAGGTGG - Intergenic
1052535941 9:29747574-29747596 GAGAAGCCAAGGAATGCAGTGGG - Intergenic
1053176619 9:35930107-35930129 GAGAAGGAGAAGTCCCCAGTAGG + Intergenic
1056424961 9:86466759-86466781 AGGAAGCCAGAGTCTCCTGTGGG - Intergenic
1056449231 9:86699432-86699454 GAGAAGCCAGAGTCAGCAGAGGG + Intergenic
1056521525 9:87406397-87406419 GAGAAGCCAAGGCCTCCTGTGGG - Intergenic
1058082031 9:100710730-100710752 CATAAGCCAAAGTCACAAGTTGG + Intergenic
1059439789 9:114300628-114300650 TTGAAGCCAATGTCTCCAGGCGG - Exonic
1061700146 9:132409825-132409847 GAGAACCGAGAATCTCCAGTGGG - Intergenic
1188772454 X:34169438-34169460 TAGAATCTAAAGTCTACAGTGGG + Intergenic
1189466809 X:41283825-41283847 GAGAAACCAAGTTCTCCAGTGGG - Intergenic
1189488685 X:41452735-41452757 GAGAAGTCAATGTTTCCAGAGGG - Intronic
1190389128 X:49914229-49914251 GAAAATCCAAACTCTCCATTAGG - Intergenic
1200213435 X:154356941-154356963 GAGACCCCAAAGTCCCCAGTGGG + Intronic