ID: 1146008416

View in Genome Browser
Species Human (GRCh38)
Location 17:29176830-29176852
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008416_1146008425 5 Left 1146008416 17:29176830-29176852 CCCTCACGCCGCCGCGCGGGGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1146008425 17:29176858-29176880 CGGCCCTTGGCGTTTCCCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 51
1146008416_1146008423 -8 Left 1146008416 17:29176830-29176852 CCCTCACGCCGCCGCGCGGGGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1146008423 17:29176845-29176867 GCGGGGAGCCGGGCGGCCCTTGG 0: 1
1: 0
2: 5
3: 49
4: 379
1146008416_1146008430 14 Left 1146008416 17:29176830-29176852 CCCTCACGCCGCCGCGCGGGGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1146008430 17:29176867-29176889 GCGTTTCCCCGCGGCTGGGCCGG 0: 1
1: 0
2: 3
3: 18
4: 134
1146008416_1146008428 9 Left 1146008416 17:29176830-29176852 CCCTCACGCCGCCGCGCGGGGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1146008428 17:29176862-29176884 CCTTGGCGTTTCCCCGCGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 40
1146008416_1146008429 10 Left 1146008416 17:29176830-29176852 CCCTCACGCCGCCGCGCGGGGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1146008429 17:29176863-29176885 CTTGGCGTTTCCCCGCGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008416 Original CRISPR CTCCCCGCGCGGCGGCGTGA GGG (reversed) Intronic