ID: 1146008422

View in Genome Browser
Species Human (GRCh38)
Location 17:29176841-29176863
Sequence GGGCCGCCCGGCTCCCCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008422_1146008430 3 Left 1146008422 17:29176841-29176863 CCGCGCGGGGAGCCGGGCGGCCC 0: 1
1: 0
2: 4
3: 35
4: 258
Right 1146008430 17:29176867-29176889 GCGTTTCCCCGCGGCTGGGCCGG 0: 1
1: 0
2: 3
3: 18
4: 134
1146008422_1146008429 -1 Left 1146008422 17:29176841-29176863 CCGCGCGGGGAGCCGGGCGGCCC 0: 1
1: 0
2: 4
3: 35
4: 258
Right 1146008429 17:29176863-29176885 CTTGGCGTTTCCCCGCGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 45
1146008422_1146008435 22 Left 1146008422 17:29176841-29176863 CCGCGCGGGGAGCCGGGCGGCCC 0: 1
1: 0
2: 4
3: 35
4: 258
Right 1146008435 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 7
3: 27
4: 354
1146008422_1146008425 -6 Left 1146008422 17:29176841-29176863 CCGCGCGGGGAGCCGGGCGGCCC 0: 1
1: 0
2: 4
3: 35
4: 258
Right 1146008425 17:29176858-29176880 CGGCCCTTGGCGTTTCCCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 51
1146008422_1146008428 -2 Left 1146008422 17:29176841-29176863 CCGCGCGGGGAGCCGGGCGGCCC 0: 1
1: 0
2: 4
3: 35
4: 258
Right 1146008428 17:29176862-29176884 CCTTGGCGTTTCCCCGCGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008422 Original CRISPR GGGCCGCCCGGCTCCCCGCG CGG (reversed) Intronic