ID: 1146008423

View in Genome Browser
Species Human (GRCh38)
Location 17:29176845-29176867
Sequence GCGGGGAGCCGGGCGGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 379}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008411_1146008423 25 Left 1146008411 17:29176797-29176819 CCGACTGCACGCTTCTCACGTGA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1146008423 17:29176845-29176867 GCGGGGAGCCGGGCGGCCCTTGG 0: 1
1: 0
2: 5
3: 49
4: 379
1146008417_1146008423 -9 Left 1146008417 17:29176831-29176853 CCTCACGCCGCCGCGCGGGGAGC 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1146008423 17:29176845-29176867 GCGGGGAGCCGGGCGGCCCTTGG 0: 1
1: 0
2: 5
3: 49
4: 379
1146008416_1146008423 -8 Left 1146008416 17:29176830-29176852 CCCTCACGCCGCCGCGCGGGGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1146008423 17:29176845-29176867 GCGGGGAGCCGGGCGGCCCTTGG 0: 1
1: 0
2: 5
3: 49
4: 379
1146008412_1146008423 -4 Left 1146008412 17:29176826-29176848 CCAGCCCTCACGCCGCCGCGCGG 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1146008423 17:29176845-29176867 GCGGGGAGCCGGGCGGCCCTTGG 0: 1
1: 0
2: 5
3: 49
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008423 Original CRISPR GCGGGGAGCCGGGCGGCCCT TGG Intronic