ID: 1146008424

View in Genome Browser
Species Human (GRCh38)
Location 17:29176853-29176875
Sequence GGGAAACGCCAAGGGCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146008424_1146008430 -9 Left 1146008424 17:29176853-29176875 CCGGGCGGCCCTTGGCGTTTCCC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1146008430 17:29176867-29176889 GCGTTTCCCCGCGGCTGGGCCGG 0: 1
1: 0
2: 3
3: 18
4: 134
1146008424_1146008435 10 Left 1146008424 17:29176853-29176875 CCGGGCGGCCCTTGGCGTTTCCC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1146008435 17:29176886-29176908 CCGGCGCAGCCGCAGCCCCGCGG 0: 1
1: 0
2: 7
3: 27
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146008424 Original CRISPR GGGAAACGCCAAGGGCCGCC CGG (reversed) Intronic