ID: 1146008427 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:29176862-29176884 |
| Sequence | CCAGCCGCGGGGAAACGCCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 77 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 74} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1146008427_1146008435 | 1 | Left | 1146008427 | 17:29176862-29176884 | CCTTGGCGTTTCCCCGCGGCTGG | 0: 1 1: 0 2: 0 3: 2 4: 74 |
||
| Right | 1146008435 | 17:29176886-29176908 | CCGGCGCAGCCGCAGCCCCGCGG | 0: 1 1: 0 2: 7 3: 27 4: 354 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1146008427 | Original CRISPR | CCAGCCGCGGGGAAACGCCA AGG (reversed) | Intronic | ||